ID: 1085084316

View in Genome Browser
Species Human (GRCh38)
Location 11:73656611-73656633
Sequence TGGGGACAGAGAAAAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 480}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085084316_1085084331 18 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084331 11:73656652-73656674 GGCATGGGGTGGGTGGCAGGAGG 0: 1
1: 0
2: 42
3: 314
4: 2064
1085084316_1085084333 20 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084333 11:73656654-73656676 CATGGGGTGGGTGGCAGGAGGGG 0: 1
1: 0
2: 11
3: 130
4: 927
1085084316_1085084324 3 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084324 11:73656637-73656659 CTCAGCACAGGGCCTGGCATGGG 0: 1
1: 4
2: 27
3: 147
4: 680
1085084316_1085084327 8 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084327 11:73656642-73656664 CACAGGGCCTGGCATGGGGTGGG 0: 1
1: 3
2: 64
3: 644
4: 2714
1085084316_1085084330 15 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084316_1085084325 4 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084325 11:73656638-73656660 TCAGCACAGGGCCTGGCATGGGG 0: 2
1: 3
2: 47
3: 227
4: 989
1085084316_1085084334 21 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084334 11:73656655-73656677 ATGGGGTGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 39
3: 440
4: 3158
1085084316_1085084322 -3 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084322 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 3
2: 40
3: 311
4: 1406
1085084316_1085084317 -9 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084317 11:73656625-73656647 CTGTCCCCAGAACTCAGCACAGG 0: 1
1: 0
2: 5
3: 49
4: 375
1085084316_1085084326 7 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084326 11:73656641-73656663 GCACAGGGCCTGGCATGGGGTGG 0: 1
1: 2
2: 19
3: 164
4: 1212
1085084316_1085084328 11 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084328 11:73656645-73656667 AGGGCCTGGCATGGGGTGGGTGG 0: 2
1: 158
2: 979
3: 3064
4: 7190
1085084316_1085084318 -8 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084318 11:73656626-73656648 TGTCCCCAGAACTCAGCACAGGG 0: 1
1: 1
2: 9
3: 89
4: 432
1085084316_1085084332 19 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084332 11:73656653-73656675 GCATGGGGTGGGTGGCAGGAGGG 0: 1
1: 0
2: 7
3: 122
4: 1021
1085084316_1085084323 2 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084323 11:73656636-73656658 ACTCAGCACAGGGCCTGGCATGG 0: 1
1: 4
2: 30
3: 133
4: 644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085084316 Original CRISPR TGGGGACAGAGAAAAGATTC AGG (reversed) Intronic
900637312 1:3672285-3672307 TGGGGAAAGAAAGAAGATTCTGG + Intronic
901029049 1:6295728-6295750 TGGGGACAGAGGGTAGATTAGGG + Intronic
901419394 1:9140240-9140262 TGGGGACAGAAAGTAGAATCAGG - Intergenic
901422801 1:9162348-9162370 GGGGGACAGAGGAAAAATCCTGG + Intergenic
901817825 1:11805194-11805216 TGGGGAAAGAGAAAGGAGACAGG - Intronic
902311324 1:15584109-15584131 TGGGGACACAGAGAAGGTTCAGG + Intronic
902682924 1:18056480-18056502 TGGGGGCAGAGGTGAGATTCTGG + Intergenic
902798217 1:18813377-18813399 TGGAGACAGAGTCAAGATTTGGG + Intergenic
902919032 1:19655724-19655746 TCGGGACAGGGCAAAGATTTTGG - Intronic
904149783 1:28428397-28428419 AGGGGATAGGGAGAAGATTCTGG - Intronic
904714489 1:32457093-32457115 TGGGGAAAAAGAAATGATCCTGG - Intergenic
905803233 1:40859220-40859242 AGGGGAGAGAGAAGAGAATCAGG + Intergenic
906493672 1:46287468-46287490 TGGGGACAGGGAAAGCAATCAGG - Intronic
906813204 1:48850437-48850459 TGGGGCCTGAGACAAGAGTCTGG - Intronic
906856108 1:49306720-49306742 TGGGGATAGAGAAGAAATTATGG + Intronic
908433505 1:64082051-64082073 TGGGGCCAGAGATAAAATTTTGG + Intronic
908647807 1:66298273-66298295 TGGTGAAAGAGAAAACATTTTGG + Intronic
909127022 1:71685547-71685569 TGCGGACAGAGAACAAAGTCAGG - Intronic
909581884 1:77245964-77245986 AGGGGACTGAGAAAAGATGTGGG + Intergenic
909953041 1:81742822-81742844 TGGAGACAGAGAAAAATTTGTGG - Intronic
911042202 1:93599870-93599892 TGGGGATAGGTAAAAGAATCAGG - Intronic
911669138 1:100588353-100588375 TGGAGACAGAGAAAAGCTGCTGG - Intergenic
911687454 1:100793377-100793399 AAGGGACACAGAAAAGATTAAGG + Intergenic
912089321 1:106051231-106051253 TGGGGACAGAGTAAGTGTTCAGG + Intergenic
912890020 1:113520343-113520365 TAGGGACATAGAAATGAATCAGG + Intronic
912947828 1:114099275-114099297 TGGGGACAGAGAAAAGGGAATGG + Intronic
913177947 1:116292144-116292166 TTGGAACAGAGAAAAGCTCCAGG - Intergenic
913427553 1:118750834-118750856 TGAGTACAGAGAGAAGAATCAGG - Intergenic
915565519 1:156710687-156710709 TGGGGACAGAAAGAGGATTTTGG + Intergenic
915935116 1:160085958-160085980 TGGGGGAAGAGGAAAGAGTCGGG - Intronic
916164656 1:161955253-161955275 TGGGGAAACAGAGAAGACTCTGG - Intronic
916180654 1:162080586-162080608 TGGGGAGAGAGAAAGGAGACAGG + Intronic
916867419 1:168875458-168875480 CAGGGACAGAGAAAAAATACTGG + Intergenic
917334262 1:173912320-173912342 TCTGGACAGAGAAGAGAATCAGG + Intronic
918896448 1:190354059-190354081 TGGTGACAGAGAAATGAGACTGG - Intronic
921179757 1:212622922-212622944 TGGGGACAGTGAAAAAGTTCTGG - Intergenic
921963610 1:221063413-221063435 AGGGAACAGAGAAAAGAATCAGG + Intergenic
921999268 1:221458310-221458332 TGGGGCCAGAGAACAGGATCCGG - Intergenic
922538861 1:226403890-226403912 CGGGGACAGGGAAAATACTCTGG + Intronic
922988544 1:229885784-229885806 TGGCTACAGAGAAAGGCTTCAGG - Intergenic
923029923 1:230240897-230240919 GGTGGACAGAGAAAAAATTAAGG - Intronic
923103768 1:230838457-230838479 TGGAGCCAGATAAAATATTCTGG + Exonic
924008025 1:239633570-239633592 TGGCCACAGAAAAAAGAGTCTGG - Intronic
924427010 1:243960750-243960772 TGGGAAAAGAGAAAAAATGCTGG + Intergenic
1063313435 10:4978489-4978511 TGGGCACACATCAAAGATTCAGG - Exonic
1063314517 10:4989228-4989250 TGGGCACACATCAAAGATTCAGG + Exonic
1064005646 10:11696860-11696882 TGGGGACAGACCTAAGATACAGG - Intergenic
1064038861 10:11940358-11940380 TGTGGACAGAGAAGAGAAGCAGG - Intronic
1065062706 10:21922750-21922772 TGTGGATTGAGAATAGATTCAGG - Intronic
1065178757 10:23104412-23104434 TGTGTCCAGAGAAAAGTTTCAGG - Intronic
1065519644 10:26559188-26559210 TGGGGATAGAGACAAGATAGAGG + Intronic
1065770050 10:29069705-29069727 TGGGGACTGAGAGAAAATTCAGG + Intergenic
1067157082 10:43791379-43791401 TGGGGGCAGATAAGAGCTTCTGG + Intergenic
1068201643 10:53790950-53790972 AGGAGAAAGAGAAAAGATTGTGG + Intergenic
1068535808 10:58240469-58240491 ATGGGCCAGAGAAAAAATTCTGG + Intronic
1068630323 10:59291119-59291141 GGGGCTCAGAGAAAAGCTTCTGG - Intronic
1068768720 10:60796591-60796613 TGGGGACAATGAAAAGATAGAGG + Intergenic
1069756922 10:70779121-70779143 TGGGGACAGGGAAGAGATCCTGG - Intronic
1069983986 10:72271604-72271626 TTTGGACAGAAAAAAAATTCAGG - Intergenic
1070661996 10:78313667-78313689 TGGGGACACAGAGATGAGTCTGG + Intergenic
1071269744 10:83996030-83996052 TGGTGACAGAGAAAAGAGCAAGG + Intergenic
1071676020 10:87657092-87657114 AGGGGACAGAGGAAGGATTGAGG - Intergenic
1071906295 10:90177898-90177920 TGGGGACAGAGGAAGGAGTTGGG + Intergenic
1074915967 10:117955328-117955350 TCGGGGCAGAGAAAGGATGCTGG - Intergenic
1074980704 10:118617761-118617783 TGCAGAGAGAGGAAAGATTCAGG + Intergenic
1075161807 10:120030974-120030996 TGGGGACAGCAAAAACATCCAGG - Intergenic
1075430921 10:122380339-122380361 TGGGGAAACAGACAAGAATCAGG + Intronic
1076267171 10:129117973-129117995 TGGGGACAGAGTGAAGATCTTGG + Intergenic
1076269275 10:129136658-129136680 GGGGGCCAGAGAAAAGACTTGGG - Intergenic
1077921675 11:6646548-6646570 TGGGGAAAGAGACAAGATGGAGG - Intronic
1077980383 11:7294067-7294089 TGAGGACACAGAAAATATGCTGG - Intronic
1078317107 11:10303314-10303336 TGAGGACGGAGGACAGATTCCGG - Intergenic
1078747190 11:14126807-14126829 GGAGGAGAGAGAAAAGACTCAGG - Intronic
1078776544 11:14399029-14399051 AGGGCAAAGAGAAAAAATTCGGG + Intergenic
1078854654 11:15197267-15197289 TTGAAGCAGAGAAAAGATTCAGG + Intronic
1078934063 11:15936879-15936901 TGGGGAAAGAGGAGAGAATCAGG - Intergenic
1079992966 11:27266081-27266103 GGGAAACAGAGAAGAGATTCTGG + Intergenic
1080785195 11:35469109-35469131 TGGAGCAAGAGAAAAGATTTAGG + Intronic
1081720573 11:45285769-45285791 TGGGGACTGAGAGAAGAATGGGG - Intronic
1083105384 11:60353171-60353193 TTGGGAGAGAGATAAGATCCTGG - Intronic
1083327967 11:61883151-61883173 TGGGGAAGGTGAAAAGGTTCTGG - Intronic
1083569476 11:63750109-63750131 TGGTGACAGAGAGAAGAGCCAGG - Exonic
1083906160 11:65672355-65672377 TGGGGATGATGAAAAGATTCTGG + Intergenic
1084667249 11:70583054-70583076 GGGGGACAGAGGGAAGATTGGGG + Intronic
1084778686 11:71394913-71394935 TGGTGCCAGGGAAAAGATTAGGG + Intergenic
1085084316 11:73656611-73656633 TGGGGACAGAGAAAAGATTCAGG - Intronic
1085107696 11:73860048-73860070 AGTGGACAGAGAAAAGAACCAGG - Intronic
1085306126 11:75487054-75487076 GGGGGAGACAGGAAAGATTCTGG + Intronic
1085618740 11:78021958-78021980 TGGGGTCAGAGAAAGGAGTGCGG - Intronic
1086965678 11:93025672-93025694 TGGTGACTCAGAAAAGATTTTGG - Intergenic
1087002230 11:93432653-93432675 TGAGGATAGAGACAAGATACAGG + Intronic
1087211223 11:95447569-95447591 TGGGGACAGAGGACAGGTGCAGG + Intergenic
1087262018 11:96022270-96022292 TGGGGTCTCAGGAAAGATTCAGG - Intronic
1087345679 11:96968193-96968215 TAGGGACAGAAAAAAGATATTGG + Intergenic
1087851992 11:103042367-103042389 TGGGGAAAGAGCAAGGATTGGGG + Intergenic
1088089311 11:106019612-106019634 TGGGAACAGTGAAGAGATCCTGG - Intronic
1088889567 11:114033868-114033890 TACGGACAGAGGAAAGCTTCCGG - Intergenic
1088996126 11:114998781-114998803 TGGGGATAGAGAAATAAATCAGG + Intergenic
1089191160 11:116654221-116654243 TGGGGCCTGAGAAAAGATGATGG + Intergenic
1089638106 11:119829608-119829630 TGGGGACTGAGTTAAGCTTCTGG - Intergenic
1089703755 11:120261717-120261739 TGTAGACAGTGACAAGATTCTGG + Intronic
1090012566 11:123058293-123058315 TGAGGACAAACAGAAGATTCTGG - Exonic
1090203496 11:124872357-124872379 TGGGGACAGAGCAAGGAACCAGG - Intronic
1090208571 11:124899306-124899328 TGGGGCCAGAGAACAGAATTTGG - Intergenic
1090411881 11:126514907-126514929 TGACGACAGAGAACAGAGTCTGG - Intronic
1090492795 11:127179933-127179955 TGGTGAAAGAGAAAATATTCTGG + Intergenic
1090802818 11:130184104-130184126 TGGGGACAGGAAATGGATTCAGG + Intronic
1091895423 12:4099274-4099296 TGAGGACAAAGAGAAGATTCTGG + Intergenic
1092356394 12:7798936-7798958 CTGGGACAGACAAAAGCTTCCGG + Exonic
1092369624 12:7905893-7905915 CTGGGACAGACAAAAGCTTCCGG + Intergenic
1092534147 12:9371937-9371959 TGAGGACAGAGAAAAGAAAAAGG - Intergenic
1092700876 12:11229392-11229414 TGGGGACACAGTAGATATTCAGG + Intergenic
1092924363 12:13260081-13260103 TTGGGACAGTGAAAAGTTTTTGG + Intergenic
1093007057 12:14062394-14062416 TAGGGAAAGAGGACAGATTCTGG - Intergenic
1093082972 12:14835146-14835168 TGGGGACACAGAATAGCTTGTGG + Intronic
1094052707 12:26238638-26238660 AGGGGACAGAGAGATGAATCAGG - Intronic
1094368228 12:29706861-29706883 TGGGTAAAGAGAAAAGAATGAGG + Intronic
1094707593 12:32929337-32929359 AGGGGACAGAGGAAAAATCCAGG - Intergenic
1096430267 12:51537457-51537479 TAGGGACAGAGAACAGATTGTGG - Intergenic
1097637017 12:62134998-62135020 TGGGGTCAGAGAAAGCCTTCTGG - Intronic
1097823677 12:64153278-64153300 TGTGGACAGAGATCAGATTTTGG + Exonic
1098647240 12:72918875-72918897 TGGGTACAGTGAAAAGGATCTGG - Intergenic
1099541627 12:83916817-83916839 AGGGGACATTGAAAAGTTTCTGG + Intergenic
1100687841 12:97005948-97005970 CTGGGCCAGAGATAAGATTCAGG - Intergenic
1100707190 12:97213737-97213759 TGAGGAAAGTGAAAAGTTTCAGG - Intergenic
1100860512 12:98800593-98800615 TGATGACAGTGAAAAGAATCTGG + Intronic
1101311023 12:103579483-103579505 TGAAGCCAGAGAGAAGATTCAGG + Intergenic
1101509253 12:105377965-105377987 TGGGAGCAGAGAAGAGAGTCTGG + Intronic
1102270927 12:111534571-111534593 TTGGGAGAGAGAAAATATACCGG + Intronic
1102635752 12:114322124-114322146 TAGGGACAGAGAAAAGGGCCAGG - Intergenic
1102755495 12:115336139-115336161 TGGGGATAGAGCAAAGTTCCAGG + Intergenic
1103227555 12:119301174-119301196 TGGGGACAGTAAAAGGATTAGGG - Intergenic
1104327008 12:127808779-127808801 TAGAGCCAGAGAAAAGAATCGGG + Intergenic
1104459216 12:128940899-128940921 TGGGGAGAGAAAAAATATTCAGG - Intronic
1105372270 13:19812539-19812561 AGGGGACAGAAAAAGGATTCAGG - Intergenic
1106893959 13:34277568-34277590 AGGGGACATAGAAAAGATCATGG + Intergenic
1107520862 13:41179490-41179512 TAGAGACAGAGAATAGATTAAGG - Intergenic
1108163886 13:47671386-47671408 TAGAGACAGAGAAAACAGTCTGG + Intergenic
1110006757 13:70281937-70281959 TGGGGACAATGAAAATAGTCTGG + Intergenic
1110902555 13:80841171-80841193 TTGTGAAAGAGAAAAGATTCAGG + Intergenic
1111086973 13:83388421-83388443 TGTGGACAGAGGAAAGAGTAGGG + Intergenic
1111619998 13:90713082-90713104 TGGGGAAAGAAAAAAGATAAGGG + Intergenic
1111796021 13:92921348-92921370 TGGGGAAAAAGGAAAGATACTGG - Intergenic
1112135422 13:96573463-96573485 TGGGCCAAGAGAAAAGATACAGG + Intronic
1112465755 13:99643101-99643123 AGAGGACAGTCAAAAGATTCTGG - Intronic
1113123402 13:106949134-106949156 TGGGGAAAGAGAAAAGAAAAGGG + Intergenic
1113794378 13:113048783-113048805 CTGGGACAGAGAAAAGCCTCAGG - Intronic
1113812361 13:113150380-113150402 TCGGTAAACAGAAAAGATTCCGG + Intergenic
1113971252 13:114192038-114192060 TGGAGACAGTAAAAAGATACGGG + Intergenic
1114567885 14:23645823-23645845 GGGTGACAGTGGAAAGATTCTGG + Intergenic
1116131885 14:40865122-40865144 TGGGGACTCAGAGAAGACTCAGG + Intergenic
1116608454 14:47033819-47033841 TGGGGTGAGAGACAAGGTTCTGG - Intronic
1118444386 14:65838300-65838322 TGGTGTCAGAGGAAAGTTTCTGG + Intergenic
1119236991 14:73027789-73027811 TGTAGACAGAGAAAAGCTTGAGG + Intergenic
1119703417 14:76769939-76769961 TGGGGACAGAGAAAGAGCTCCGG - Intronic
1120453341 14:84699499-84699521 TAGAGACTGAGAAAAGGTTCAGG - Intergenic
1122452715 14:101823697-101823719 TGGTGACAGAGACCAGATACCGG + Intronic
1122743134 14:103883188-103883210 TGTGGACAGGGATAAGAATCAGG + Intergenic
1202839936 14_GL000009v2_random:112454-112476 TGGGGAGAGAGAAAGCATTCAGG - Intergenic
1202909320 14_GL000194v1_random:102651-102673 TGGGGAGAGAGAAAGCATTCAGG - Intergenic
1124365575 15:29068957-29068979 TGGGGGCAGCGAAAATGTTCTGG - Intronic
1124863362 15:33464876-33464898 TGGGGACAGTGGGAAGATGCTGG - Intronic
1124963429 15:34415172-34415194 TGGGGGCAGTGAAAATGTTCTGG - Intronic
1124980050 15:34561398-34561420 TGGGGGCAGTGAAAATGTTCTGG - Intronic
1125751561 15:42032729-42032751 TGGGCACAGAGAAGAGAATAAGG + Intronic
1126105383 15:45143818-45143840 TGAGCACATAGAAAACATTCAGG + Intronic
1127268602 15:57380699-57380721 TGGAGGAAGAGAACAGATTCTGG + Intronic
1127586956 15:60387599-60387621 TGGGGACAGCAAAAAGATCAGGG + Intronic
1127616925 15:60695279-60695301 TAGGGACACTGAAAAAATTCAGG + Intronic
1128451130 15:67806544-67806566 TGGGGAAAGAGATCAGATCCAGG + Intronic
1128700881 15:69803404-69803426 TGGGGACAGCGCCAAGATCCAGG - Intergenic
1129617777 15:77113453-77113475 TGGGGACAGAGTGGAGAATCAGG + Exonic
1129689386 15:77704862-77704884 TGGGGCCAGAGACAGGGTTCAGG - Intronic
1130059217 15:80557634-80557656 TGGGGGCTGGGAAAGGATTCAGG - Intronic
1130142419 15:81239479-81239501 TGGGGACAGAAAAAACCTACAGG + Intronic
1130246791 15:82258666-82258688 TAGTGACAGAGAAAACATACTGG - Intronic
1131611581 15:93969982-93970004 TAGGGACAGAGACGAGATTAGGG + Intergenic
1131696648 15:94883717-94883739 TGGGGTCAGAGGGAAGACTCTGG + Intergenic
1131938849 15:97538533-97538555 TGGTCCCAGAGAAAAGGTTCTGG - Intergenic
1132243562 15:100278190-100278212 TGTGGACAGTGAAAAAGTTCTGG + Intronic
1132900043 16:2248802-2248824 TTGGGACAATGAAAAGGTTCTGG - Intronic
1133312942 16:4862661-4862683 TGGGGACACAGCCAAGAATCTGG - Intronic
1133542138 16:6766490-6766512 AGGGGAATGAGAAAATATTCCGG + Intronic
1133562557 16:6963610-6963632 TGGGGATAGTAAAAAGATCCAGG + Intronic
1136137172 16:28263547-28263569 TGGGGACAGTGACAAGAGGCAGG + Intergenic
1136777948 16:32881616-32881638 TGGGGACACAGAGCAGAGTCTGG - Intergenic
1136892674 16:33979898-33979920 TGGGGACACAGAGCAGAGTCTGG + Intergenic
1138386985 16:56642668-56642690 TGAGGCAAGAGAATAGATTCTGG - Intronic
1139532651 16:67550336-67550358 TGGGTACAGAGGAAAGAGTAAGG - Intergenic
1139842714 16:69894503-69894525 TGGGGACAGAGAAAAGGGATGGG - Intronic
1140722310 16:77783070-77783092 TGGAGAGAGGTAAAAGATTCTGG - Intergenic
1141464194 16:84195780-84195802 TGGGGACAGACATCAGCTTCAGG - Intronic
1141751868 16:85963743-85963765 TGGGGACAGAGAAGAGAATACGG - Intergenic
1203080366 16_KI270728v1_random:1143725-1143747 TGGGGACACAGAGCAGAGTCTGG - Intergenic
1143749576 17:9018650-9018672 TGTGGACAGAAACAACATTCAGG + Intergenic
1144207801 17:12991233-12991255 AGGGGAGTGAGAAAAGATTTGGG + Exonic
1144265057 17:13561147-13561169 TGGGGACAGAACAAGGATGCTGG + Intronic
1146342278 17:32031263-32031285 AGTGCACAGAGAAAAGATTGAGG + Intronic
1148153874 17:45411750-45411772 TGGGGACAGAGAGATGGGTCAGG - Intronic
1149797412 17:59533486-59533508 TAGGGAGAGAGAAATGCTTCAGG - Intergenic
1149869696 17:60170482-60170504 CAGGGAGAGAGAAAGGATTCTGG - Intronic
1150461829 17:65360146-65360168 TGGGGACAGAGAAGACAGTGAGG - Intergenic
1150551471 17:66214585-66214607 AGGAGAGAGAGTAAAGATTCAGG - Exonic
1150614809 17:66762193-66762215 GGGGGACAGAGGAAACATTTTGG - Intronic
1150897963 17:69236052-69236074 TGAGGACAAAGATAAGATCCTGG + Intronic
1151335261 17:73435844-73435866 TTGGGACAGAGTAAAGATCCGGG + Intronic
1151961753 17:77409346-77409368 TGGGGCCAGAGAACAGAGCCTGG + Intronic
1151967256 17:77437848-77437870 TGGGGCCAGGGAGAAGCTTCGGG - Intronic
1152027875 17:77823462-77823484 AGGGGGCAGAGGACAGATTCTGG + Intergenic
1152427933 17:80228743-80228765 TGGGGAGACAGAACAAATTCCGG + Intronic
1153617976 18:6951742-6951764 TGGGGACTCAGAACAGATTCAGG + Intronic
1155434866 18:25801771-25801793 TGGGGAGAGAGGAAAGATGATGG + Intergenic
1156809830 18:41234266-41234288 TGGGGACAGAGAGAAGAATTTGG - Intergenic
1156938945 18:42741870-42741892 TTGGGACAGAGAAAATTTTTGGG - Intergenic
1157163472 18:45336562-45336584 GGGGGACAGAGGCAAGATCCAGG - Intronic
1157406986 18:47429964-47429986 TAGAGACAGAGAAAAGATAGGGG - Intergenic
1157640671 18:49210507-49210529 TGGAGACAGCAAAAAGATTAGGG + Intronic
1158521106 18:58171878-58171900 TGGGCTCAGAGAAAAGAATCTGG + Intronic
1158567943 18:58570977-58570999 TGAGGTCAGAGGAAAGCTTCTGG - Intronic
1159195461 18:65108297-65108319 TGGGTACAGAGAAGAGCATCAGG + Intergenic
1159502811 18:69295561-69295583 TGAGGATTGAGAAAAGATTGTGG + Intergenic
1161260652 19:3335949-3335971 TGGGGCCAGAGGAAACATTCAGG - Intergenic
1161642569 19:5433504-5433526 TGGAAACAGAGAAAAGAGGCCGG + Intergenic
1161964685 19:7541498-7541520 TGGGGGCAGAGAACAGCTTGTGG - Intronic
1163774184 19:19208291-19208313 TGGGGACAGAGAAGGCACTCAGG + Intergenic
1163830133 19:19543657-19543679 TGGGGACAAAGAAAACATGCAGG - Intronic
1164022733 19:21322746-21322768 TGGTGCCAGAAAAAAGATACGGG - Intronic
1164769791 19:30799702-30799724 AGGGGACAGATAACAGATGCTGG + Intergenic
1164954441 19:32369889-32369911 TGGGGAGGGAGAGAAGATTCCGG - Intronic
1165004591 19:32794467-32794489 TTGGTACTGAGAAAAGATTTGGG + Intronic
1165196876 19:34111003-34111025 TGGGGACAGAGGAAAAACCCAGG - Intergenic
1165431706 19:35776625-35776647 TGGGGACCCAGAAAAGAATCAGG + Intronic
1167582998 19:50357536-50357558 TGGGGACCCCGAAAAGAGTCAGG - Intronic
1167856898 19:52249117-52249139 ATGGGACAGAGAGAAGATTAGGG + Intergenic
1167967172 19:53157562-53157584 TGGGGACAATGAAAAGACTGGGG - Intronic
1168077260 19:53987910-53987932 TGGGGACAGAGAAGCGACCCTGG + Exonic
1168088776 19:54067984-54068006 TGGGGACAGAGGACAGAATTGGG - Intergenic
1168377921 19:55896064-55896086 TGAGAACAGAGAAGAGATGCTGG + Exonic
1202633117 1_KI270706v1_random:18107-18129 TGGGGAGAGACAAAGCATTCAGG + Intergenic
1202652761 1_KI270707v1_random:21943-21965 TGGGGAGGGAGAAAGTATTCAGG - Intergenic
925263512 2:2548020-2548042 GGGGGACAGAGAGAAGATGGGGG - Intergenic
925618950 2:5771773-5771795 TGTAGACAGAAATAAGATTCAGG + Intergenic
926001709 2:9338730-9338752 TGGGGACAGAGAAGCAATTGGGG + Intronic
926493625 2:13556877-13556899 TGGTGACAGAAAAAAAATGCAGG - Intergenic
926513724 2:13814508-13814530 TGGTAACAGAGATGAGATTCAGG - Intergenic
926615276 2:14991143-14991165 TGGGGACATAGAAGACATGCAGG + Intergenic
927203787 2:20594322-20594344 TGATGATAGAGAAAAGATCCTGG + Intronic
927701880 2:25274272-25274294 TGGAGACAGAGAAGAGCTTTGGG - Intronic
927897036 2:26789517-26789539 TGGGGTCAGAGGAGAGATCCAGG - Intronic
927981207 2:27376289-27376311 TGGGGACAGACACAAGGTGCCGG - Intronic
928582501 2:32723455-32723477 TGGGGAGAGAGAAAAACATCTGG - Intronic
928600365 2:32898417-32898439 TGGGTACAGAGAAAAAGCTCAGG + Intergenic
928621017 2:33087906-33087928 TGGTGTCAGAGTAAAGATTAGGG + Intronic
929278310 2:40049592-40049614 TGGGGAGAGATAAATGATGCTGG - Intergenic
929382124 2:41365500-41365522 AGGAGACAGAGAACAAATTCGGG + Intergenic
929423113 2:41815412-41815434 GGAGGACAAAGAGAAGATTCAGG - Intergenic
929449425 2:42026954-42026976 TTGGGGCAGAGAAAAGACACTGG - Intergenic
929805567 2:45142110-45142132 TGGTGACAGAGTATAGGTTCAGG + Intergenic
930056141 2:47253455-47253477 TGGGGACAGAGAAGGCTTTCTGG + Intergenic
931092349 2:58899623-58899645 TGGAGAAAGAAAAGAGATTCTGG - Intergenic
931418089 2:62100280-62100302 TGGGGCCACAGAGAAGACTCAGG - Intronic
931673862 2:64673592-64673614 AGGGGACAGAGAAAAAGGTCTGG + Intronic
932263607 2:70346989-70347011 TGGGAACAGAGAAGAGAGACAGG + Intergenic
932484860 2:72078545-72078567 AGGGGAAAAAGAAAAAATTCAGG - Intergenic
933500746 2:83107951-83107973 TGGGGGGAGGGAAAGGATTCAGG + Intergenic
933534917 2:83559341-83559363 TGGAGACAAAGAAAAGAATGAGG + Intergenic
933837201 2:86255646-86255668 TGGGAACACAGACAAGATTCTGG + Intronic
934122593 2:88854591-88854613 TAGGGATAGAGAACAGATTCTGG - Intergenic
936777251 2:115988640-115988662 TGGGGATAGAGAACAGCTTTGGG + Intergenic
937051271 2:118893134-118893156 TGGGGACAGAGACAAGAGACAGG - Intergenic
937249955 2:120517366-120517388 TGGGGAAAGAGAAAAGGGTTTGG - Intergenic
937981504 2:127618928-127618950 AGGGGACAGAGGAAACATGCAGG + Intronic
938507741 2:131904620-131904642 TGGTGATAGATAATAGATTCTGG - Intergenic
938778591 2:134563737-134563759 TGTGGAAAGTGAAAAGAATCAGG + Intronic
939528992 2:143333753-143333775 TAGGCACAGAAACAAGATTCGGG + Intronic
939839354 2:147168702-147168724 GGGGGAAAAAAAAAAGATTCTGG - Intergenic
939933947 2:148265903-148265925 TGGGGACAAAGAACAAGTTCAGG + Intronic
940249918 2:151663861-151663883 TGTGGACAGAGAAGAAATTATGG + Intronic
940496122 2:154431224-154431246 TGCAGAAAGAGACAAGATTCAGG + Intronic
940807938 2:158208691-158208713 TGGGAAGATAGAAAAGAGTCAGG - Intronic
942686273 2:178535621-178535643 GGGGTAGAGAGAAAAGATGCTGG - Exonic
942963850 2:181865793-181865815 TGGGAAAAGAGCAAAGATTTTGG - Intergenic
943348667 2:186771857-186771879 TGGGGAAAGATGAAAGATTCAGG + Intergenic
945042683 2:205755288-205755310 TGGGGACAGAGAGAAAATTACGG + Intronic
945575831 2:211526995-211527017 AGGAGACAGAGAAAAAATTATGG + Intronic
945682788 2:212934259-212934281 TGGTCAAAGAGAAAAGATTAAGG + Intergenic
945687378 2:212988075-212988097 GGGGGATAGAGAAATCATTCAGG - Intergenic
946841378 2:223823584-223823606 GGGGGACAGAGAAGAAATTGAGG + Intronic
947310478 2:228796286-228796308 TGGGGAAACAGAAATGATTGAGG - Intergenic
1168868444 20:1108690-1108712 TGGGAACAGAGAAACGATCTAGG - Intergenic
1168984422 20:2035873-2035895 TGGGGAAAGAGAAAAAATGCAGG + Intergenic
1169248241 20:4041035-4041057 TGGGGACAGAGAAATGAGTGAGG - Intergenic
1169285635 20:4305003-4305025 TGGGGACAGGAATAAGACTCCGG - Intergenic
1169880024 20:10336739-10336761 ACGTGAGAGAGAAAAGATTCAGG + Intergenic
1170905488 20:20512416-20512438 TGGGGAAGAAGAAAAGATTGGGG - Intronic
1171178064 20:23069722-23069744 TGGAGACAGTGAAAAGATCATGG + Intergenic
1171524676 20:25799487-25799509 TCGTTACAGAAAAAAGATTCAGG + Intronic
1171552151 20:26056396-26056418 TCGTTACAGAAAAAAGATTCAGG - Intergenic
1171949162 20:31405585-31405607 TGGGGCCAGAGAAAAGTCCCAGG - Intronic
1172004130 20:31805948-31805970 TGTGCTCAGAGAAAACATTCTGG - Intergenic
1173859840 20:46276071-46276093 TGGGGGCAGAGGAGAGATGCTGG + Intronic
1174074282 20:47921335-47921357 TTGGGACAGAGGAAAGAGTGAGG - Intergenic
1174879884 20:54267613-54267635 GAGGGACAGAGCAAATATTCAGG + Intergenic
1175503547 20:59466809-59466831 TGGTGACAGAGGAAAGGTTACGG - Intergenic
1176177035 20:63733563-63733585 TGGGGGCAGAGACAAGCTGCAGG - Intronic
1176256674 20:64156646-64156668 TGGGGACAGAGGAAAGACAGAGG - Intronic
1176599391 21:8777710-8777732 TGGGGAGGGAGAAAGTATTCAGG + Intergenic
1176628672 21:9117364-9117386 TGGGGAGAGAGAAAGCATTCAGG - Intergenic
1176645338 21:9343987-9344009 TGGGGAGAGACAAAGCATTCAGG + Intergenic
1177210642 21:18066852-18066874 TGTGCACAGAGAAATGATTATGG + Intronic
1177983777 21:27947631-27947653 TGGTGATAGATAATAGATTCTGG + Intergenic
1178620521 21:34170062-34170084 TGGGGAAAGAGAATACATTTGGG - Intergenic
1178988712 21:37333073-37333095 TGGAGACAGTAAAAAGATTAGGG - Intergenic
1179077786 21:38140201-38140223 TGAAGACAGAGGAAAGATTTGGG + Intronic
1179082101 21:38180638-38180660 TCTGGACAGAGAAAAGAGTGAGG + Intronic
1180367613 22:11955247-11955269 TGGGGAGAGACAAAGCATTCAGG - Intergenic
1180378472 22:12116087-12116109 TGGGGAGAGAGAAAGCATTCAGG + Intergenic
1180419037 22:12797192-12797214 TGGGGAGAGACAAAGCATTCAGG - Intergenic
1181510550 22:23386959-23386981 AGGGGACAGAGAACAGATGAGGG - Intergenic
1182548911 22:31090754-31090776 TGGGGAAAGAGAAAAGACAGGGG - Intronic
1183282709 22:36940927-36940949 TGGGGACAAGGAAAAGATGGCGG + Intergenic
1184447306 22:44556428-44556450 TAGGGACAGAGAAATGAAGCTGG - Intergenic
1184461294 22:44639654-44639676 GGGGGACAGAGAAATAAATCAGG + Intergenic
1184710824 22:46248401-46248423 TGGGGATAGAGAAAAGGGTACGG - Intronic
1184770217 22:46592576-46592598 TCGGAACAGTGAAAACATTCAGG - Intronic
949370469 3:3329125-3329147 TGGGGACAGAGACATTATTTAGG + Intergenic
950747135 3:15099508-15099530 TAGAGACAGAAAAAATATTCAGG + Intergenic
950770878 3:15310013-15310035 TGGGGAGACAGGAAAGATTTTGG - Intronic
953508451 3:43510001-43510023 TGGAGACAGAGAACAGATTTTGG + Intronic
953657693 3:44866526-44866548 TGGGGCCAGAGATCAGACTCAGG - Intronic
955907858 3:63826448-63826470 TGGGGAGAGGGAAAAATTTCTGG + Intronic
956457863 3:69441626-69441648 TGGGGACACAGAAAAGAACAAGG - Intronic
957094985 3:75770055-75770077 TGGGGAGAGAGAAAGCATTCAGG - Intronic
957226713 3:77458380-77458402 TGAGGAGACAGAAAAGATTGAGG + Intronic
957360666 3:79152391-79152413 TGGGGACAGAGAAAAGACTAAGG + Intronic
958025612 3:88045297-88045319 TGGAGAAAGAGAAAAGAGGCCGG - Intergenic
961424452 3:126834203-126834225 TGGGGACACAGAAGTGACTCAGG + Intronic
962031261 3:131602674-131602696 TGTGGACAGAGTAAAGAGACAGG + Intronic
962247156 3:133805356-133805378 TGAGTTCAGAGAAAAGCTTCTGG - Intronic
962338765 3:134563220-134563242 TTGGGTCTGAGATAAGATTCTGG - Exonic
963360366 3:144264950-144264972 TGGAGACAGAGAAATGAAACCGG + Intergenic
964654772 3:159054145-159054167 AGGGCACAGAGAAGAGATTTGGG - Intronic
964880997 3:161422793-161422815 TGGTGACAGAGAAAAGAGTTTGG - Intergenic
964911630 3:161789689-161789711 TGAAGACACAGAAAAGAATCTGG + Intergenic
965057648 3:163743171-163743193 TGGGAACAGAGAATAGAATGTGG + Intergenic
965866507 3:173211426-173211448 TTGAGACAGAGAAGAGATTCTGG + Intergenic
967132725 3:186487611-186487633 TGGGTCCAGAGAAAAGAGTGGGG - Intergenic
967278141 3:187796402-187796424 TGGGGAAAGGGAAAAGGTGCAGG - Intergenic
1202741552 3_GL000221v1_random:61081-61103 TGGGGAGAGACAAAGCATTCAGG - Intergenic
968799812 4:2734574-2734596 TGGGAAGAGAGACAAGATGCAGG + Intergenic
970028778 4:11654020-11654042 TTGGGACAGAGAAAATTTTGGGG + Intergenic
971334525 4:25710529-25710551 TGAGGCCAGAGAATAGAGTCTGG + Intergenic
971872392 4:32259991-32260013 AGTGGACAGTGAAAACATTCTGG + Intergenic
972882129 4:43437855-43437877 TGAGGATAGAGCAAAGATTAGGG - Intergenic
973142819 4:46790643-46790665 TGGGGACCCAGAACAGATACAGG - Intronic
973362748 4:49180081-49180103 TGGGGAGAGAGAAAGCATTCAGG + Intergenic
973398349 4:49616772-49616794 TGGGGAGAGAGAAAGCATTCAGG - Intergenic
973887226 4:55335850-55335872 TGGGGAGGGAGAAAAAATTAGGG - Intergenic
974010560 4:56602974-56602996 TGGGGAAAGAGAAAAGGTTTTGG + Intronic
974582169 4:63816976-63816998 TGGAGATAGAAAAAAAATTCAGG - Intergenic
975134640 4:70862688-70862710 TTGGGACAGAAAAAATATTAAGG + Intergenic
975469643 4:74750640-74750662 AGGAGACAGAGGACAGATTCTGG - Exonic
975550457 4:75607788-75607810 TGGGGATAGATAAGAGATTGTGG + Intronic
977212155 4:94231278-94231300 TATGAAGAGAGAAAAGATTCAGG + Intronic
978561884 4:110042463-110042485 GGGGGCCAGGGAATAGATTCGGG - Intergenic
978688528 4:111479382-111479404 TGGGAACAGAGAATAGATTGTGG + Intergenic
979316410 4:119269804-119269826 AAGGGACAAAGAAAAGATTTAGG + Exonic
979940360 4:126754523-126754545 TGGAGGCAGAGACAAGACTCAGG - Intergenic
981162892 4:141520398-141520420 TTGGGGCAGAGAAAACTTTCTGG - Intergenic
981494460 4:145375803-145375825 TGGTGACAGAGAGAAGAGCCAGG - Intergenic
982103517 4:151991601-151991623 TGGTGACAGTGAAAATATTATGG - Intergenic
982405050 4:155010159-155010181 TGGGAAGAGAGAGAAGCTTCGGG - Intergenic
982788461 4:159562750-159562772 GGTGGAAAGAGAAAAGATGCAGG - Intergenic
983813349 4:172091842-172091864 GAGAGACAGAGAAAAGAATCGGG + Intronic
984311425 4:178065351-178065373 TGGGGAGAGAGAAAAGTTAATGG + Intergenic
984725181 4:183013566-183013588 TGGGGACAGAAAAGAGGTTTAGG + Intergenic
985161216 4:187046981-187047003 TGGGGACAATGAAAAGATAATGG + Intergenic
985231723 4:187825357-187825379 TGGGGACAGAAAGATAATTCAGG + Intergenic
1202760092 4_GL000008v2_random:101553-101575 TGGGGAGAGAGAAAGCATTCAGG + Intergenic
985959346 5:3287897-3287919 TTGGGACAGAGACAAGAGTGGGG - Intergenic
986203325 5:5599546-5599568 TGGCCACAGAGCAAAAATTCTGG + Intergenic
986207919 5:5643709-5643731 TGAGGACAGAGAACAGAATGTGG + Intergenic
987212260 5:15694806-15694828 AGGGAACAAAAAAAAGATTCTGG + Intronic
987244014 5:16029878-16029900 TGTGCACAGAGAAAACATTAGGG + Intergenic
988968647 5:36444477-36444499 TGGGCACAGTGAAAACCTTCAGG - Intergenic
990322763 5:54646230-54646252 TGGGGAGAGAGATAAAAATCTGG - Intergenic
990448908 5:55917609-55917631 TGGGGAGAGAGGAAGGCTTCAGG - Intronic
991389214 5:66124562-66124584 TGAGGACAGAAAAAGGAATCTGG + Intergenic
991556511 5:67900981-67901003 TGAGCACAGAGGAAAGATTGTGG - Intergenic
991921029 5:71657336-71657358 TTGGGACTGAGAACAAATTCTGG - Exonic
992379101 5:76219590-76219612 TGGGGAGAGAGACAAGAGGCTGG - Intronic
992683439 5:79176128-79176150 TATGGAAAAAGAAAAGATTCTGG + Intronic
993139115 5:84008093-84008115 TGGAGACAGAGAATAGAATGAGG + Intronic
994051692 5:95369416-95369438 AGGGGACAGAGAAAAGATTTAGG - Intergenic
995351958 5:111187965-111187987 TGGGGAGAGAGACAAGAGACTGG - Intergenic
995502683 5:112825067-112825089 TGGGAAAAGATAAGAGATTCAGG - Intronic
996803161 5:127426066-127426088 TGGAGCCAGAGATAAGAGTCAGG + Intronic
996992079 5:129647483-129647505 TGGAGACAGGGTAAAGATTATGG - Intronic
997107728 5:131040338-131040360 TGGAGAGAGACAAAATATTCAGG - Intergenic
998321779 5:141239293-141239315 TGAGGAAAGAGAAAACATTTTGG - Intergenic
999532055 5:152474720-152474742 TGGAGACAGAGATTAGATTGTGG - Intergenic
1000677474 5:164139324-164139346 GGGAGGCAGAGAAAATATTCAGG + Intergenic
1001097646 5:168788166-168788188 TGGGGGCAGAGAAAGGTTCCTGG + Intronic
1001145973 5:169185113-169185135 TGTGGACAGAGAATGGATTATGG - Intronic
1001591334 5:172867413-172867435 TAGGGACAGGGAAAAGTTACGGG - Intronic
1002839228 6:891494-891516 TGGACACAGAGAAAAGACACTGG - Intergenic
1003043338 6:2709878-2709900 TGGGGACAGAGACAGTATTTTGG - Intronic
1003179490 6:3779883-3779905 TGGAGACAGTGAAAACATTGGGG - Intergenic
1003220963 6:4160667-4160689 TGGGGTCAGAGAAAGTTTTCTGG + Intergenic
1003797490 6:9621085-9621107 TGGGGAAAGAGAATAGAGTCTGG + Intronic
1004477734 6:15989440-15989462 TGGGGACAGGAAGAAGAGTCAGG + Intergenic
1005279789 6:24261414-24261436 TCTGGCCAGAGAAGAGATTCAGG - Intronic
1005898608 6:30198470-30198492 GAGGGACAGAGACAAAATTCAGG - Exonic
1006525396 6:34600233-34600255 AGGGGACAGAGACCAGATTGTGG - Intronic
1006685483 6:35829561-35829583 TCAGGACAGAGATTAGATTCTGG + Intronic
1006703418 6:35995985-35996007 TGGGCACAGAGAAATGAATTTGG - Intronic
1007826607 6:44605630-44605652 TGGGTATAGAGAACAAATTCAGG + Intergenic
1007921637 6:45615624-45615646 TGGGGACAGGGAAAAGGGACAGG - Intronic
1008755268 6:54787649-54787671 TGGGGGAAGGGAAAAGATGCTGG + Intergenic
1009613626 6:65977773-65977795 AGTGGACAGAGAAAGGAATCTGG + Intergenic
1009960528 6:70515563-70515585 TGGTGACAGTAAAAAGATCCGGG + Intronic
1009985908 6:70780741-70780763 AGGGGAAAGAGAAAAGCTACTGG - Intronic
1012606032 6:101158399-101158421 TGGAGATAGAGAAAAGAATGAGG + Intergenic
1013112538 6:107075791-107075813 TGAGTACAGGGAAAAGTTTCTGG + Intronic
1013705595 6:112830116-112830138 AAGGGAAAGAGAAAAGATTGAGG + Intergenic
1015670717 6:135686847-135686869 TAGAGACAAAGACAAGATTCTGG - Intergenic
1015928419 6:138333294-138333316 TGGGGACACAGAATATATTTTGG - Intronic
1016958744 6:149651603-149651625 AGGGGAGAGAGAATAGATTGGGG + Intergenic
1017113580 6:150955128-150955150 TGGGGATAATGAAAAGGTTCTGG - Intronic
1017361144 6:153573257-153573279 AGGAGATAGAGAAAAGAATCTGG - Intergenic
1018347268 6:162913238-162913260 TGGGGACAGAGGAAAGGCTTGGG - Intronic
1018752346 6:166818357-166818379 TGAGGAGACAGAAAAAATTCAGG - Intronic
1019025200 6:168956200-168956222 GGGAGAGAGAGAAAAAATTCTGG - Intergenic
1019496511 7:1342905-1342927 TGGGGACACAGATGAGATTTGGG - Intergenic
1020615360 7:10453002-10453024 TGAGGACAAACAGAAGATTCTGG + Intergenic
1020792430 7:12643356-12643378 TGGGTACAGAGGAAAGAGCCCGG - Intronic
1020903527 7:14036460-14036482 TGGGGGCAGAGTAAAGTTTGTGG - Intergenic
1021254983 7:18380887-18380909 TGGGGAAAAACAAAAGATTAGGG + Intronic
1021854741 7:24843325-24843347 TGAGGAAAAAGAACAGATTCAGG + Intronic
1022375611 7:29807867-29807889 TGTGAAGTGAGAAAAGATTCTGG - Intronic
1022448588 7:30492685-30492707 TGGGGGCAGAGGGAAGAATCAGG - Intergenic
1023658715 7:42451865-42451887 TGGGGACAAAGGAAAGATTGTGG - Intergenic
1024852842 7:53741335-53741357 AGGGGCCAGAGAAAAAAGTCAGG + Intergenic
1026372829 7:69718781-69718803 TGGGGAAAGAGCAAAGTTTGGGG - Intronic
1027973933 7:85124626-85124648 GGAGGACAGAGAAAAGAGACTGG + Intronic
1030413175 7:109207777-109207799 TGGGGATAGAGAGAATATCCTGG + Intergenic
1031121377 7:117726390-117726412 TGGGAACACAGACAAAATTCTGG + Intronic
1032203167 7:129837705-129837727 TAGGAACAAAGAAAAGATGCAGG + Intronic
1032317683 7:130855178-130855200 TGGAGGCAGAGAAATGATTCTGG + Intergenic
1032448811 7:132009276-132009298 TGGAACCAGAGAAACGATTCTGG - Intergenic
1032811518 7:135423699-135423721 TGGTGACCCAAAAAAGATTCAGG + Intronic
1032990264 7:137386687-137386709 TGGGGACACAGAAAAGGGTAGGG + Intronic
1033219073 7:139516058-139516080 TGGGAAAAGACAAAGGATTCAGG + Intergenic
1033581974 7:142746278-142746300 TGGGGAACGATAAAAGATACTGG + Intergenic
1034637694 7:152580439-152580461 TGGGGACAGTGCAAATATTATGG + Intergenic
1034740950 7:153472803-153472825 TGTGACCAGAGAAAAGATCCAGG + Intergenic
1035926489 8:3733622-3733644 TCTGGACAGAGGAATGATTCGGG - Intronic
1035986766 8:4442001-4442023 GGGGGACATAGAAATGACTCAGG - Intronic
1037710199 8:21349230-21349252 TTGGGACATAGCAAAGATCCTGG + Intergenic
1038849590 8:31262541-31262563 TGAGGAGGGGGAAAAGATTCAGG + Intergenic
1038996839 8:32932721-32932743 TAGGGACACAGAGAAGAATCTGG - Intergenic
1039927743 8:41953256-41953278 TGGGGAGAGGAAATAGATTCAGG - Intronic
1040287239 8:46106703-46106725 TGGGCACAGTTGAAAGATTCAGG - Intergenic
1040389788 8:46940033-46940055 TTGGGAAAATGAAAAGATTCTGG + Intergenic
1040611472 8:48987593-48987615 TAGGAACAGAGAAATAATTCCGG - Intergenic
1040860938 8:51998870-51998892 TGGGAACAGAGCAAAGACTGAGG + Intergenic
1041662416 8:60412990-60413012 TGGGGACAGAGACCAGACCCAGG + Intergenic
1042041864 8:64600229-64600251 TCTGGATAGAGAAAAGATTTTGG + Intronic
1042110339 8:65374954-65374976 TGGGGACACAGGCAAGATTGGGG + Intergenic
1042778456 8:72462938-72462960 TGGGGAAAGAAAAAAGAGTAAGG - Intergenic
1042972127 8:74420955-74420977 TGAGGAAAGAGAAGAGTTTCAGG - Intronic
1043517286 8:81006353-81006375 AAGGGATAGAGAACAGATTCAGG - Intronic
1044043425 8:87399361-87399383 GGAGAACAGAGAAAAGACTCAGG - Intronic
1044527619 8:93269399-93269421 TGTAGACAGAGAAAGGCTTCAGG - Intergenic
1046087261 8:109453575-109453597 TGGGAAAATAGAAAAGTTTCAGG + Intronic
1046722911 8:117640811-117640833 GAGAGACAGAGACAAGATTCAGG - Intergenic
1047052605 8:121129598-121129620 TTGGGTGAGAGAAAAAATTCTGG + Intergenic
1050865984 9:10499988-10500010 TGGGGACAGAGAAAGAAAGCTGG - Intronic
1050961693 9:11741516-11741538 TGGGGACAATAAAAATATTCTGG + Intergenic
1051090993 9:13407913-13407935 TGGGGAGTGATAAAAGATTCCGG + Intergenic
1052502524 9:29310137-29310159 TGGGGACTGTGAAAAGCTTTGGG + Intergenic
1052755331 9:32535192-32535214 TGGGGCTAGAGAAATGATTTAGG - Intergenic
1052791898 9:32882991-32883013 TTGGGGCAGAGATAAGATTGAGG + Intergenic
1053793019 9:41699979-41700001 TCGTTACAGACAAAAGATTCAGG + Intergenic
1054152156 9:61614845-61614867 TCGTTACAGACAAAAGATTCAGG - Intergenic
1054181428 9:61912000-61912022 TCGTTACAGACAAAAGATTCAGG + Intergenic
1055802036 9:80048537-80048559 TGGGGACTGAGAAGAGATGGGGG + Intergenic
1057247016 9:93465186-93465208 TGGGAATGGAAAAAAGATTCTGG - Intronic
1057694781 9:97315431-97315453 TGGGGACAGAGCCAAGAGGCAGG - Intronic
1058389481 9:104478437-104478459 AGGGGACAGGGAAAAGTTTCTGG + Intergenic
1058525917 9:105857525-105857547 TGGGAACAGAGAGAAGGGTCTGG - Intergenic
1058576877 9:106413206-106413228 TGGGGAAATAGAAATAATTCAGG - Intergenic
1058593831 9:106593725-106593747 AAGGGTCAGAGAAAAGATTATGG - Intergenic
1059255254 9:112924447-112924469 TGGGGAAAGGGAAAACAGTCTGG + Intergenic
1059568645 9:115410079-115410101 TGGGAATAGAAAAAAGATTTGGG + Intergenic
1059753789 9:117273518-117273540 TTGGGACATAAAAAAGACTCAGG + Intronic
1061609194 9:131735116-131735138 TTGGGACACAGCAAAGATCCCGG - Intronic
1062678772 9:137764803-137764825 AGGGGACAGAGAGAATGTTCTGG - Intronic
1203751519 Un_GL000218v1:85043-85065 TGGGGAGAGAGAAAGCATTCAGG - Intergenic
1203710187 Un_KI270742v1:91005-91027 TGGGGAGAGACAAAGCATTCAGG - Intergenic
1203540866 Un_KI270743v1:86447-86469 TGGGGAGAGAGAAAGCATTCAGG + Intergenic
1185680896 X:1887631-1887653 TGGGGACGGTGAGAAGTTTCTGG - Intergenic
1185680911 X:1887715-1887737 TGGGGACGGTGAGAAGTTTCTGG - Intergenic
1185680958 X:1887967-1887989 TGGGGACGGTGAGAAGTTTCTGG - Intergenic
1185680988 X:1888135-1888157 TGGGGACGGTGAGAAGTTTCTGG - Intergenic
1185681033 X:1888387-1888409 TGGGGACGGTGAGAAGTTTCTGG - Intergenic
1187046172 X:15649227-15649249 TGGGGACAGAGGAAAGTATTTGG - Intronic
1187520346 X:20007936-20007958 TTGAGACAGAGAAGAAATTCAGG - Exonic
1187555414 X:20346259-20346281 AGGTGACAGAGAAGGGATTCAGG - Intergenic
1188170517 X:26918525-26918547 TGAGGTCAGAGAAAATATTCTGG - Intergenic
1189292824 X:39897849-39897871 TGGGGACTGAGTAAACATTCGGG + Intergenic
1189306515 X:39990772-39990794 GGGGGACAGAGAGAAGAACCAGG + Intergenic
1189653035 X:43210842-43210864 TGTGGACAGAGGGAAGATGCAGG + Intergenic
1189851197 X:45177757-45177779 TGGGGAAAGACAAAAATTTCAGG + Intronic
1191715853 X:64193042-64193064 GGGGGACGGAGCAAAGGTTCTGG - Exonic
1192301989 X:69914795-69914817 TGAGGAGAGACAAAAGAATCAGG - Intronic
1192591817 X:72366605-72366627 TAGGGACAAAGAAAAGAATAAGG - Intronic
1193532366 X:82671229-82671251 TGGGGCCTCAGAAAAGACTCAGG - Intergenic
1193667844 X:84345323-84345345 TGGAGACAGAAAACAGATTAGGG - Intronic
1193865640 X:86726828-86726850 TGGGGACCAAGAAAAGCTCCTGG - Intronic
1194104569 X:89752999-89753021 TGGGGCCTCAGAAAAGACTCAGG - Intergenic
1194407387 X:93513667-93513689 TGGGGACAGAGCAAATAATGGGG - Intergenic
1194411858 X:93567409-93567431 TGTGGACAGCAAAAAGTTTCAGG + Intergenic
1194589603 X:95782991-95783013 TGGGGCCAGAAAAAACATGCAGG - Intergenic
1195158550 X:102148060-102148082 AGGGGAAAAAGAAAAGTTTCAGG - Intergenic
1195264071 X:103163250-103163272 AGAGGAAAGAGAAAAGAATCAGG - Intergenic
1195354507 X:104026130-104026152 TGTGGAGAGAGAACATATTCTGG - Intergenic
1195500548 X:105593475-105593497 TGGGAACAAAGAAGACATTCTGG + Intronic
1195501706 X:105609280-105609302 TGGGGATGAAGAAAACATTCTGG + Intronic
1196354540 X:114775055-114775077 TGAGGACAAACAGAAGATTCTGG - Intronic
1196622821 X:117842669-117842691 TGGGGAAAGAGAAAAGAGAAAGG + Intergenic
1198050050 X:132942965-132942987 AGGCGCTAGAGAAAAGATTCAGG - Intronic
1200456524 Y:3400778-3400800 TGGGGCCTCAGAAAAGACTCAGG - Intergenic
1201165174 Y:11202659-11202681 AGGGGAGAGAGAAAGCATTCAGG - Intergenic
1201384639 Y:13425413-13425435 TGGGGACAGACAACAGATTGTGG + Intronic