ID: 1085084319

View in Genome Browser
Species Human (GRCh38)
Location 11:73656629-73656651
Sequence AGGCCCTGTGCTGAGTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1271
Summary {0: 1, 1: 4, 2: 28, 3: 222, 4: 1016}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085084319_1085084334 3 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084334 11:73656655-73656677 ATGGGGTGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 39
3: 440
4: 3158
1085084319_1085084330 -3 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084319_1085084331 0 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084331 11:73656652-73656674 GGCATGGGGTGGGTGGCAGGAGG 0: 1
1: 0
2: 42
3: 314
4: 2064
1085084319_1085084333 2 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084333 11:73656654-73656676 CATGGGGTGGGTGGCAGGAGGGG 0: 1
1: 0
2: 11
3: 130
4: 927
1085084319_1085084328 -7 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084328 11:73656645-73656667 AGGGCCTGGCATGGGGTGGGTGG 0: 2
1: 158
2: 979
3: 3064
4: 7190
1085084319_1085084332 1 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084332 11:73656653-73656675 GCATGGGGTGGGTGGCAGGAGGG 0: 1
1: 0
2: 7
3: 122
4: 1021
1085084319_1085084327 -10 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084327 11:73656642-73656664 CACAGGGCCTGGCATGGGGTGGG 0: 1
1: 3
2: 64
3: 644
4: 2714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085084319 Original CRISPR AGGCCCTGTGCTGAGTTCTG GGG (reversed) Intronic
900130800 1:1086370-1086392 AGGGCCTGTGCTGAGCCCGGAGG - Intronic
900713854 1:4131712-4131734 AGGCCCAGTGCTCAGCTCTGGGG - Intergenic
900965849 1:5957966-5957988 AGGCCCTGGGCTGGGTGCTGAGG - Intronic
901208043 1:7508571-7508593 AGGCACAGTGCTGGGTGCTGGGG - Intronic
901239767 1:7686146-7686168 AGGCACTGTTCTGGGCTCTGGGG + Intronic
901817338 1:11802002-11802024 AGGCACTGTTCTAAGTTCTGTGG - Intronic
902243174 1:15102032-15102054 AGGCGCTGTGCTCAGTGCAGGGG + Intronic
902442148 1:16437688-16437710 ATGCCAGGTGCTGAGTACTGGGG - Intergenic
902456545 1:16537413-16537435 AGACTCTGTGCTGAGTGTTGTGG + Intergenic
902475974 1:16687713-16687735 TGGCGCTGTGCTGTGTGCTGTGG - Intergenic
902495620 1:16870498-16870520 AGACTCTGTGCTGAGTGTTGTGG - Intronic
902644575 1:17789535-17789557 TGGCACTGTGCTAAGTGCTGGGG - Intronic
902719268 1:18293198-18293220 AGGCCCTGGGCTGAGAGCTGGGG - Intronic
903051592 1:20605173-20605195 GGGCCCTGGGATGAGTGCTGAGG + Intronic
903070600 1:20725263-20725285 AGGCCATGTGCTGGATACTGGGG - Intronic
903224121 1:21885270-21885292 GGGCCCTGGGCTGGGTTCTAGGG - Intronic
903262052 1:22136718-22136740 AGGCCCTGTGCTGGGCACTTAGG - Intronic
903371114 1:22836833-22836855 GGGCCCTGTGCTGGGCACTGGGG + Intronic
903377214 1:22874446-22874468 AGGCCCTGGGCTTTGTGCTGGGG - Intronic
903661080 1:24979134-24979156 AGGCCCTGTGCTTGGTGCTAAGG + Intergenic
903759164 1:25685718-25685740 AAGCCCTGTGCTGGTTGCTGTGG + Intronic
903993586 1:27290491-27290513 AGGCGCTGTGCTGGGCTCTAGGG - Intronic
904052915 1:27651011-27651033 AGGCCCTGTGCTAGGGCCTGAGG + Intergenic
904282699 1:29432544-29432566 AGGCACTGTGCTGGGAACTGGGG + Intergenic
904300644 1:29551272-29551294 AGGCCCTGTGCTGGGCACTGGGG - Intergenic
904457560 1:30656771-30656793 AGGCCCTGTGCTGGGCACTGGGG + Intergenic
904512813 1:31027779-31027801 AGGCACTGTGCTAGGTTCTGAGG - Intronic
904595132 1:31639418-31639440 AGGCACTGTGCTGGGCCCTGGGG - Intronic
904627298 1:31814345-31814367 AGGCACAGTGCTGCGCTCTGTGG + Exonic
904650569 1:32002846-32002868 AGACACTGTGCTCAGTCCTGGGG - Intergenic
904700268 1:32353746-32353768 AGGGCCTGTACTGGGCTCTGGGG - Intronic
904946141 1:34200099-34200121 AGGCCTTGACCTGAGTGCTGGGG - Intronic
905113394 1:35615319-35615341 TGGCACTGAGCTCAGTTCTGTGG - Intronic
905171510 1:36112583-36112605 AGGTGCTGGGCTGAGTTTTGGGG - Intronic
905295589 1:36952353-36952375 AGGCCCTGTGCTGGGAACAGAGG - Intronic
905485510 1:38293012-38293034 AGGCCCTGGGCTGGGGGCTGGGG - Intergenic
905900153 1:41576030-41576052 AGGCCCTGTATGGGGTTCTGGGG - Intronic
905925009 1:41743386-41743408 AGGCTCTGTCCTAAGTGCTGGGG - Intronic
905967524 1:42111795-42111817 AGGTCTTGTGCTAAATTCTGGGG + Intergenic
906004892 1:42460294-42460316 AGGCCCTGTGCTGAGCCATGAGG + Exonic
906033374 1:42736793-42736815 AGGCCCTGTGCTGGGTCCTGGGG - Intronic
906283791 1:44572299-44572321 AGGCACTGTGCTGGGTGCTGAGG - Intronic
906513720 1:46425800-46425822 TTGCCCTGTGCTGAGCTCTGGGG + Intergenic
906617052 1:47240724-47240746 GGGCCCTGTGCTGGCTGCTGGGG + Intergenic
906680377 1:47722207-47722229 AGGCACTGTGCTGAGCACTGTGG - Intergenic
906781375 1:48575878-48575900 AGGCCCTATGCTGGTTTCTGGGG - Intronic
906789589 1:48647019-48647041 AGGCCCTGTGCTGGGCCTTGGGG - Intronic
906943137 1:50273257-50273279 AGGCTCTGAGCTAAGCTCTGGGG + Intergenic
907044032 1:51288781-51288803 AGCTCCTGAGCTGAGTTCAGAGG + Intronic
907189232 1:52634375-52634397 AAGCCCTGTGGTGAGTGCTGGGG + Intronic
907333126 1:53684265-53684287 CAGCCCTGTGTTGAGTTCTGGGG - Intronic
907397171 1:54199255-54199277 AGGCACTGTTCTCAGTGCTGGGG + Intronic
907451693 1:54549530-54549552 AGCACCTGAGCTGAGATCTGAGG - Intronic
907464718 1:54627505-54627527 AGGCACTGTGCTAGGCTCTGGGG + Intronic
907487732 1:54788867-54788889 AGGTCCTGTGCTGGGTGCTCTGG + Intronic
907665888 1:56433563-56433585 AGGCACTGTCCTGAGTGCTGGGG - Intergenic
907667814 1:56448804-56448826 AGGCACAGAGCTGAGTTCTGGGG + Intergenic
907687453 1:56625964-56625986 AGGCACTGTGCTAAATTTTGGGG - Intronic
907701199 1:56789782-56789804 AGGCCCTGTGCTTGGTGCTGGGG - Intronic
907764699 1:57397522-57397544 TGGCCCAGTGCTGGGCTCTGAGG + Intronic
907935665 1:59039956-59039978 AGGCTCTGTGCTAGGTCCTGGGG + Intergenic
908255526 1:62300334-62300356 AGGCACTGGGCTAGGTTCTGTGG + Intronic
908628726 1:66077522-66077544 AGGCACTGGACTCAGTTCTGAGG - Intronic
908701453 1:66906615-66906637 AGGCACTGTGCTGGGTGCTAGGG - Intronic
908732210 1:67237907-67237929 AGGCACTGTTCTGGGTACTGGGG + Intronic
908776816 1:67648652-67648674 ACGCCCTGTGCTGGGGGCTGGGG + Intergenic
908864467 1:68530955-68530977 AGGCCCAGTGCTTTGTTCTTTGG - Intergenic
909061631 1:70885655-70885677 AGGCACTGTGCTAGGCTCTGAGG + Intronic
909329051 1:74390584-74390606 AGGCACTGTGCTCAGTACTGAGG + Intronic
909529996 1:76671369-76671391 AGGCACTCTGCTGGGTGCTGGGG - Intergenic
910171960 1:84387271-84387293 AGGCATTGTGCTGAGTGCTGAGG - Intronic
910466405 1:87504980-87505002 AGGCACTGTTCTAAGTGCTGCGG - Intergenic
910802947 1:91163587-91163609 AGGAACTGTGCCGAGTGCTGGGG + Intergenic
911007296 1:93240604-93240626 AGGCCCTACACTGAATTCTGTGG - Intronic
911211992 1:95151061-95151083 AGGCCTTGTGCTAGATTCTGAGG + Intronic
911256796 1:95642489-95642511 AGGCACTGTGCTAAGTGCTTTGG - Intergenic
911287880 1:96019567-96019589 AGGCACTATGCTAAGTGCTGAGG + Intergenic
911445421 1:97985980-97986002 AGGCTCTGTGCTAGGTGCTGGGG + Intergenic
911518094 1:98893597-98893619 AGGCGCTGTGAAGAATTCTGTGG - Intronic
911676276 1:100661939-100661961 AGGCACTGTTCTGTGTACTGGGG - Intergenic
911696247 1:100893539-100893561 AGGCTCTGTGCTGGGTGCTGGGG - Intronic
911729635 1:101279522-101279544 AGGCACTGTGCTAGGTACTGAGG - Intergenic
912159619 1:106966031-106966053 AGGCACTGTGCTGGGTGCTGAGG - Intergenic
912469649 1:109897660-109897682 AGGCCCTGTTCTGAGTGCTGGGG - Intergenic
912691722 1:111809774-111809796 AGACACTGGGCTGAGTGCTGGGG + Intronic
912777054 1:112512283-112512305 AGGCACTGTTCTCAGTACTGGGG + Intronic
912962610 1:114209404-114209426 AGTCACTGTGCTGAGGGCTGAGG - Intergenic
913057076 1:115172378-115172400 ATGCCCTGGGCTTAGTTCTAAGG - Intergenic
913172483 1:116245258-116245280 AGGCCCTGGACTGAGGACTGGGG + Intergenic
913191949 1:116420318-116420340 CGGCCCTGCGTAGAGTTCTGAGG + Intergenic
913210247 1:116576263-116576285 TGGCCCTGTGCTCAGCTCAGGGG + Exonic
913318370 1:117572040-117572062 AGACTCTGTGCTGAGATCTGAGG + Intergenic
913379804 1:118197181-118197203 AGGCCCTGTGCTCAGCACTGAGG + Intergenic
914847024 1:151289056-151289078 AGGCCCTGTGGTGAGGTGGGAGG - Intronic
915003370 1:152613877-152613899 AGACACTGTGCTGAGCTCTTTGG - Exonic
915738701 1:158101560-158101582 TGGCCCTGTGCTGGGGTCTGGGG - Intergenic
915960728 1:160264272-160264294 AGGCCCTGTTCTATGTGCTGGGG + Intergenic
916167395 1:161976328-161976350 AGGCTCTGTGCTAAGTGCTGCGG + Intergenic
916472771 1:165140265-165140287 AGGCTCTGTGCTGCACTCTGTGG + Intergenic
916589091 1:166173173-166173195 AGGCACTGTGCTTAGAACTGAGG - Intergenic
916859014 1:168782521-168782543 AGGCACTGTAATAAGTTCTGGGG + Intergenic
917128525 1:171714972-171714994 GACCCCTGTGCTGAGTTTTGAGG + Intronic
917485618 1:175452251-175452273 AGGCACTGTTCTGGGCTCTGAGG + Intronic
918444673 1:184605388-184605410 AAGCCCTGTGCTAGGTTCTGAGG - Intronic
919420746 1:197367233-197367255 GGGCACTGGGCTCAGTTCTGGGG + Intronic
919456669 1:197828858-197828880 AGGCACTGTGCTAAGCACTGGGG + Intergenic
919538661 1:198820813-198820835 AGGCTCTGTCCTGTGATCTGTGG - Intergenic
919750385 1:201034222-201034244 AGGCCTGGTGCTGAGGTGTGTGG + Intergenic
920280398 1:204839275-204839297 AGTCTCTGTGCTCAGTACTGCGG + Intronic
920849560 1:209619371-209619393 AGGCACTGTGCTGGGGTCTGGGG - Intronic
921129711 1:212209280-212209302 AGGAACTGTGCTAAGTGCTGGGG - Intergenic
921321115 1:213940107-213940129 AGGACCTTTGCTGAGTGCTGGGG - Intergenic
921358881 1:214312344-214312366 AGGCACTGTTGTCAGTTCTGGGG + Intronic
921590062 1:216992487-216992509 AGGCACTATGCTGGGTACTGAGG - Intronic
921726220 1:218526643-218526665 AGGCCTTGTGCTAAGTGCGGTGG + Intergenic
922129404 1:222762127-222762149 AGGTTCTGTGCTGTGTGCTGGGG + Intergenic
922406512 1:225319715-225319737 AGGCCCTGTTCTGGGCACTGAGG + Intronic
922507208 1:226133511-226133533 GGGCCCTGTGCTGTGTGCAGAGG + Intergenic
923000821 1:230005098-230005120 GGGCCCTGTGCTGAGTGTTGGGG - Intergenic
923085942 1:230703728-230703750 GGGCCCTGTGCTCAGTGCTGGGG - Intronic
923201774 1:231719290-231719312 AAGCACTATGCTAAGTTCTGGGG - Intronic
923282231 1:232454971-232454993 AGGAACTGTGCTGAGCACTGGGG - Intronic
923322784 1:232852428-232852450 AGGCCTTATGCTAAGTGCTGGGG + Intergenic
924420029 1:243899596-243899618 AGGCACTGTGCTAAATTCTGGGG - Intergenic
1062862607 10:822341-822363 ATGCCCTGTGCCGAGCCCTGCGG - Intronic
1063124629 10:3127634-3127656 AGGGCCAGTGCAGAATTCTGAGG - Intronic
1063137480 10:3229888-3229910 AGGCTCTGTGCTAGGTTTTGTGG + Intergenic
1063214631 10:3913064-3913086 AGGCAGTGTGCTGAGGGCTGGGG - Intergenic
1063428224 10:5966038-5966060 GGGATCTGTGCTGAGGTCTGAGG - Intronic
1063538430 10:6908398-6908420 AGGTCCTGTGCTGAGTCCATTGG + Intergenic
1064002267 10:11673541-11673563 TGGCCCTGTGCTGTGTGCTGAGG + Intergenic
1064002455 10:11674855-11674877 TGGCCCTTTGCTGTGTGCTGAGG + Intergenic
1064620849 10:17215641-17215663 AGGACCTGAGCTGGCTTCTGGGG - Intergenic
1064898865 10:20271610-20271632 AGGATCTGTGCTGAGGACTGGGG + Intronic
1064953585 10:20881708-20881730 AGGCACTATTCTGGGTTCTGAGG - Intronic
1065069351 10:22005687-22005709 AGGACATTCGCTGAGTTCTGGGG + Intergenic
1065125339 10:22568533-22568555 AGGCCCTATGCTGAGTGCAGAGG + Intronic
1065136571 10:22676721-22676743 AGGCACTGTTCTGGGTGCTGAGG + Intronic
1066088475 10:31994571-31994593 AGGCCCTATGCTAGGTGCTGGGG - Intergenic
1066303360 10:34116523-34116545 AGGCTGTGTGCAGAGATCTGAGG - Intronic
1066333671 10:34453437-34453459 AGCCACTGTGCTGAGTGCTTGGG - Intronic
1066536232 10:36395359-36395381 AGGCCCTGGGCAGAAGTCTGTGG + Intergenic
1067054868 10:43044614-43044636 TGGCCCTGTGCAGGGCTCTGAGG - Intergenic
1067072422 10:43143808-43143830 AGGCACTGTGCTGAGTACCAAGG - Intronic
1067472812 10:46548652-46548674 ATACTCTGTGCTGGGTTCTGTGG - Intergenic
1067732695 10:48823475-48823497 AGGCCCAGTCCTGAGGTCTGTGG - Intronic
1068891648 10:62154512-62154534 ATGCCCTGTGCTTGGTCCTGAGG - Intergenic
1068935943 10:62635942-62635964 AGGCCCTGGGCTGAGGGCTTTGG - Intronic
1069032873 10:63616429-63616451 AGGCAGTGTGCTGAATTATGAGG - Intronic
1069085777 10:64138047-64138069 AGGCACTGTGCTAGTTTCTGTGG + Intergenic
1069514431 10:69066294-69066316 AGGTCCTGTGCTGAGGTCACTGG - Intergenic
1069620316 10:69833464-69833486 AGGCCCTGTGTTCAGTGCCGTGG + Intronic
1069740278 10:70682916-70682938 AGGCCCAGTGCTGGGTCATGAGG - Intronic
1070241674 10:74688387-74688409 AGGCACTGTGCTGGGTCCCGGGG - Intronic
1070311515 10:75276733-75276755 AGCAACTGTGCTGGGTTCTGAGG + Intergenic
1070645077 10:78196202-78196224 AGGCACTGTGCCAGGTTCTGGGG - Intergenic
1070654425 10:78261713-78261735 AGGCACTGTTCTAAGTGCTGGGG - Intergenic
1070904335 10:80058609-80058631 TGGGCCTATGCTGAGTTCTTTGG + Intergenic
1070948512 10:80412468-80412490 AGGATCTGTGTTGAGTGCTGGGG + Intronic
1071290627 10:84186181-84186203 AGGCCCTGAGCTGCGTTCTGAGG + Intergenic
1071438358 10:85667699-85667721 AGGGGCTGTGCTCAGTTCTGGGG - Intronic
1071522328 10:86339108-86339130 AGGCACTGTGTTGGGTGCTGGGG - Intronic
1071563158 10:86658451-86658473 AGCCCCTGCTCTGAGTCCTGGGG - Intronic
1071571457 10:86699632-86699654 AGGCCCTGTGCAGAGGGCAGGGG - Intronic
1071923136 10:90374196-90374218 AGGCACTGAGCTGGGTTCTGTGG - Intergenic
1071967256 10:90864343-90864365 AGGCACTGTGCTAAGTGCTGGGG + Intergenic
1072263616 10:93706036-93706058 TGGCACTGTGCTGAGCACTGGGG - Intergenic
1072356399 10:94615836-94615858 AGGACATTTGCTGAATTCTGTGG - Intergenic
1072459677 10:95607573-95607595 AGGCACTGTGTTGAGCCCTGGGG + Intronic
1072484608 10:95843214-95843236 AGGCACTGTTCTAAGTACTGAGG + Intronic
1072765000 10:98088081-98088103 AGGCACTGTGCTGGGCTCTGAGG - Intergenic
1072775277 10:98185259-98185281 AGGCCCTGTGCTCAGTGTTGGGG + Intronic
1072816663 10:98516301-98516323 AGACCCTGTGCTGGGTGCTGAGG - Intronic
1072970019 10:100009666-100009688 CGGCGCTGTGCTGCGCTCTGTGG - Intronic
1073338852 10:102729999-102730021 AGGCCGTGTGTTGAGTCCCGTGG + Intronic
1074052866 10:109895667-109895689 AGGCCCTATGCTGTGTTCTAAGG - Intronic
1074827802 10:117227550-117227572 AAGCCTTGTGCTTAGGTCTGTGG + Intergenic
1074858292 10:117489786-117489808 AGGCCCTGAGCTCAGCTCTGGGG - Intergenic
1075087604 10:119423944-119423966 TGGCACTGTGCTGGGTGCTGGGG + Intronic
1075341723 10:121651610-121651632 AGGTTCTGTGCTGGGTCCTGGGG - Intergenic
1075439280 10:122466536-122466558 TGACCCTGTACTGAGCTCTGGGG + Intronic
1075652624 10:124139182-124139204 AAGCCCTCTGCTGGGTGCTGGGG + Intergenic
1075909599 10:126112768-126112790 AGGCCCTGTGTAGGGTGCTGGGG + Intronic
1075925662 10:126249945-126249967 AGTCCCTGTGCTAAGTAGTGAGG - Intronic
1075931346 10:126299386-126299408 AGGCACTATACAGAGTTCTGGGG + Intronic
1076336120 10:129707443-129707465 TGGCCGTGTGCTGTGTTCAGGGG - Intronic
1076348361 10:129796380-129796402 AGGCACTGTTCTGGGGTCTGGGG + Intergenic
1076353967 10:129839175-129839197 AGGCTCTCTGCTGGGTGCTGAGG - Intronic
1076606626 10:131693728-131693750 AGTCCCTGTGGCGGGTTCTGTGG + Intergenic
1076984875 11:228231-228253 AGGCCCTTTGCTGGGTTCTGTGG - Intronic
1077228386 11:1448153-1448175 AGCCCCTGTGCTGTGTCCGGTGG + Intronic
1077917650 11:6621818-6621840 AGACTCTGCGCTGAGTGCTGAGG + Exonic
1077991407 11:7415396-7415418 AGGGTGTGTGCTGAGCTCTGTGG + Intronic
1078469498 11:11575691-11575713 ACACACTGTGCTGGGTTCTGGGG - Intronic
1078570865 11:12456851-12456873 AGGCCCTGTGCTGTGTCCTGGGG - Intronic
1078643291 11:13115627-13115649 AGGGCCTGGGCTAGGTTCTGGGG + Intergenic
1078731715 11:13981106-13981128 AGGCTCTGTGCTAGGTTCTGGGG + Intronic
1078830028 11:14969903-14969925 AGGCCCTGTGCTGAGCGCTTGGG + Intronic
1079145545 11:17848095-17848117 AGGCCCTTTGCTGAATCCTAGGG + Intronic
1079308584 11:19345429-19345451 ATGCTCTGTGCTGAGCTCCGGGG + Intergenic
1079369758 11:19840867-19840889 AGACACTGTGCTAAGCTCTGGGG + Intronic
1079522790 11:21348359-21348381 GGACCCTGTGCTGAGCTCTAGGG + Intronic
1079961565 11:26930584-26930606 AGGCTCTGTGCTAAGTATTGAGG + Intergenic
1080022095 11:27572846-27572868 AGGCACTGTGCTAGGCTCTGGGG + Intergenic
1080313038 11:30916581-30916603 AGGCTCTGTGCTAAGTTGTCAGG + Intronic
1080326576 11:31081101-31081123 AGGCCTTGTGATCAGCTCTGAGG - Intronic
1080396878 11:31898324-31898346 CGGCCCTGTGCTGGGTGCTGTGG - Intronic
1080521604 11:33072209-33072231 AGTCACTGTGCTGAGTGCTGAGG + Intronic
1080539566 11:33253503-33253525 AGGCCCTGTTCTAGGCTCTGGGG + Intergenic
1080570040 11:33547400-33547422 AGGCCCTGAGCTCGGTGCTGCGG - Intronic
1080888719 11:36390010-36390032 AGGCCCTGTGCTAAGCCCTGGGG + Intronic
1081245715 11:40764138-40764160 AGGCACTGCGCTGAGTCCTGAGG + Intronic
1081484566 11:43517551-43517573 AGGCACTATGCTGGGTGCTGGGG + Intergenic
1081535458 11:43993115-43993137 ACACCCTGTACTGAGGTCTGCGG - Intergenic
1081578134 11:44332446-44332468 TGGCTCTGTGCTGGGTTCCGGGG - Intergenic
1082006865 11:47424183-47424205 AGGCCCTGTGCTGTGTCCTTAGG - Exonic
1082799787 11:57406172-57406194 AGGCCCTGTCCTGGGTGCTGGGG - Intronic
1082986640 11:59174948-59174970 AGGCCCTGTGCTGGGTGCTGCGG + Intronic
1083150205 11:60787122-60787144 TGGCCCTGTGCAGAGCGCTGAGG + Intronic
1083188626 11:61033703-61033725 AGGCCCTCTTCTGCGTGCTGGGG - Intergenic
1083213592 11:61204507-61204529 AGGGCCTGTGCTGGGCTCAGGGG + Intronic
1083216475 11:61223343-61223365 AGGGCCTGTGCTGGGCTCAGGGG + Intronic
1083219357 11:61242169-61242191 AGGGCCTGTGCTGGGCTCAGGGG + Intronic
1083552300 11:63599072-63599094 AGACCCTGCACTGAGTGCTGGGG + Intronic
1083614796 11:64021076-64021098 AGGCGCTGTGCTGAGAGCCGGGG - Intronic
1083996388 11:66275086-66275108 GGGTCCTGTGCTAAGTGCTGGGG - Intronic
1083998055 11:66281958-66281980 AGGCCCTGTGCTGAGCACTGGGG - Intronic
1084070656 11:66731820-66731842 AGGCACTGTGCTGGGATCTGGGG + Intergenic
1084475696 11:69387399-69387421 AGGCACTGTGCTAGGTGCTGGGG - Intergenic
1084855601 11:71983655-71983677 AGGCCCTGTGCTGAGTGCTGGGG + Intronic
1084874673 11:72122341-72122363 AGGTACTGTGCTGGGTGCTGAGG - Intronic
1084961840 11:72720983-72721005 TGGCCCTGTGCTGGCTCCTGAGG + Intronic
1085084319 11:73656629-73656651 AGGCCCTGTGCTGAGTTCTGGGG - Intronic
1085130186 11:74031675-74031697 AGGCCCTGTGCTGGGTGCCAAGG - Intronic
1085152535 11:74263650-74263672 AGGCACTGTGCTGAGAACTTAGG - Intronic
1085259754 11:75197759-75197781 AGGCCCTGTTCTGGGAGCTGAGG + Intronic
1085280066 11:75324464-75324486 AGGCCCTGTTCTGAACCCTGAGG - Intronic
1085280411 11:75326267-75326289 AGGCCCTGGGCTGCTTTCTGGGG - Intronic
1085287876 11:75375822-75375844 AGGCACTGCGCTGGGTGCTGGGG - Intergenic
1085322978 11:75585906-75585928 AGGCTCAGTGCTGAGCACTGGGG - Intergenic
1085346490 11:75771384-75771406 AGGTCCTGTGCTGAACCCTGAGG - Intronic
1085394133 11:76198090-76198112 AACCCCTGGGCTGAGTTCTGAGG + Intronic
1085451148 11:76634376-76634398 AGGCCCTGTGCTGGGCACTAGGG - Intergenic
1085462707 11:76704105-76704127 AGGCCCTGTGCTTAGAGCTAAGG + Intergenic
1085513908 11:77101506-77101528 AAGCCCTGGGGTCAGTTCTGGGG - Intronic
1085635856 11:78159030-78159052 AAGCACTGTGCTGAGGGCTGGGG - Intergenic
1085671908 11:78474675-78474697 AGGCACTGGGCTAAGTCCTGGGG + Intronic
1085703834 11:78768557-78768579 AGGCCCTGTCCAGGGTACTGGGG - Intronic
1085719286 11:78898735-78898757 AAGCCCTGTGTTGTGTGCTGGGG + Intronic
1085734966 11:79031100-79031122 AGGCACTGTGCTGGGTGCTACGG - Intronic
1085757827 11:79216265-79216287 AAGCCCTGTGCTGGGTGCTTGGG - Intronic
1085816145 11:79739333-79739355 AGACCCTGTGCTGGGGGCTGAGG - Intergenic
1086596189 11:88574168-88574190 AGGCACTGTGCTCAGTACTGAGG - Intronic
1086737340 11:90322614-90322636 AAGCCCAGTGCTAGGTTCTGGGG - Intergenic
1087047080 11:93851131-93851153 AGGCACTGTGTTAAGTGCTGGGG + Intergenic
1087112546 11:94486541-94486563 AGACCCTCTACTGAGTCCTGAGG + Intronic
1087179427 11:95127154-95127176 AGGCCTTGGGCTGGGTTCTGGGG + Intronic
1087311024 11:96543538-96543560 AGGCATTGTGCTGAATTCAGAGG + Intergenic
1088086078 11:105982029-105982051 AGGCACTGTGCTGGGTGCTGGGG - Exonic
1088352737 11:108908736-108908758 ATGTACTTTGCTGAGTTCTGGGG + Intronic
1088384327 11:109236430-109236452 AGACCCTGTGCTTACATCTGGGG + Intergenic
1088545132 11:110951567-110951589 AGTCTCTGTGGTCAGTTCTGTGG - Intergenic
1088646972 11:111925363-111925385 AGGCTCTGTGCCATGTTCTGGGG - Intronic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1088678249 11:112217289-112217311 AGGCACTGTGCTAGGTTCTGGGG + Intronic
1088738976 11:112751427-112751449 AGGCCCTGTGGTGAGCTCAGAGG - Intergenic
1088805591 11:113349068-113349090 AGGCAATGTGGTCAGTTCTGAGG - Intronic
1089052291 11:115556439-115556461 AGGCACTATGCTGAGTGCTGGGG - Intergenic
1089139686 11:116275731-116275753 GGGCCCAGGGCTGACTTCTGGGG + Intergenic
1089586407 11:119512515-119512537 AGGCTCTGAGCTGAGTGCTGGGG + Intergenic
1089600302 11:119610249-119610271 AGCCCAATTGCTGAGTTCTGGGG + Intergenic
1089668388 11:120034702-120034724 AGGCCCAGTGCTGGGCTCTGGGG - Intergenic
1089768476 11:120785656-120785678 TGGCTCTGTGCTGAGTTGTATGG + Intronic
1090064878 11:123494111-123494133 AGGCACTGTGCTAAGTGTTGCGG - Intergenic
1090257707 11:125297343-125297365 AGGCCTTCTGCTAATTTCTGGGG + Intronic
1090747789 11:129721086-129721108 GGGGCTTGTGCTCAGTTCTGCGG - Intergenic
1090911358 11:131122328-131122350 AGGCACTGTGCTAAGTTCCTAGG + Intergenic
1091033780 11:132214944-132214966 TGGCACTCTGGTGAGTTCTGAGG - Intronic
1091124802 11:133084262-133084284 AGGCCCTGTGCAGGTGTCTGGGG - Intronic
1091187856 11:133662621-133662643 AGGCACTGTGCTGGGTGCTGTGG + Intergenic
1091744050 12:2979915-2979937 AGTACCTGTGCTGAGTTGTTAGG + Intronic
1091831626 12:3554391-3554413 GAGCCCTGTGCTCAGTGCTGGGG + Intronic
1091881089 12:3978780-3978802 AGGCACTGTTCTGAGTACTTGGG - Intergenic
1091948569 12:4571901-4571923 AGGCACTGACCTAAGTTCTGGGG - Intronic
1091983160 12:4882898-4882920 AGGCCTTGTACTGGGTTCTAGGG + Intergenic
1092252802 12:6910261-6910283 AGGCCTTGTGCTGTGTTTTGGGG + Intronic
1092489458 12:8932142-8932164 AGGCCCTGGGCTGTGTTTTAGGG + Intronic
1092757267 12:11775387-11775409 AGGCCTTGTGATGAGTGCTGGGG + Intronic
1092827195 12:12411957-12411979 GGGCCCTCTGCTCATTTCTGTGG + Intronic
1093996548 12:25649093-25649115 AGGCACTGTGCTCAGTGCTAGGG + Intergenic
1094111770 12:26870029-26870051 AGGCCCTGTACTGAGCCCTCTGG + Intergenic
1094426014 12:30317913-30317935 AGGTGCTGTGCTGGGTGCTGGGG - Intergenic
1094811537 12:34143077-34143099 AGCACCTGTGCTGTGTTATGGGG - Intergenic
1094837020 12:34326846-34326868 AGCCCCTGCGCTGTGTCCTGGGG - Intergenic
1096228245 12:49882811-49882833 AGGCCCTGTTCTGGGCACTGGGG + Intronic
1096601779 12:52734748-52734770 TGGCCCTGTGCTTGGTGCTGGGG - Intergenic
1096756662 12:53805078-53805100 AGGCCCTCTGGTTAGCTCTGAGG + Intergenic
1096860319 12:54522100-54522122 AAGCCCTGTGCTGGGTTTTTGGG + Intronic
1097330074 12:58323452-58323474 AGGCACTGTTCTGGGTGCTGAGG - Intergenic
1097338278 12:58409048-58409070 AGGCACTGTGTTAAGTTTTGGGG + Intergenic
1097640487 12:62174974-62174996 AGGCACTGTGCTATGTGCTGTGG - Intronic
1098503035 12:71216552-71216574 AAAGTCTGTGCTGAGTTCTGAGG + Intronic
1099232568 12:80044171-80044193 AGGCACTGTGCTAAGTCCAGAGG - Intergenic
1099397182 12:82155326-82155348 AAGCACTGTGCAAAGTTCTGGGG + Intergenic
1100343619 12:93705165-93705187 AGGCACTGTCCTGGGGTCTGGGG - Intronic
1100467233 12:94857066-94857088 AGGCCCAATGCTAGGTTCTGGGG + Intergenic
1100470992 12:94892817-94892839 AAGTCCTGGGCTCAGTTCTGGGG - Intergenic
1100744993 12:97635768-97635790 AGGCACTGTGCTAAGTGCTGAGG + Intergenic
1101195574 12:102378610-102378632 AGGCACTGGGCTGACTGCTGGGG + Intergenic
1101717562 12:107323808-107323830 AGGCACTGTGCTGAGTGATATGG - Intronic
1101790176 12:107918898-107918920 ATGCTCTGTGCTCAGTGCTGGGG - Intergenic
1101921610 12:108937617-108937639 TGGATCTGTGCTGAGGTCTGAGG - Intronic
1102030330 12:109736645-109736667 AGGCCCTGTGCTAGATGCTGGGG - Intronic
1102036876 12:109775612-109775634 AGACCCTAAGCTGAGATCTGCGG + Intergenic
1102317899 12:111904804-111904826 AGGCACTGGTCAGAGTTCTGGGG + Intergenic
1102365482 12:112330665-112330687 AGACACTGTGCTCAGCTCTGGGG - Intronic
1102406201 12:112676328-112676350 AGGCTGTGTGCTCATTTCTGAGG + Intronic
1102434668 12:112911475-112911497 AGGCTCTGTTTTAAGTTCTGGGG - Intronic
1102470779 12:113158774-113158796 TGGCCCTGTGCTGGGCACTGGGG - Exonic
1102795463 12:115685576-115685598 AGATACTGTGCTGGGTTCTGAGG + Intergenic
1102887056 12:116530220-116530242 AGGGACTGTGCTAAGTGCTGGGG + Intergenic
1103286656 12:119807553-119807575 TGGCACTGTGCTGTGTACTGAGG - Intronic
1103643188 12:122369535-122369557 AGGCCCTGTCCTAAGTGTTGTGG + Intronic
1103689068 12:122756057-122756079 AGGTCCTCGGCTAAGTTCTGTGG + Intronic
1104285983 12:127425286-127425308 AGGCCCTGTGCTGGACTGTGAGG - Intergenic
1104343831 12:127977721-127977743 AGGCTTTGTGCTGAGTATTGGGG - Intergenic
1104364107 12:128161606-128161628 AGGCACTGTGCTGTGAGCTGAGG + Intergenic
1104626347 12:130358834-130358856 AGGCCCTGTTCTCAGTGCTGGGG - Intronic
1104685030 12:130779269-130779291 AGGCGTTGTGCTGACTCCTGTGG - Intergenic
1105818241 13:24056589-24056611 AGACACTGTGCTGGGCTCTGTGG - Intronic
1105939610 13:25135696-25135718 AGGCACAGTGCTGGGTTCAGGGG - Intergenic
1106138116 13:26989780-26989802 CGGGGCTGTCCTGAGTTCTGTGG - Intergenic
1106139546 13:27000791-27000813 AGGCCCTGTGCTAAGCACTGGGG + Intergenic
1106174947 13:27322250-27322272 AGGCCCTGTGCAGGGGACTGGGG + Intergenic
1106299874 13:28453828-28453850 ATACCCTGTGCTGGGTCCTGGGG + Intronic
1106594817 13:31127046-31127068 AGGCTCTGTGCTAAGCTCTGGGG + Intergenic
1106814014 13:33387420-33387442 TGGCCCTGTGCTAAGTGCTGGGG + Intergenic
1107555398 13:41513251-41513273 AGGCCCTGTGCTAGGTGTTGGGG + Intergenic
1107579079 13:41762815-41762837 AGGCACTGTGCTGAGCTCTGGGG - Intronic
1107699059 13:43029189-43029211 AGGACTTATGCTAAGTTCTGGGG - Intronic
1108145876 13:47476383-47476405 TGGCCCAATGCTAAGTTCTGTGG + Intergenic
1108712413 13:53046609-53046631 TGGCCCTGTTCTGGGTACTGGGG + Intronic
1109270780 13:60252871-60252893 AGGCCTTGTGCTGAGTATTGGGG - Intergenic
1110446871 13:75594621-75594643 AGGCATTGTGCTAAGTGCTGAGG + Intronic
1111623809 13:90757423-90757445 AGGTACTCTTCTGAGTTCTGTGG + Intergenic
1111801298 13:92984352-92984374 AGGCCCCATGCTCAGTGCTGGGG - Intergenic
1112044489 13:95582596-95582618 AGGCCCTGAGCTGAATGCTGGGG - Intronic
1112105881 13:96238744-96238766 AAGCACTGTGCTGGGTACTGGGG - Intronic
1112120680 13:96407639-96407661 AAGCACTGTGCTGGGTGCTGTGG + Intronic
1112155236 13:96809899-96809921 AGGCCCTGTGCCAAGCTCTATGG - Intronic
1112703757 13:102042523-102042545 AGGCCCTGTTCTAGGTTCTGAGG - Intronic
1113474196 13:110568497-110568519 AAGCCCTGTGCTCAGTGCCGGGG - Intergenic
1113695297 13:112342004-112342026 AGGCTCTGGGCTGGGCTCTGAGG - Intergenic
1113770246 13:112903648-112903670 AGGGTATGTGCTTAGTTCTGCGG + Intronic
1113949761 13:114065464-114065486 AGCCTCTGGGCTGAGCTCTGCGG + Intronic
1114392362 14:22323602-22323624 AGGCACTATGCTAAGTACTGGGG - Intergenic
1115292454 14:31787632-31787654 AGGCACTGTGCTGAGTCCTAAGG - Intronic
1116312323 14:43342419-43342441 AGCCCCTGTGCTGTGATGTGCGG + Intergenic
1116505319 14:45670624-45670646 AGGCACTGTGCTGAGCACTGCGG + Intergenic
1116631243 14:47336875-47336897 GGGCACTGTGCTGGGTACTGTGG - Intronic
1116858634 14:49975979-49976001 AGGCTCTCTGGTGATTTCTGCGG + Intergenic
1117206114 14:53445439-53445461 AGGTACTGTGCTGGGCTCTGGGG + Intergenic
1117209539 14:53481327-53481349 AGGCCCCATACAGAGTTCTGAGG - Intergenic
1117489737 14:56234590-56234612 AGGGCCTGTGGTGGGTTGTGGGG + Intronic
1117627545 14:57655307-57655329 AGGCACTGCGCTGAGTGCTGGGG + Intronic
1117747019 14:58879970-58879992 AGGCCCTGTGTTAGGTGCTGTGG - Intergenic
1117949595 14:61068796-61068818 AGGCACTGTCCTAAGCTCTGAGG - Intronic
1118262943 14:64265068-64265090 AGGTCCTGTAGTGAATTCTGGGG + Intronic
1118278735 14:64409813-64409835 AGGCCATGTCCTGAGATCTGAGG + Intronic
1118884469 14:69854833-69854855 AGGCACTGTTCTAAGTGCTGTGG - Intronic
1118997270 14:70848037-70848059 AGGCCTTGTGCTCAGTTCTAGGG + Intergenic
1119197476 14:72727758-72727780 AGGCACTGTGCTGGGTGCTAGGG - Intronic
1119203815 14:72779067-72779089 AGGCTCTGTGCTGAACACTGCGG - Intronic
1119423290 14:74520947-74520969 AGGCACTGTGCCAAGCTCTGAGG - Intronic
1119695251 14:76708392-76708414 AGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1120219677 14:81718241-81718263 AGGCACTGTGCTAGGCTCTGGGG - Intergenic
1120679037 14:87457292-87457314 AGGCCCTATGCTAAATACTGAGG + Intergenic
1120825443 14:88950751-88950773 AGGCTCTGTGCTATGTCCTGGGG - Intergenic
1120908475 14:89642891-89642913 AGGCACTGTGCTAGGTACTGGGG - Intergenic
1121029965 14:90649841-90649863 AGGCCCTATGCTAACTTCTGGGG + Intronic
1121384002 14:93500374-93500396 AGGCACTGTCCTAAGTACTGGGG + Intronic
1121533092 14:94672214-94672236 GAGCCCAGTGCTGAGTGCTGGGG - Intergenic
1121575359 14:94980570-94980592 AGGCACCGTGCTGGGTGCTGGGG - Intergenic
1121718636 14:96094147-96094169 AGGCACTGTGCTGGGTGGTGGGG - Intergenic
1121795847 14:96734724-96734746 AGGCTCTGTGCTAGGTTCTGGGG + Intergenic
1122055239 14:99093662-99093684 TGGCCCTGTGGTGGGTGCTGGGG + Intergenic
1122248669 14:100422813-100422835 AGGCCCTGTGCTCCATCCTGGGG + Intronic
1122436971 14:101706951-101706973 AGGCACTGTGCTGGGTGCTGGGG - Intergenic
1122457265 14:101864111-101864133 AGGCAGTGTGCTGAATTCAGTGG - Intronic
1122517814 14:102320675-102320697 AGGCACTGTGCTGGGTACTGCGG - Intronic
1123031908 14:105455950-105455972 AGTCACTGTGCTGAGGCCTGTGG + Intronic
1202898974 14_GL000194v1_random:25040-25062 AGGCCCTGTGCTGAGCCCCGTGG - Intergenic
1202899519 14_GL000194v1_random:27325-27347 AGCCCCTGTGCTGGGTACCGGGG - Intergenic
1125639171 15:41215298-41215320 AGGCACTGTTCTGAGCTCTTGGG - Intronic
1125972832 15:43926030-43926052 AGGCCCTGTGCTAAGTTCTGGGG - Intronic
1126075375 15:44904042-44904064 AGGCACTGTGCTGGGTGCTGTGG + Intergenic
1126082995 15:44983745-44983767 AGGCACTGTGCTGGGTGCTGTGG - Intergenic
1126324518 15:47462325-47462347 AGGCACTGTGCTGGGACCTGTGG - Intronic
1126682893 15:51220433-51220455 AGGCACTGTTCTAGGTTCTGGGG - Intronic
1126994978 15:54432141-54432163 AGGCACTGTGCTAAGTACTTGGG + Intronic
1127157354 15:56141725-56141747 AGACCCTGTGATAAGTTCTCAGG - Intronic
1127295448 15:57604858-57604880 AGCTCCTGTGCTAAGTGCTGAGG + Intronic
1127981468 15:64038278-64038300 GGGGTCTGTGCTGAGTACTGTGG - Intronic
1128131370 15:65229302-65229324 AGGCCCTGAGCTAGGTGCTGGGG + Intergenic
1128323004 15:66705679-66705701 AGGCACTGTGCTGGGTGCTGTGG + Intronic
1128435327 15:67642314-67642336 AGACCCTGTGTGGAGTGCTGGGG + Intronic
1128656777 15:69468440-69468462 AGGCCCTGGGCTCAGGCCTGAGG - Intergenic
1128688304 15:69703585-69703607 AGGCCTGATGCTGAGTTATGGGG + Intergenic
1128847283 15:70910778-70910800 AGGCACTGTTATGAGTGCTGGGG + Intronic
1128892648 15:71344585-71344607 CGGCACAGTGCTGAGTACTGTGG - Intronic
1129191002 15:73937576-73937598 AGGCCCTGTGCCGGCCTCTGTGG - Intronic
1129230232 15:74192977-74192999 AGGCCCCGGGCTCAGTGCTGTGG - Intronic
1129238375 15:74237240-74237262 AGGCACTGTTCTGAGTGCTGGGG - Intronic
1129319106 15:74763957-74763979 AGGCCCTGCCCAGAGTTTTGGGG + Intergenic
1129367919 15:75068399-75068421 AGGCACTGTGCCCAGTGCTGCGG + Intronic
1129450093 15:75646871-75646893 AGGCACTGTGCTGGGCACTGGGG - Intronic
1129606407 15:77027296-77027318 GGCCCCTGTGCCGAGGTCTGGGG - Intronic
1129656996 15:77530973-77530995 GGGCACTGTGCTAAGTACTGGGG - Intergenic
1129695779 15:77739982-77740004 AGGCACTGAGCTGAGAGCTGGGG + Intronic
1129802709 15:78428262-78428284 AGGCCCTGTGGTAAGGGCTGGGG - Intergenic
1129941342 15:79499700-79499722 AAGCTCTATGCTGAGTTTTGGGG - Intergenic
1130101018 15:80894113-80894135 AGGCCCTGGGCTGAATGCTGGGG + Intronic
1130136466 15:81185637-81185659 AAGCACTGTGCTGGGCTCTGGGG + Intronic
1130149088 15:81297767-81297789 AGGCCCTGTGCTAGATGCTGGGG + Intronic
1130407152 15:83612349-83612371 AGGATCTGTGCTGACATCTGTGG + Intronic
1130446656 15:84008390-84008412 AGGCCCCGTGGTGAGTTCTTAGG + Intronic
1131050124 15:89342191-89342213 AGGCCCTGTGCTAGGTGCTGGGG - Intergenic
1131072224 15:89473047-89473069 AGGCACTGTCCTGGGTGCTGAGG + Intronic
1131197212 15:90365174-90365196 AGGCACTGTTCTAAGTGCTGTGG - Intronic
1131226468 15:90628469-90628491 AGGCCCTGTGCCAGGTGCTGAGG + Intronic
1131231556 15:90663849-90663871 AGGCACTGTTTTAAGTTCTGGGG - Intergenic
1131262923 15:90897994-90898016 GGGACATTTGCTGAGTTCTGAGG + Intergenic
1132303220 15:100789278-100789300 ATTCCCTTTGCTGAGCTCTGCGG - Intergenic
1132347405 15:101116551-101116573 AGGCCCTGTGATGTGTGCTGGGG - Intergenic
1132386980 15:101407680-101407702 AGGCCTTGTGGTGGTTTCTGTGG - Intronic
1132866623 16:2096236-2096258 AGGCCCTGTGGTGTGGCCTGTGG + Intronic
1133097077 16:3454769-3454791 TGGCTCTGTGATGAGTTCAGAGG - Intronic
1133332835 16:4987287-4987309 AGTCCCTGTGCTTCCTTCTGAGG + Intronic
1133559204 16:6934729-6934751 AGGCCCTTTGCTTAGTTTGGAGG + Intronic
1133631279 16:7624531-7624553 AGGCACTGTGCTGGGCTTTGGGG - Intronic
1133685938 16:8165661-8165683 AGGCACTGTGCTAAGTACTGAGG + Intergenic
1133787715 16:8986092-8986114 AGGCCCTGTCCTGGGTATTGTGG + Intergenic
1133984961 16:10661406-10661428 AGATTCTGTGCTGAGATCTGGGG - Intronic
1134856959 16:17528015-17528037 AGGCACTGTGCTAGGTGCTGGGG - Intergenic
1135048592 16:19173982-19174004 AGGCCCTGGGCTAAGTGCTAGGG - Intronic
1135474747 16:22764055-22764077 AGGCCCTGTTCCCAGTGCTGTGG - Intergenic
1135658376 16:24271654-24271676 AGACCCTGTGTTGGGTCCTGAGG + Intronic
1135859038 16:26038212-26038234 TGCCCCTGTGGTGAGTTCTCAGG + Intronic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1135972266 16:27081137-27081159 CTGCTCTGTGCTGAGTACTGGGG - Intergenic
1136504692 16:30695432-30695454 TGGCCCTGTGCTGTGTGCAGTGG - Intergenic
1136516360 16:30771047-30771069 AGGCCTTGCGCTGATTGCTGTGG + Intronic
1137238884 16:46638174-46638196 AGGCTCTGTACTGGGTACTGAGG - Intergenic
1137573294 16:49580456-49580478 AGGCGCTTTGCTGGGCTCTGGGG - Intronic
1137661419 16:50210131-50210153 AGTCCCTGTGCTTACCTCTGTGG + Intronic
1137748817 16:50842921-50842943 AGGGACTGTGCTCAGTGCTGGGG - Intergenic
1137906983 16:52333254-52333276 AGGCCATGTGCTGGGTGCTGGGG - Intergenic
1137934264 16:52618903-52618925 AGGCTCTCTGCTAAGTGCTGGGG + Intergenic
1138002367 16:53295093-53295115 AGGCCATATGCTGAGCTCTGAGG - Intronic
1138121739 16:54405774-54405796 AGTCACTGTGCTGAGCTCTCGGG - Intergenic
1138226145 16:55296738-55296760 AGTCTATGTGCTGAGTACTGTGG + Intergenic
1138345314 16:56316779-56316801 AAGCCCAGGGCTGAGTGCTGGGG - Intronic
1138375798 16:56563252-56563274 AGGCACTGTGCTGGGCACTGGGG - Intergenic
1138627589 16:58264903-58264925 AGGCACTGGGCTGAGTGCTAAGG + Intronic
1139314875 16:66059603-66059625 AGGCACTGTGCTGGGCACTGGGG - Intergenic
1139323468 16:66133981-66134003 GTGCCCCGTGCTGGGTTCTGAGG + Intergenic
1139471919 16:67182965-67182987 AGGCACTGTTCTGGGTTCTGGGG - Intronic
1139702127 16:68714296-68714318 AGGTCCTGTGCTTGGTGCTGGGG - Intronic
1140014830 16:71171911-71171933 AGGCCCTGTGCCAGGTACTGGGG + Intronic
1140202236 16:72904044-72904066 AGGAGCTGTGCTGAGAACTGAGG - Intronic
1140806031 16:78533100-78533122 AGGCACTGGGAGGAGTTCTGAGG - Intronic
1141116036 16:81310066-81310088 AGGCACTGTACTGGGTGCTGGGG + Intergenic
1141146398 16:81533253-81533275 AGGCCCTGTTCTAAATGCTGGGG - Intronic
1141147252 16:81539941-81539963 AGGCCCAGTGCTCAGGGCTGGGG - Intronic
1141203565 16:81915289-81915311 AGGCACTGTTCTGGGCTCTGGGG + Intronic
1141380543 16:83572550-83572572 AGGCACTGTGCTCAGTACTGAGG - Intronic
1141497434 16:84419726-84419748 AGGCCCTGGGCTGGGTACCGAGG + Intronic
1141882040 16:86866679-86866701 AGGTACTGTGCTCAGTTCTGGGG + Intergenic
1142143248 16:88481916-88481938 CTGCCCTGTGTTGAGCTCTGAGG + Intronic
1142885060 17:2907371-2907393 AGGCCCAGTGCTCGGTTCTGGGG + Intronic
1143012499 17:3873613-3873635 GGGCCCCGTGCTGAGTGCTGAGG + Intronic
1143165822 17:4896867-4896889 GGCCCCTGGGCAGAGTTCTGGGG + Intronic
1143269856 17:5667508-5667530 AGGCCCTGTGCTGAGCAATGGGG - Intergenic
1143281566 17:5758423-5758445 AGGCACTGTGCTGGGGGCTGGGG - Intergenic
1143339291 17:6196574-6196596 AGGCTCTGTGCTGTGACCTGTGG + Intergenic
1143419676 17:6778974-6778996 AAGCCATGTGGTGAGTTTTGAGG - Intronic
1143951445 17:10635924-10635946 GGGCACTGTGCTAAGATCTGGGG + Intronic
1144125445 17:12198482-12198504 AGGCCCTTGGCTAAGTACTGGGG + Intergenic
1144409617 17:14988011-14988033 AGGCACTGTGCTGAGACATGGGG + Intergenic
1144573077 17:16412550-16412572 AGGCACTGTGCTGGTTGCTGGGG + Intergenic
1144769180 17:17749821-17749843 ATGCCCTATGCTGGGTGCTGGGG - Intronic
1144902772 17:18612873-18612895 GGGTGCTGTGCTGTGTTCTGTGG + Intergenic
1144930143 17:18852382-18852404 AGGCCCAGTGCTGAGGGTTGGGG - Intronic
1144965549 17:19075259-19075281 AGGCACTGTTCTCAGTGCTGGGG + Intergenic
1144982418 17:19176924-19176946 AGGCACTGTTCTCAGTGCTGGGG - Intergenic
1144985805 17:19201315-19201337 AGGCACTGTTCTCAGTGCTGGGG + Intergenic
1145260847 17:21353628-21353650 AGGCACTGTGCTGGGCACTGGGG + Intergenic
1145782310 17:27571228-27571250 AGGCTTTCTGCTGATTTCTGTGG + Intronic
1146024698 17:29309491-29309513 AGGCACTGTGCTAGGCTCTGGGG - Intergenic
1146374224 17:32283743-32283765 AGGCTCTGTGCTAAGTACCGGGG + Intronic
1146448083 17:32949161-32949183 AGGCTCTGTGCTGGGCTCTGGGG + Intergenic
1146694317 17:34897257-34897279 AGGTCCTGTGCTGGGTGCTAGGG - Intergenic
1147250065 17:39147822-39147844 AGGCACTGTGCTGGGTGCTGGGG + Intronic
1147252718 17:39162997-39163019 AGGCCCCGTGCTGGGCCCTGGGG + Intronic
1147358833 17:39918583-39918605 AGGAACTGTGCAGAGATCTGTGG - Exonic
1147572052 17:41577351-41577373 AGGCATTGGGCTGAGTGCTGGGG + Intergenic
1148145962 17:45365011-45365033 TGGCCCTGTGCTTGGTGCTGTGG + Intergenic
1148220249 17:45856337-45856359 AGGCCCTGTTTTTAGTTCTTTGG + Intergenic
1148659625 17:49318534-49318556 AGACACTGTGCTAAGCTCTGAGG - Intronic
1148743733 17:49907285-49907307 AGGCTCTCTGCTGAGATCAGGGG - Intergenic
1148773653 17:50081091-50081113 AGGTCCTGTGCTGGATGCTGGGG - Intronic
1148843614 17:50515348-50515370 AGGCACTGTGCTAGGTTCTAGGG - Intronic
1148864806 17:50622936-50622958 AGGCCCTGTGCTGGGACCTGGGG + Intronic
1148866611 17:50632064-50632086 AGGCACTGTCCTGGGTGCTGAGG + Intergenic
1149229939 17:54521036-54521058 AAGCACTGTGCTGAGTCCCGGGG - Intergenic
1149295301 17:55256714-55256736 AGGCACTGTGCTGGGCACTGAGG - Intergenic
1149432057 17:56602292-56602314 AGGCCCTGTGCTAGGCTCTGGGG - Intergenic
1149907709 17:60541814-60541836 GGGCCCTCTGCAGAGTCCTGAGG - Intergenic
1149985994 17:61347495-61347517 AGGCACTGTGCTGTGCACTGGGG + Intronic
1149994949 17:61401429-61401451 AGGCCTTGTGCTCAGATCTGGGG - Intronic
1150337375 17:64340661-64340683 AAGCTCTGTGCTCAGCTCTGGGG + Intronic
1150393358 17:64802966-64802988 AGGCACTGTTCTAAGTGCTGGGG - Intergenic
1150426189 17:65078868-65078890 AGGCCCTGAGCTGGGAGCTGGGG + Intergenic
1150646918 17:66984530-66984552 TAGCCCTGTGCTATGTTCTGGGG + Intronic
1150955936 17:69860363-69860385 AGGACATTTGCTGAGTGCTGAGG - Intergenic
1151171183 17:72247622-72247644 AGGTCCTGTGCTATGTGCTGGGG - Intergenic
1152141564 17:78540295-78540317 AGGCCTACTGCTGAGTGCTGGGG - Intronic
1152224529 17:79086481-79086503 AGACCCCGGGCTGAGTGCTGTGG + Exonic
1153713443 18:7822558-7822580 AGGCTCTTTGATGTGTTCTGTGG + Intronic
1154062254 18:11072936-11072958 GGGCCCTGTGCTAAGTGCAGAGG - Intronic
1155052215 18:22158347-22158369 AGGCTCTGTTCTGGGCTCTGGGG + Intergenic
1155347315 18:24871105-24871127 AGGCACTGTGCTAGGCTCTGGGG + Intergenic
1155391458 18:25341891-25341913 AGGCACTGTACTAAGTTCTGAGG - Intronic
1155832512 18:30535499-30535521 AGGCACTGTTCTGAGTGCTGGGG + Intergenic
1156761135 18:40591800-40591822 TGGCCCTGTTCTGAGTAATGTGG - Intergenic
1156843961 18:41641787-41641809 AGCCACTGTTCTGAGTTGTGTGG - Intergenic
1157114991 18:44854152-44854174 AGGCCTTGTGATGCATTCTGGGG - Intronic
1157285724 18:46375863-46375885 AGGCCCTGGGCTAAGGGCTGGGG + Intronic
1157300023 18:46472539-46472561 GGGGCCTGTGCTAAGTGCTGGGG + Intergenic
1157502973 18:48203782-48203804 AGGCTCTGGGCTGGGTGCTGGGG - Intronic
1157548065 18:48561534-48561556 AGACCCTGTGCTGGCTGCTGGGG + Intronic
1158194819 18:54872878-54872900 AGCCACTGAGCTGAGCTCTGTGG + Intronic
1159776110 18:72604758-72604780 ATGCCCTCTGCAGAGTTCTAAGG + Intronic
1159900247 18:74038643-74038665 TGGCCCTGTGCTGCATCCTGTGG - Intergenic
1160001113 18:75023956-75023978 ACGCACTGTGCTAAGTTATGGGG + Intronic
1160610067 18:80077847-80077869 GGGCACAGAGCTGAGTTCTGAGG + Intronic
1160669479 19:352582-352604 AGGACGAGTGCTGAGTTCTGGGG + Intergenic
1160699640 19:499711-499733 AGGCCCTGTTCTAGCTTCTGTGG - Intronic
1160723644 19:608289-608311 AGGCCCGGTCCTGGGGTCTGAGG + Intronic
1160877759 19:1305090-1305112 AGGCTCAGTGGTGAGGTCTGGGG - Intergenic
1160963939 19:1737371-1737393 AGGCTCTGTGCTGGATGCTGGGG + Intergenic
1161293769 19:3509135-3509157 TGGCTCTGTGCTGAGTCCAGTGG - Intronic
1161314397 19:3611135-3611157 AGGCCCTGTGCTCAGAGGTGGGG + Exonic
1161317443 19:3624247-3624269 AGGCACTGTTCTAGGTTCTGGGG + Intronic
1161516730 19:4700555-4700577 ACACCCTGTGCTGAGAGCTGGGG + Intronic
1161747403 19:6069543-6069565 AGGCCTAGGGCTGAGTTCTGGGG + Intronic
1161796025 19:6387296-6387318 AGGCCCTGTGCTGGGAGCTGGGG - Intronic
1161858104 19:6777306-6777328 AGGCCCTGTTCTTGGTGCTGGGG + Intronic
1161864265 19:6822142-6822164 AAGCCCTGCGCTGGGGTCTGCGG + Intronic
1162733302 19:12731755-12731777 AAGCCCTGTGCCAAGTGCTGTGG + Intronic
1162802711 19:13119809-13119831 AGGCCCTGTGCCGAGCTCGCTGG + Intronic
1162873255 19:13601511-13601533 TGGCCCTGTGCTAGGTCCTGGGG + Intronic
1163434391 19:17286539-17286561 AGGCCCGGGGCTGAGTGCTGGGG + Exonic
1163468612 19:17484081-17484103 AGGCACTGTTCTCAGCTCTGGGG - Intronic
1163546155 19:17942536-17942558 AGGCTCTGTGCTGGGTGCAGGGG - Intronic
1163564982 19:18045735-18045757 AGGCCCTGGGCTGTGGTCTGGGG - Intergenic
1163725928 19:18922985-18923007 AGCCCATTTGCTGTGTTCTGGGG + Intronic
1164095001 19:22000999-22001021 AAGCCCTGGGCTGAGTGCGGTGG + Intronic
1164145714 19:22511302-22511324 AGGCTCTGTGCTGGGCACTGGGG - Intronic
1164581322 19:29437140-29437162 AGGCCCTGGGCTGGTTGCTGGGG - Intergenic
1164698309 19:30263155-30263177 ATGCGCTGTGCTGCATTCTGGGG - Intronic
1164737523 19:30552844-30552866 AGGCCGTGTGCTGTCCTCTGTGG - Intronic
1165324825 19:35108475-35108497 AGACCCTGGGCTCAGTGCTGGGG + Intergenic
1165482612 19:36073647-36073669 AGGCCCTGTCCTAGGTGCTGAGG + Intronic
1165575886 19:36816977-36816999 AGGCACTGTCCTAAGTGCTGTGG + Intergenic
1165725449 19:38109684-38109706 AGGCACTGTGCTGGGTACTGAGG + Intronic
1165986750 19:39776338-39776360 AGGTCCTGTGCAGGGCTCTGAGG + Intergenic
1166007419 19:39917029-39917051 AGGCCCTGTCCTTGGTGCTGGGG - Intronic
1166228059 19:41409436-41409458 AAGCCCTGTGCTGGGTTCTGGGG - Intronic
1166341021 19:42136947-42136969 AAGCCCTGTGCTGGGAGCTGAGG + Intronic
1166640860 19:44494192-44494214 AGGCCCTGTGCAAAGCACTGTGG - Intronic
1167016199 19:46842641-46842663 TGGTCCTGTGCTGAGGGCTGGGG - Intronic
1167207976 19:48115413-48115435 AGGGTCTGTGCTGGGCTCTGGGG - Intergenic
1167487082 19:49768916-49768938 AGGCCCTGTTCTAGGTACTGGGG + Intronic
1167489448 19:49783083-49783105 AGGCACTGTGCTGATTGCTGGGG + Intronic
1167588034 19:50385948-50385970 AGGCCCTCTGCTGAGCACTGGGG + Intronic
1167695475 19:51013254-51013276 AGGCCCAGTGCTGGGTGCTGGGG - Exonic
1167757328 19:51421131-51421153 AGGCCCTTTTCTGAGCTCTGTGG - Intergenic
1168151576 19:54451801-54451823 AAGGCCTGTGTTCAGTTCTGTGG + Intronic
1168231942 19:55038244-55038266 CAGCCCTGTCCTGAGCTCTGTGG + Exonic
1168340065 19:55617580-55617602 AGGCCCTGAGCTGGGCACTGGGG + Exonic
1168379772 19:55910113-55910135 AGGTTCTGTTCTCAGTTCTGAGG - Intronic
1168641773 19:58035434-58035456 GGGTCCTGGGCTGAGGTCTGTGG - Intronic
1202709990 1_KI270714v1_random:13567-13589 TGGCGCTGTGCTGTGTGCTGTGG - Intergenic
925185568 2:1844021-1844043 AGGCCCTGTGGTCTCTTCTGGGG + Intronic
925535154 2:4908811-4908833 AGGCCCTCTTCTGAGATCTGTGG + Intergenic
925788203 2:7453437-7453459 AGGCACTGTGCTGGGCTCTGAGG + Intergenic
925973780 2:9126484-9126506 AGGCCCTCTGCTGCGAACTGGGG + Intergenic
926137813 2:10348921-10348943 AGGCCCTTTCCTGAGCTCTTTGG - Intronic
926242238 2:11097195-11097217 AGGCACTGTGCTAAGCTCGGAGG - Intergenic
926320012 2:11743162-11743184 AGGCCCTAGGCTGAGCACTGGGG - Intronic
926597278 2:14805051-14805073 AGGCCTTGTGCTCAGATTTGAGG + Intergenic
926721889 2:15967056-15967078 AGGCCCTGTGCTCAGTTCTAGGG + Intergenic
927146429 2:20169271-20169293 AGGCTGTGTGTTAAGTTCTGGGG + Intergenic
927213068 2:20650640-20650662 AGGCCCGGTGCTGGGCACTGGGG - Intronic
927271629 2:21216352-21216374 AGGCACTGTGCTAAGGTCTGGGG + Intergenic
927313646 2:21657314-21657336 AGGCCCTGTGCTAAGTGCAAGGG - Intergenic
927369410 2:22337384-22337406 TGGCTCTGTGCTAAGTGCTGTGG + Intergenic
927554996 2:24024976-24024998 AGGCTCTGTGCTGGGCTCTTGGG - Intronic
927766927 2:25819027-25819049 AGAGGCTGTCCTGAGTTCTGTGG - Intronic
927868143 2:26606157-26606179 AGACACTGCGCTGAGTCCTGGGG + Intronic
928108093 2:28485691-28485713 AGGCTCTGTGCTAAGTGCTGGGG + Intronic
928411093 2:31054521-31054543 AGGCGCTATGCTGGGTTCTGGGG - Intronic
928420631 2:31135829-31135851 AGGCTCTGTGCTGGGTTTGGGGG - Intronic
928472625 2:31589567-31589589 AGGCCTTGTGCCGAGGCCTGGGG + Intergenic
929212800 2:39376571-39376593 AGGCCCTAAGCTCAGTGCTGGGG + Intronic
929443852 2:41987847-41987869 AGTCCCTGTGCCAGGTTCTGGGG + Intergenic
929720749 2:44364530-44364552 AGGCCCTGTGCTAGGTGCAGAGG - Intronic
929759916 2:44798317-44798339 TGGCACAGTGCTGAGTGCTGAGG - Intergenic
929825038 2:45303452-45303474 AGGCACTGTGCTGGGTGCTGGGG - Intergenic
929914826 2:46126267-46126289 AGGCACTGTGCAGCGTGCTGGGG + Intronic
930882794 2:56291322-56291344 AGGCACTGTGCTGGGCACTGGGG + Intronic
931150650 2:59569367-59569389 AAGCACTCTGCTGAGTACTGAGG + Intergenic
931276525 2:60748475-60748497 AGCAGCTGTGCTAAGTTCTGAGG + Intergenic
931327836 2:61245790-61245812 AGGCACTGTTCTAAGTGCTGGGG - Intronic
931456381 2:62412688-62412710 AGGCACTGTCCTAAGATCTGCGG + Intergenic
931642468 2:64393912-64393934 AGGCTCAGTGCTGTGGTCTGGGG + Intergenic
932281500 2:70496768-70496790 ATGCACTGTGCTGGGTACTGGGG + Intronic
932347338 2:71004303-71004325 AGGACCTGTGCTGGGAACTGTGG - Intergenic
932570962 2:72938203-72938225 AGGCCCTCTGCTGAGTCAGGGGG - Intergenic
932613650 2:73218335-73218357 AGGCACTGTGCTAGGTGCTGTGG + Intronic
933346143 2:81088114-81088136 ATGCACTCTGCTAAGTTCTGAGG + Intergenic
933775936 2:85771201-85771223 AGGCAAAGTGCAGAGTTCTGGGG + Intronic
933984978 2:87583432-87583454 AGGCCTTTTGCTGAGCTCAGAGG + Intergenic
934769224 2:96897255-96897277 AGGCACGGTGCTAGGTTCTGGGG - Intronic
934777733 2:96949805-96949827 AGGCCCAGAGCAGAGCTCTGTGG + Intronic
934900763 2:98158219-98158241 AGAACCTGGGCTGAGTGCTGTGG + Intronic
934989490 2:98911380-98911402 AGGCCCCTTGCTAAGTGCTGTGG - Intronic
935111757 2:100100686-100100708 AGACCTTGTGCTGGTTTCTGTGG - Intronic
935123579 2:100202776-100202798 AGGCCCTGTCCTAGGTGCTGAGG + Intergenic
935346290 2:102111546-102111568 AAGCCCTGTGCTAGGTGCTGGGG + Intronic
935350011 2:102144587-102144609 AGGCACTGTGGTGAGTGGTGGGG + Intronic
935637129 2:105257917-105257939 AGGCATTGTGCAAAGTTCTGTGG - Intergenic
935694277 2:105757587-105757609 AGGCACTGTGCTGGGTGCCGTGG + Intronic
936059906 2:109287697-109287719 AGGGCCTCTGATGAGATCTGAGG - Intronic
936123208 2:109764482-109764504 AGACCTTGTGCTGGTTTCTGTGG + Intergenic
936221474 2:110606987-110607009 AGACCTTGTGCTGGTTTCTGTGG - Intergenic
936308869 2:111367379-111367401 AGGCCTTTTGCTGAGCTCAGAGG - Intergenic
936377504 2:111954489-111954511 AGGCACTGTGCTGGGTGATGGGG - Intronic
936756440 2:115718731-115718753 AGGCCCTGTGCTGAGCCTTGAGG - Intronic
936896698 2:117435678-117435700 AGGCACTGTGGTGGGTGCTGGGG + Intergenic
937081376 2:119142420-119142442 AGGCCCTGTAGTAAGTTCTGGGG - Intergenic
937355140 2:121193563-121193585 TGGCCCTGTGCTGGGCACTGGGG + Intergenic
937389341 2:121469777-121469799 AAGCCCTGTGTGGCGTTCTGGGG - Intronic
937456365 2:122044997-122045019 AGGCACTGTGCTTGGCTCTGGGG - Intergenic
938112998 2:128581597-128581619 AGGCCCTGTCCACAGCTCTGTGG - Intergenic
938242622 2:129755063-129755085 AGGCACTGTGCTGAGTGCCGAGG - Intergenic
938814929 2:134892422-134892444 AGGGCCTGTGCTGAAGTCTTAGG + Intronic
939502295 2:143003061-143003083 TGGCCCTGTGCTGAGTACTGAGG - Intronic
939996069 2:148921100-148921122 AGGCACAGTGCTGAGTGCTGGGG - Intronic
940360256 2:152789147-152789169 TGGCACTGTGCTAAGTACTGAGG + Intergenic
940972292 2:159906833-159906855 AGGCCCTGTGCCCAGTGTTGAGG - Intergenic
941176348 2:162201739-162201761 AGGCGCTGTGCTAAGTGCTAAGG + Intronic
941442702 2:165557713-165557735 AGGCACTGTGCTGAAAGCTGTGG - Intronic
942117056 2:172738293-172738315 AGGCACTGTGCTGGGCACTGGGG + Intronic
942353832 2:175084856-175084878 AGGCAATGTGCTGTGCTCTGGGG - Intronic
942383947 2:175421765-175421787 AGGCACTGTTCTGAGCTTTGGGG - Intergenic
942438256 2:176004180-176004202 AGGCCCTGTGTTACGTGCTGAGG + Intergenic
942782845 2:179666718-179666740 AGGCCCTGCTCTGAGTGCTGAGG + Intronic
943294025 2:186114585-186114607 GGGCCATGTGCTGGGCTCTGAGG + Intergenic
943328535 2:186530977-186530999 AAGCACTGTGCTGGGTACTGGGG + Intergenic
944832384 2:203545783-203545805 AGGCACTGTGCTGAATGATGGGG + Intergenic
944858185 2:203788261-203788283 ATGCCCTGTGCTAGGTACTGTGG + Intergenic
944863645 2:203839633-203839655 AGGCCCTGTGCTGGGCACTGAGG + Intergenic
945066460 2:205951550-205951572 AGGCCTTGTAGTTAGTTCTGTGG + Intergenic
945185617 2:207136696-207136718 AGGTACTGTGCTGGGTGCTGGGG - Intronic
945344418 2:208695996-208696018 AGGTCCTGGGCTCAGTGCTGTGG + Intronic
946247576 2:218396362-218396384 AGGTCCTGGGCTGGGGTCTGAGG - Exonic
946284633 2:218693751-218693773 AGGGCCTGTGCCGTCTTCTGGGG + Exonic
946415123 2:219536388-219536410 AGGCTCAGTGCTGGGTTCTGTGG + Intronic
946491462 2:220152973-220152995 AGGCCGTGTGCTAAATGCTGGGG - Intergenic
946756104 2:222949270-222949292 AGGGCCAGTGCTGAGACCTGTGG + Intergenic
947019296 2:225656767-225656789 AGGGACTGTGCTCAGTTCAGAGG + Intergenic
947353766 2:229271762-229271784 AGCCCCTATGCTGGGTTCTGAGG + Intergenic
947990607 2:234484705-234484727 AGGCCCTGTGCTAGGCTCTGGGG + Intergenic
948235949 2:236390786-236390808 AGGCCCAGTGCTGATTTTTGTGG + Intronic
948336376 2:237210635-237210657 AGGCACTGTTCTTGGTTCTGGGG + Intergenic
948393647 2:237629136-237629158 TGGCTCTGTGCTGAGCTCTTGGG - Intronic
948618992 2:239221536-239221558 AGGCCTTGCGGTGAGTGCTGAGG - Intronic
1168837033 20:884406-884428 AGGCCCAGTGCTGGGTGCTGGGG - Intronic
1168896422 20:1326805-1326827 AGGCACTGTGCTCAGCACTGGGG - Intronic
1168948270 20:1779155-1779177 AGACCCTGTGCTCAGTGCTGGGG - Intergenic
1168966851 20:1903962-1903984 AGGCCCTGTGCTGAGGTCCTGGG - Intronic
1168973014 20:1943779-1943801 TGGCCCTGTGCAAAGTTCTGAGG + Intergenic
1169205209 20:3735861-3735883 AGGCTCTGTGCTAAGCACTGGGG - Intronic
1169291811 20:4359292-4359314 AGGCCCTGTGCAAACTTCTCCGG + Intergenic
1169971866 20:11277234-11277256 ATGCCCTGTGCTCAGCTCAGAGG + Intergenic
1169974547 20:11309570-11309592 AGGCCCTGGGGTGAGATTTGGGG + Intergenic
1170119051 20:12892653-12892675 AGGAACTCTGCTGAGCTCTGGGG + Intergenic
1170211931 20:13854634-13854656 AAGCACTGTGCTTGGTTCTGTGG - Intronic
1170269447 20:14507859-14507881 AGCCCCTGAGCTGATTTCTCAGG - Intronic
1170432175 20:16286114-16286136 AGACACTGTGTTAAGTTCTGGGG - Intronic
1170749104 20:19129482-19129504 AGGCCTGGTGCTGGGGTCTGTGG + Intergenic
1170799517 20:19579469-19579491 AGGCCCTGTGCTGACTGCTGCGG + Intronic
1171096024 20:22332872-22332894 AGGCCCTGAGGTGAGTTAGGGGG - Intergenic
1172007029 20:31824652-31824674 AGGCCCTGTGCTGGGCACTGGGG + Intronic
1172038539 20:32027803-32027825 AGGCACTCTGCTGTGTGCTGGGG + Intronic
1172082106 20:32350205-32350227 CAGCCCTGTGCTGAGCCCTGGGG - Intergenic
1172093964 20:32451741-32451763 AGGCCCTGAGCTGAGGCCTGGGG + Intronic
1172123118 20:32610013-32610035 AGGCCCTGTGCTGGGCCCTGAGG - Intergenic
1172177209 20:32979756-32979778 AGGCTCTGTGCTAGGCTCTGGGG + Intergenic
1172286648 20:33745353-33745375 AGGCACTGTGCTGGGCACTGGGG + Intronic
1172336432 20:34120279-34120301 ATGCACTGTGCTGGGTACTGGGG - Intergenic
1172424815 20:34848476-34848498 AGGCTCTGTGCTAAGTTATTTGG - Intronic
1172582131 20:36056698-36056720 AGGCACTGTGCTGAGTGCCAGGG - Intergenic
1172658472 20:36550596-36550618 GGGACCTTTGCTGAGTGCTGCGG - Exonic
1172678336 20:36691881-36691903 AGACCCTGGTCTGAGTTGTGGGG + Intronic
1172698933 20:36840892-36840914 AGGCCCTGTGCTAAGCGCAGGGG + Intronic
1173008566 20:39159949-39159971 AGGCACTGTGCTGAACACTGGGG + Intergenic
1173060440 20:39655231-39655253 AGGCCCTGTGCTAAGTTCTAAGG + Intergenic
1173223954 20:41150962-41150984 AGGCCCTGGGCTGGGTCCTAGGG - Intronic
1173502018 20:43560836-43560858 AGGCCCTGTGCTCAGTGCTGAGG + Intronic
1173562622 20:44017081-44017103 AGGCCCTTTGCTAGATTCTGGGG - Intronic
1173747406 20:45448476-45448498 AGGCACTGTCCTAAGTGCTGGGG - Intergenic
1173895713 20:46549345-46549367 AGGCTCTGTGCTGACCCCTGTGG + Intronic
1173911223 20:46672434-46672456 AGGCACTGTGCTGAACACTGGGG + Intronic
1173965033 20:47106271-47106293 AGGCCCTGTGCTAGGTCCGGGGG - Intronic
1173976429 20:47190096-47190118 AGGCTCTGTGCTTGATTCTGTGG - Intergenic
1174174371 20:48635773-48635795 AGGCCCTGAGCTGGGAGCTGGGG - Intronic
1174194962 20:48766532-48766554 AGCACCTGTGCTGAGGCCTGGGG - Intronic
1174404612 20:50295190-50295212 AGGTCCTGGGCTGGGTGCTGGGG + Intergenic
1174405218 20:50298583-50298605 CAGCCCTGTGCTGAGTGCTGGGG - Intergenic
1174452458 20:50628721-50628743 TGGCCCTGTCCTGGGCTCTGGGG - Intronic
1174600990 20:51724683-51724705 AGGCCCTGTGCTGGGTTCTGGGG - Intronic
1174883416 20:54305353-54305375 AGGCCTTGTGTTGATTTATGGGG - Intergenic
1175202835 20:57289955-57289977 TGGCCCTTTGCTGAATCCTGGGG + Intergenic
1175913765 20:62416333-62416355 AGGCCCTGGGCTACGTGCTGGGG - Intronic
1176101721 20:63367548-63367570 AGCCCTTGTGCTGACATCTGAGG + Intronic
1176249763 20:64114933-64114955 AGGCCCTGGGCTCAGTGCTGGGG + Intergenic
1176618895 21:9042097-9042119 AGCCCCTGTGCTGGGTACCGGGG - Intergenic
1176706827 21:10124059-10124081 AGGCCCTGCGCTGAGCCCCGTGG + Intergenic
1176877493 21:14147434-14147456 AGGCACTGTGTTAAGTGCTGGGG - Intronic
1177458134 21:21370570-21370592 AGACACTTTGCTGGGTTCTGGGG - Intronic
1177955296 21:27590984-27591006 AGGCTCTGTTCTAAATTCTGGGG - Intergenic
1178049482 21:28732341-28732363 AGGCACTGTGATGTGTGCTGAGG + Intergenic
1178427562 21:32491310-32491332 GGGCCTTGTGCACAGTTCTGAGG + Intronic
1178461583 21:32807210-32807232 AGGCCCTGTGCTAAGGACTGGGG - Intronic
1180143167 21:45905309-45905331 GGGCCGGGTGCTGAGTTCTTGGG - Intronic
1180796271 22:18607262-18607284 AGGCACTGTGCTTGGATCTGTGG - Exonic
1181225451 22:21388009-21388031 AGGCACTGTGCTTGGATCTGCGG + Exonic
1181253182 22:21546804-21546826 AGGCACTGTGCTTGGATCTGCGG - Exonic
1181412571 22:22734570-22734592 AGGCCCAGTGCTGGGATCTCAGG + Intergenic
1181415910 22:22758691-22758713 AGGCCCAGTGCTGGGGTCTCAGG + Intronic
1181420205 22:22792483-22792505 AGGCCCAGTGCTGGGGTCTCAGG + Intronic
1181424246 22:22822771-22822793 AGGCCCAGTGCTGGGGTCTCAGG + Intronic
1181428035 22:22856540-22856562 AGGCCCAGTGCTGGGGTCTCAGG + Intronic
1181725727 22:24809664-24809686 AGACCCTGGGCTAGGTTCTGTGG + Intronic
1181859340 22:25806068-25806090 AGGCCCTGTGCTAGGCCCTGGGG - Intronic
1182796705 22:32996211-32996233 AGGCACTGTGCTGGGCTCTGAGG + Intronic
1182899202 22:33884015-33884037 AGGCACTGTTCTAAGTACTGTGG - Intronic
1182953044 22:34395693-34395715 AGGCCCTGTGCTAGGATTTGAGG - Intergenic
1183107487 22:35625058-35625080 AGGCTCCGTGCTGGGCTCTGGGG + Intronic
1183214635 22:36471462-36471484 AGGCACAGTGCTGGGTGCTGCGG + Intronic
1183247963 22:36708613-36708635 AGGCCCTGTGCTGAGGTACAAGG + Intergenic
1183454296 22:37913285-37913307 AGAGCCTGTGCTGGGCTCTGGGG + Intronic
1183861043 22:40670247-40670269 AGGCACTGTGCTAGGCTCTGTGG - Intergenic
1183888504 22:40905441-40905463 AGGCACTGCTCTGGGTTCTGAGG + Intronic
1183992057 22:41603935-41603957 AGGCCTTGTGCTGAGTGATAAGG + Intronic
1184007327 22:41719994-41720016 TGGCCCTGTGCTGGGCTCTGAGG + Intronic
1184248814 22:43248949-43248971 AGGCCCTGTGCTGTGCCCTGAGG + Intronic
1184341279 22:43887440-43887462 TGGACCTGAGCTGAGTACTGGGG - Intronic
1184401260 22:44275975-44275997 AGGCCCTGTTCTATGTGCTGGGG + Intronic
1184587856 22:45459805-45459827 AGCCCCTGGGGTGAGTGCTGGGG - Intergenic
1184804936 22:46788612-46788634 AGGCACTGTCCTGGGTGCTGAGG - Intronic
1185016525 22:48346391-48346413 AGGGTCTGTGCTGGGTTCTGAGG + Intergenic
1185229401 22:49671477-49671499 AGACCCTGGGCTGGGTGCTGAGG - Intergenic
949375623 3:3386339-3386361 GTGCCCTGTGTTGAGTTCTCTGG - Intergenic
950432365 3:12958225-12958247 TGCCCCTGTGCTGGGTGCTGTGG - Intronic
950450317 3:13061596-13061618 AGGCCCTGTGCTGATGCCAGGGG + Intronic
950728300 3:14933972-14933994 AGGCCCTGCGGTGACGTCTGGGG - Exonic
951117551 3:18882606-18882628 AGGCTCTGTGCTCCGTGCTGCGG - Intergenic
951188005 3:19736300-19736322 AGGCCCTGTGCTGAGGGTGGTGG - Intergenic
952494350 3:33902804-33902826 AGGCCCTGTGCTGGGCTCTGGGG + Intergenic
952500309 3:33955696-33955718 AGGCACTGTGCTGAGTACCGGGG - Intergenic
952630661 3:35461973-35461995 AGTTCCTGTGCTGGGTGCTGGGG - Intergenic
953136033 3:40182621-40182643 ATGCTCTGTGCTGAGACCTGTGG + Intronic
953194120 3:40715804-40715826 TGGCCCTATGCTGAGCACTGGGG - Intergenic
953221357 3:40974494-40974516 AGGCCCTGTGCTGGGCTCTCAGG - Intergenic
953373603 3:42410222-42410244 AGGTTCTGTTCTGAGTTCTGGGG - Intronic
953384895 3:42500982-42501004 AGGCCCTGTGCTGTGCACTGGGG - Intronic
954284616 3:49610005-49610027 AGGCCCTGTGCCAAACTCTGAGG + Intronic
954369261 3:50161690-50161712 AGGCCCCGTGCTGAGTGCTGGGG + Intronic
954608972 3:51934269-51934291 AGGCCCTGTCCAGGGTGCTGGGG - Intronic
954610966 3:51944304-51944326 AGGCCCTGTGCTGAGTGCCCTGG - Intronic
954616411 3:51970915-51970937 AAGCCCTGAGCTGGGTTCTAGGG - Intronic
954677677 3:52324745-52324767 ACCCCCAGTGCTGAGATCTGCGG - Intronic
954750645 3:52811543-52811565 AGGCCCTGGGCTGAGTACTGTGG - Intergenic
954786019 3:53092966-53092988 AGGCCCTGTGAGGAGTGCTGGGG + Intronic
955183663 3:56694240-56694262 AGGCACTGTGGTGAGCCCTGGGG - Intergenic
955225580 3:57057567-57057589 AGGCCCTGTGCTAGGTGCTGAGG - Intronic
955244524 3:57212014-57212036 AGGCACTGTGCTGGGTGCAGGGG - Intronic
955415492 3:58687349-58687371 AGGCACCATGCTGAGTACTGAGG - Intergenic
955554412 3:60120273-60120295 AGGCACTGTGCTGATCTCTGTGG - Intronic
955639768 3:61069717-61069739 GGGCACTGTGCTAAATTCTGGGG - Intronic
955677294 3:61462349-61462371 AGGCTCTGTGCTTGGTACTGAGG + Intergenic
955898336 3:63725032-63725054 AGGCTCTGTGCTGACTACTGCGG + Intergenic
955996811 3:64687141-64687163 AGGACCTGTGCTAGGTGCTGAGG + Intronic
956056987 3:65310193-65310215 AGGACCTTTCCTGAGTTGTGTGG + Intergenic
956572064 3:70707497-70707519 AGGCCCTGTTCTAGGCTCTGCGG + Intergenic
956617724 3:71189810-71189832 AGGTACTGTGCTGTGTGCTGTGG + Intronic
956620319 3:71215306-71215328 AGGCCCTGTACTGAGTGTTAGGG + Intronic
958454277 3:94309880-94309902 AGGCACTGTGTTAGGTTCTGAGG + Intergenic
958739131 3:98047023-98047045 AGGCCCTGTCCTAGGCTCTGTGG - Intergenic
959975705 3:112456382-112456404 AGGCCCTGTGCTAAGCTCTGTGG - Intergenic
960604288 3:119489135-119489157 ATGCACTGACCTGAGTTCTGTGG + Intronic
960915891 3:122694484-122694506 AGGCACTGTGCTAGGATCTGAGG - Intronic
960961223 3:123071812-123071834 AGGCCCTGGGCTAGGTGCTGGGG - Intronic
961038832 3:123662850-123662872 AGGCCAGGTCATGAGTTCTGGGG + Intronic
961264031 3:125625884-125625906 AGGCACTGTGCTAAGAGCTGGGG - Intergenic
961456519 3:127027314-127027336 TGGCCCTGTGCTGTGTGCTTGGG + Intronic
961519928 3:127461209-127461231 AGGCCCTGTGCTGGGGACTATGG + Intergenic
961584077 3:127907962-127907984 AAGCACTGTGCTGGGCTCTGGGG + Intergenic
961753004 3:129108235-129108257 GGGAGGTGTGCTGAGTTCTGTGG - Intronic
962256220 3:133871926-133871948 AGGCCCTGAGCCCAGCTCTGTGG - Intronic
962712645 3:138100792-138100814 AGGCCCTGTGCCAGGCTCTGAGG - Intronic
962901871 3:139768558-139768580 AGGCACTGCTCTTAGTTCTGGGG - Intergenic
962933175 3:140056239-140056261 AGGCACTGTGCTAGGTGCTGAGG - Intronic
963093123 3:141505266-141505288 AGGCACTGTTCTAAGTGCTGGGG - Intronic
963162118 3:142161522-142161544 AAGCACAGTGCTAAGTTCTGGGG + Intergenic
964159283 3:153627242-153627264 AGGCACTGTCCTTTGTTCTGTGG - Intergenic
964596420 3:158437348-158437370 TGGCACTGGGCTGAGTTTTGAGG + Intronic
964733752 3:159894650-159894672 AGGCCCTGTGCTAGGCTCTGGGG - Intronic
965605144 3:170491065-170491087 AGGCACTGTGCTTAGTGATGGGG + Intronic
965629098 3:170712314-170712336 AGGCTCTGTGCTGGGCACTGGGG + Intronic
965780811 3:172284143-172284165 AGGGCCTGTGCTGGGTGCTGCGG + Intronic
966514798 3:180806909-180806931 AGGACCTGTACTTAGTGCTGTGG + Intronic
966748011 3:183296710-183296732 ATGTGCTGTGCTGAGTGCTGAGG - Intronic
966916299 3:184585908-184585930 AGGCACTGTGCTGGGCACTGGGG + Intronic
967135791 3:186511656-186511678 TGGCCCTGTTCTCAGTGCTGAGG + Intergenic
967197277 3:187039368-187039390 AGGCACTGTGCTGGGTACTAGGG + Intronic
967302576 3:188030252-188030274 AGGCATTGTGCTGGGCTCTGAGG - Intergenic
967407392 3:189132895-189132917 AGGCACTGAGCTAAGTTCTGTGG + Intronic
968045433 3:195621533-195621555 CGGCACTGTACTGAGTACTGTGG - Intergenic
968064227 3:195749554-195749576 CGGCACTGTACTGAGTACTGTGG - Intronic
968079685 3:195837271-195837293 TGGACCTGGGCTGAGTTTTGGGG + Intergenic
968123291 3:196141326-196141348 AGGCACTGTGGTGGGTTCTGGGG - Intergenic
968376494 4:47081-47103 AGGGCCTGTGCTGACTTTGGTGG + Intergenic
968734510 4:2288416-2288438 GGGCCCTGGGCTGGGTGCTGGGG + Intronic
968974393 4:3813572-3813594 AGGGCCCATGCTGAGTACTGTGG + Intergenic
969075281 4:4573387-4573409 AGGCTCTGTGCTAAGTACTAAGG + Intergenic
969108789 4:4828476-4828498 AGGGCCTGGGCTCAGTTTTGAGG + Intergenic
969111641 4:4848145-4848167 GGGCTCTGTGCTGACTACTGGGG + Intergenic
969304605 4:6318523-6318545 AGGCCCTGCGCTCAGAGCTGTGG - Intergenic
969452408 4:7282110-7282132 TGGCCCGGGGCTGAGTTCCGTGG - Intronic
969481052 4:7447101-7447123 ACCCCGTGTGCTCAGTTCTGGGG + Intronic
969502231 4:7560044-7560066 AGGCCCTGGCCTGAATTCTGGGG + Intronic
969590377 4:8118590-8118612 AGGGGCTGGGCTGTGTTCTGTGG - Intronic
969696324 4:8737176-8737198 AGGCACTGGGCTGAATTCTGGGG + Intergenic
970609710 4:17713797-17713819 AGGCTCTGTGCTGGGCACTGGGG + Intronic
971092762 4:23363773-23363795 AGGCACTGTTCTAAGTACTGTGG - Intergenic
971417236 4:26443002-26443024 AGGCACTGTGCTAGGGTCTGGGG - Intergenic
971639239 4:29108109-29108131 ATGCACTTTGCTGAGTGCTGAGG + Intergenic
971861148 4:32107667-32107689 AGGCCCTGTGCTTGGTACTGAGG - Intergenic
971953192 4:33381466-33381488 AGACACTGTGCTGAGGACTGAGG - Intergenic
972277110 4:37567730-37567752 AGGCACTGTGCTAGGTTCTGGGG - Intronic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
972605322 4:40608340-40608362 GGTCGCTCTGCTGAGTTCTGGGG - Intronic
972645994 4:40967851-40967873 AGGCACTGTGCTTAGTGCTAGGG - Intronic
972707993 4:41564461-41564483 AGGGTCTGTGCTTGGTTCTGTGG + Intronic
973200201 4:47491960-47491982 AGGCACGGTGCTGAGTGCTTTGG - Intronic
973622763 4:52743911-52743933 AGGAGCTGTGCTGATTGCTGTGG + Exonic
973809680 4:54557703-54557725 AGGCCCTGTTCTAGGTGCTGGGG + Intergenic
974026014 4:56733737-56733759 AGGCACTCTGCTAAGTGCTGGGG + Intergenic
974101291 4:57420513-57420535 AGGCACTGTGCTAAGTGCTGTGG + Intergenic
975580113 4:75898646-75898668 AGGCACTGTGCTAAATCCTGGGG - Intronic
975633697 4:76424771-76424793 AGACCCTGTGCTGGGTACTGGGG + Intergenic
975647895 4:76563884-76563906 AGGCCCGATGCTGTGCTCTGTGG + Intronic
976089676 4:81443450-81443472 AGCCACTGTTCTGATTTCTGTGG - Intronic
976303318 4:83535936-83535958 AGGACCTTTGCTGAGTGCTGGGG + Exonic
976828564 4:89287109-89287131 AGGCATTGTGCTAAATTCTGTGG + Intronic
977171827 4:93771907-93771929 AGGCACTGTGCTAAGTTCTGGGG - Intronic
977557954 4:98503767-98503789 AGGGCTTGTGCTGAATTCTAGGG - Intronic
977656157 4:99523159-99523181 AGGCACTGTGCTGGGACCTGGGG - Intronic
977773027 4:100881973-100881995 CAGCCCTGTTCTGAGATCTGCGG - Intergenic
978286172 4:107079765-107079787 AGGCCCTGTTTTGAGTGTTGAGG - Intronic
978540376 4:109810342-109810364 AGGCACTGTACTAAGTGCTGAGG + Intergenic
979543237 4:121910541-121910563 AGGCCCTGTGCAGAGTTAAATGG + Intronic
980101221 4:128543267-128543289 AGGCACTGTGCTAGGCTCTGAGG - Intergenic
980879044 4:138690845-138690867 AGGCCCTGTGCTAGATTCGGGGG - Intergenic
981180130 4:141731988-141732010 AGGCCCTGTGCTAAATGCTAGGG + Intronic
981427787 4:144623625-144623647 AGGCCCTGTGCTGGGTACTGAGG + Intergenic
981929719 4:150176316-150176338 AGGCACAGTGCTGAGTGCTCTGG + Intronic
982031750 4:151308270-151308292 AAGCACTGTTCTGAGTTATGAGG + Intronic
982083227 4:151810191-151810213 AAGCCCAGTGCTGAATACTGGGG + Intergenic
982100884 4:151966342-151966364 AGGAACTGTTCTGTGTTCTGAGG + Intergenic
982227639 4:153180912-153180934 AGGCATTGTCCTGAGTGCTGGGG + Intronic
982346857 4:154369292-154369314 AGGCTCTGTGAGAAGTTCTGAGG - Intronic
982401312 4:154971028-154971050 AGGCACTGAGCTAGGTTCTGAGG - Intergenic
982732081 4:158966912-158966934 AAGCCCTGTGCTTAGTTGAGAGG + Intronic
982913464 4:161175220-161175242 AGGCACTGTGTGAAGTTCTGGGG + Intergenic
983062247 4:163173432-163173454 AGCCCCATTGCTTAGTTCTGTGG + Intergenic
983509820 4:168596149-168596171 AAACCCTTTGCTGGGTTCTGTGG + Intronic
984497352 4:180515470-180515492 GGGCACTGTGCTGGGTACTGAGG + Intergenic
984702206 4:182825694-182825716 TGGGGCTGTGCTGAATTCTGAGG - Intergenic
984884281 4:184436346-184436368 AGGAACTGTGCTGAGTGCTGTGG + Intronic
984954750 4:185034214-185034236 AGACTCTGTGCTAAGTTCTGGGG - Intergenic
985007142 4:185545108-185545130 AGGCCATTTGGGGAGTTCTGTGG - Intergenic
985089875 4:186351645-186351667 AGGACCTGTCCTGGGCTCTGAGG - Intergenic
985253362 4:188044776-188044798 GGGCCCTGTTCTGAATTCTCTGG + Intergenic
985631366 5:1015767-1015789 GGGGCCTGTGCTGCGTCCTGGGG + Intronic
985903171 5:2813203-2813225 AGACCCTGGGCTGGTTTCTGGGG - Intergenic
986321603 5:6636474-6636496 AGGCCCTGTGCTGACCTGTGAGG + Intronic
986441918 5:7790570-7790592 AAGCCCTGCGCTCATTTCTGTGG + Intronic
986736811 5:10674216-10674238 AGGCGCTGTGCTTTGTGCTGGGG + Intergenic
986794000 5:11191597-11191619 AAGCACAGTGCTGAGCTCTGAGG + Intronic
987031621 5:13981350-13981372 AGGCACGGTGCTGGGTGCTGGGG - Intergenic
987079670 5:14415351-14415373 AAGCTCTGCGATGAGTTCTGGGG - Intronic
987162126 5:15155448-15155470 AGGCTCTGTGCTGGGTGCTGAGG + Intergenic
987277021 5:16373310-16373332 AGGCACTGTGCTGAGCATTGGGG - Intergenic
987798987 5:22668534-22668556 AGACTCTCTGCAGAGTTCTGAGG + Intronic
987874502 5:23662927-23662949 AGGCACTGTGCTAAGAACTGAGG + Intergenic
989276811 5:39598991-39599013 AGCCACTGTGCTGCGCTCTGGGG + Intergenic
990136741 5:52654319-52654341 AGACCCAGTGATGAGGTCTGAGG - Intergenic
990303437 5:54472265-54472287 CTGCCCTGTTCTGTGTTCTGGGG + Intergenic
990860774 5:60324378-60324400 AGGCACTGTGCTGGGTCCTATGG - Intronic
991084814 5:62639078-62639100 AGGCACTATGCTGGGTGCTGAGG + Intergenic
991624300 5:68583323-68583345 AAGCACTGTGCTGAGTGCTCAGG - Intergenic
991738096 5:69645003-69645025 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
991760098 5:69911421-69911443 AGGCCCAGTGGCGACTTCTGGGG + Intergenic
991787234 5:70206679-70206701 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
991789672 5:70224729-70224751 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
991814421 5:70499839-70499861 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
991817556 5:70521131-70521153 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
991839329 5:70786472-70786494 AGGCCCAGTGGCGACTTCTGGGG + Intergenic
991879680 5:71207069-71207091 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
991882120 5:71225098-71225120 AGGCCCAGTGGCGACTTCTGGGG - Intergenic
992024426 5:72656565-72656587 AGGCCATGTTTTGAGTTCTTAGG - Intergenic
992076298 5:73195763-73195785 AGACCCTGTTCTGAGTGTTGCGG - Intergenic
992763464 5:79972358-79972380 AAGCACTGTGCTCAGTGCTGGGG + Intergenic
993738964 5:91513181-91513203 AGTTCCTGTGCTAGGTTCTGGGG + Intergenic
994151641 5:96454598-96454620 TGGCCCTGTGCTGAGTCTAGCGG + Intergenic
995000357 5:107120483-107120505 AGGTCCTGTGCACAGTGCTGGGG + Intergenic
995179803 5:109220334-109220356 AGGCACTGTTCTTAGTTGTGAGG - Intergenic
997423640 5:133788117-133788139 AGGCCCTGGGCTGGGCGCTGGGG - Intergenic
997435113 5:133868217-133868239 AGGCACAGTGCTGGGTGCTGAGG + Intergenic
997446956 5:133947311-133947333 AGGCCCTGTGCTGAGTTTTGGGG - Intergenic
997498639 5:134353215-134353237 AGGGCCTGTACTTAGTTTTGTGG - Intronic
997662559 5:135600618-135600640 AGGCACTGTGTTTGGTTCTGAGG - Intergenic
997709252 5:135990248-135990270 AGGCCCTGTGCTAGGAGCTGAGG + Intergenic
997759690 5:136433162-136433184 GGGCCCTGTGCTGTATACTGGGG - Intergenic
998377976 5:141703523-141703545 AGGCTTTGTGCTGAGATCGGTGG + Intergenic
998387649 5:141767040-141767062 AGGCCCTGTGCTATGGGCTGGGG - Intergenic
998392935 5:141799085-141799107 AGGCCCTATGCTAAGTCCTGTGG - Intergenic
998979551 5:147686538-147686560 AGGCACTGTGCTAAGCACTGCGG - Intronic
999080697 5:148840762-148840784 AGAACCTGTGCTAACTTCTGGGG + Intergenic
999113134 5:149139274-149139296 AGCCCCAGTGCTGGCTTCTGGGG - Intergenic
999217671 5:149948966-149948988 AGGACATGTGCTGAGCTCTTTGG - Intergenic
999342335 5:150782859-150782881 AGGCCCTGTGATAGGTGCTGAGG + Intronic
999400125 5:151258017-151258039 AGGCCCTGGGCTAAGTGCTGTGG - Intronic
999734800 5:154505269-154505291 AGACCCTGTGCTGAATGCTTGGG + Intergenic
999802480 5:155050854-155050876 AGGCACTGTGCTAAATGCTGAGG - Intergenic
999827326 5:155286280-155286302 AGGCACTGTGCTGGATCCTGGGG + Intergenic
999832411 5:155333128-155333150 AGGCCCTGTGCTAAGGGATGTGG + Intergenic
1000293874 5:159896088-159896110 AGGCACTGTGCTAGGTCCTGGGG - Intergenic
1000395539 5:160771107-160771129 AGGCACTGTGCATACTTCTGAGG - Intronic
1000703235 5:164478914-164478936 AGGCTCTGTGCTAAGTACTGGGG - Intergenic
1000918318 5:167108466-167108488 AGGCCCTGTGCTGGCTTTTGTGG - Intergenic
1001029178 5:168249394-168249416 TGGCACTGTGCTAAGTTCTGGGG + Intronic
1001039436 5:168322565-168322587 AGGCCTTGTGCTAGGTGCTGAGG - Intronic
1001149350 5:169213774-169213796 AGGCACTGTTCTTAGTTCTGGGG - Intronic
1001217141 5:169866553-169866575 AGGCCCTGTTCTGGCTGCTGAGG + Intronic
1001598235 5:172912178-172912200 AGGCCCTGTCCTGCGTCCTTTGG + Intronic
1001711611 5:173783428-173783450 AGGCACTGTTCTCAGTCCTGGGG - Intergenic
1001771597 5:174301132-174301154 AGGCCCTGAGCTAAGTGCTGAGG - Intergenic
1001777880 5:174342640-174342662 AGGCCCTGTGCTGAGTTATTTGG + Intergenic
1002026469 5:176399221-176399243 AGGCACTGTGCTGGGCTCTGGGG - Intronic
1002139566 5:177130834-177130856 AGGCAGTGTGCTGAGTGCTGGGG - Intergenic
1002203123 5:177542875-177542897 AGGCCCTGTGCTGCACTGTGAGG - Intronic
1002359629 5:178660349-178660371 AGGCACTGTGCTGAGCTTTCAGG - Intergenic
1002579133 5:180197043-180197065 CTGCCCTGTGGTGAGGTCTGAGG - Intronic
1002676924 5:180924391-180924413 GGGACGTGTGCTGAGCTCTGAGG - Intronic
1002712396 5:181203479-181203501 AGCCCTGGTGCTGAGTTCTCAGG + Intronic
1003478088 6:6503620-6503642 AGGCATTGTGCTGAATGCTGGGG + Intergenic
1003528426 6:6917620-6917642 AGTCACTGAGCTGAGTTCTATGG + Intergenic
1003558779 6:7164051-7164073 AGGCACCGTTCTAAGTTCTGTGG + Intronic
1003947902 6:11092204-11092226 AGGCACTGTTCTAAGTGCTGGGG - Intergenic
1004299999 6:14448930-14448952 AGGTCCTGTGCTGCCTGCTGGGG - Intergenic
1004603836 6:17175638-17175660 AGGCACTGTGCTTAGTGCTTTGG + Intergenic
1004949006 6:20647216-20647238 AGGCCCTGTAATAAGTGCTGGGG + Intronic
1005525204 6:26640702-26640724 AGGCACTTTTCTGAGTGCTGGGG - Intronic
1005980339 6:30831517-30831539 GGTCCCTGGGCTGAGTCCTGGGG + Intergenic
1006367543 6:33624298-33624320 AGGCACTGTACTGGGTGCTGGGG + Intronic
1006405424 6:33842255-33842277 AGCCTCTGAGCTGAGTCCTGAGG - Intergenic
1006625274 6:35393138-35393160 GGGCCCTGTGGGGAGCTCTGGGG + Intronic
1006803051 6:36771613-36771635 AGGCACTGTGTTGGGTGCTGTGG - Intronic
1006835700 6:36997666-36997688 AGGCACTGTACTAACTTCTGGGG + Intergenic
1006925443 6:37651830-37651852 AGGCACTGTGCTAGGTCCTGGGG - Intronic
1006987220 6:38183911-38183933 AGGCACTGGGCTGGGTGCTGAGG + Intronic
1007132173 6:39485509-39485531 AAGCCCTGTTCTAAGTGCTGGGG - Intronic
1007352646 6:41285025-41285047 AGGCACTGTGCTGGGCTCTTTGG + Intronic
1007357701 6:41333238-41333260 TAGCCCTGTGCTGCGTTTTGGGG + Intergenic
1007413554 6:41678995-41679017 TGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1007428547 6:41762911-41762933 AGGCACTGTGCTGAGTGCTGGGG - Intergenic
1007455898 6:41976832-41976854 AAGCTCTGTGCTGTGTGCTGTGG - Intronic
1007504816 6:42327473-42327495 AGGCTCTGTGCTAGGATCTGGGG - Intronic
1007762400 6:44140706-44140728 AGCCACTGTGCTGGGTTCTCAGG + Intronic
1007963530 6:45983152-45983174 AGTCCCTGGGCAGAGGTCTGAGG - Intronic
1007995869 6:46307166-46307188 AGGCACTGTGCTGGGTGCTGGGG + Intronic
1008047846 6:46869615-46869637 AGACCCAGTGCTGAGTACTGGGG - Intronic
1010979480 6:82355007-82355029 AGGCACTGTTCTGAGAACTGAGG - Intergenic
1011093852 6:83636929-83636951 AGGCTCTGTTCTAGGTTCTGAGG + Intronic
1011259670 6:85457765-85457787 AGGCTCTCTGCTAAGTGCTGAGG + Intronic
1011582278 6:88882418-88882440 AGGTACTGTGCTAGGTTCTGGGG - Intronic
1011808419 6:91099615-91099637 AGGCCATGTGCAGAGCTCAGAGG - Intergenic
1013073609 6:106751475-106751497 TGGCCCTGTGCTTCGTGCTGCGG + Intergenic
1013546910 6:111167474-111167496 TGACCCTGTGGAGAGTTCTGTGG + Intronic
1013611138 6:111796670-111796692 AGGCCCTGTTCTGAGAGCTGGGG + Intronic
1013613321 6:111816924-111816946 AGACACTGTGCTAAATTCTGGGG - Intronic
1014711579 6:124812411-124812433 AGACACTGTTCTGGGTTCTGAGG + Intronic
1015018944 6:128448522-128448544 ATGCTTTGTGCTGAGTGCTGAGG - Intronic
1015737779 6:136419448-136419470 AGGCCCTGTGCTGAGCCACGAGG - Intronic
1015752395 6:136573613-136573635 AGGGCCTATGCAGAGTTCTGGGG + Intronic
1016145213 6:140663064-140663086 AGGAGCTGTGCTGTGTACTGAGG + Intergenic
1016879110 6:148893616-148893638 GGGCTCTGTGCTGGGTGCTGAGG + Intronic
1017137116 6:151157699-151157721 AGGCGCTGTGCTAAGCACTGGGG - Intergenic
1017699977 6:157059620-157059642 AGGCCCTGTGGAAAGCTCTGGGG + Intronic
1017707929 6:157140982-157141004 AGGCTCTGTGCTAAATGCTGGGG - Intronic
1018230989 6:161675140-161675162 ATGCATTGTGCTCAGTTCTGGGG - Intronic
1018395166 6:163372909-163372931 AGACAGTGTGCTGAGTGCTGAGG + Intergenic
1018486583 6:164246587-164246609 AGGCCCTGTTCTAAGCACTGGGG - Intergenic
1019029522 6:168998457-168998479 AGCCACTGTTCTGTGTTCTGAGG - Intergenic
1019082358 6:169443663-169443685 AGGGTCTGTCCTGAGTTCTGTGG - Intergenic
1019300171 7:298913-298935 AAGCCCCGCGCTGGGTTCTGAGG - Intergenic
1019333530 7:471861-471883 CGGCACAGTGCTGAATTCTGGGG + Intergenic
1019344857 7:524527-524549 AGGCACTGTACTAAGTGCTGGGG + Intergenic
1019362248 7:610913-610935 AGAGGCTGTGCTGGGTTCTGGGG + Intronic
1019656177 7:2197352-2197374 AGGCCTGGTGCTGGGTGCTGGGG - Intronic
1019781340 7:2941973-2941995 AGGCACTGTGCTAAGCACTGTGG - Intronic
1019928390 7:4207994-4208016 AGGGGGTGAGCTGAGTTCTGGGG - Intronic
1020028212 7:4914567-4914589 AGGCCCTGTGCTGGTATCTGAGG - Intronic
1021018929 7:15572198-15572220 AGTCCCTGTGATGAGTCCTTAGG - Intergenic
1021214480 7:17900172-17900194 AGTCTCTCTGCTGAGTTGTGTGG + Intronic
1021666392 7:22985358-22985380 AGGGCCTGTGGTGAGTGCTGTGG - Intronic
1021691490 7:23234796-23234818 AGGCCCTGTGCTGAGCAGTCAGG - Intergenic
1021896481 7:25240832-25240854 AGATCCTGTGCTGACTTCTCAGG + Intergenic
1022785096 7:33630876-33630898 AGGCACTGTGCTTAGTGTTGGGG + Intergenic
1023329290 7:39097689-39097711 AGGGGCTGTGCTGTGTCCTGAGG + Intronic
1023387888 7:39678363-39678385 AGGCACTGTGCTAGGTGCTGAGG - Intronic
1023682890 7:42706049-42706071 AGGCACTGTGCTAACTTCTTGGG - Intergenic
1023736663 7:43241713-43241735 AGGCTCTGTGCTAAGTGCTGAGG + Intronic
1023912899 7:44568025-44568047 AGCCCCTGTGCTTGGTGCTGGGG - Intronic
1023939245 7:44759490-44759512 GGGCTCCGTGCTGAGTGCTGTGG + Intronic
1023951641 7:44850648-44850670 AGGCACTGTGCTAGGTACTGAGG + Intergenic
1024604376 7:51012328-51012350 AGACCCTGTGATGAGTGCTAGGG - Intergenic
1024621651 7:51163407-51163429 AGGCACTGTGCTTAGTTGTGTGG - Intronic
1024673486 7:51617535-51617557 AGGCCCTGTGGTCAGAGCTGTGG + Intergenic
1026824589 7:73573529-73573551 AGGTCCTGTGCTGGGTTCTCGGG + Intronic
1027170920 7:75871818-75871840 AGGCCTTGTGCTGAGCACTTTGG - Intronic
1027190170 7:75992001-75992023 AGGCACAGTGCTGACTTCAGGGG - Intronic
1027192224 7:76003411-76003433 AGGCTCTGGGCTGAGCTCTGGGG - Intronic
1027221996 7:76220151-76220173 AAGCCCTGTGCTGAGCACTAGGG + Intronic
1028942564 7:96539735-96539757 AGGCCCTGGTCTGAGTGCTGAGG - Intronic
1029162606 7:98563361-98563383 AGGCTCTGTGCAGGGTGCTGTGG + Intergenic
1029852002 7:103471437-103471459 AGGCACTGTGCTAAGTATTGAGG - Intergenic
1030687508 7:112502459-112502481 AGGCCCTGTGCAGAGTGCTGGGG + Intergenic
1032861520 7:135884286-135884308 AGGCACTGTGCTGAGTAATCTGG - Intergenic
1033599223 7:142876924-142876946 AAGCCCTGAGCTGAGATGTGGGG - Intronic
1033663240 7:143418144-143418166 AGGCACTGTTCTAAGTGCTGGGG + Intergenic
1034120748 7:148625363-148625385 AGGCACTGTGCTGAAAGCTGGGG + Intergenic
1034193639 7:149229509-149229531 AGGGCCTGTGCTGGGGGCTGGGG - Intergenic
1034197449 7:149259253-149259275 AGCACCTGTGCTGAGAGCTGTGG - Intergenic
1034207723 7:149332455-149332477 AGTCCCTTTGTTTAGTTCTGTGG - Intergenic
1034300720 7:150013173-150013195 AAGCCCTGAGCTTTGTTCTGAGG + Intergenic
1034506217 7:151493487-151493509 TGGCCCTGTGCTGGCTTCAGTGG - Intronic
1034657668 7:152742156-152742178 AGGCTCTGTGCTGGGTGCAGGGG + Intergenic
1034805330 7:154084127-154084149 AAGCCCTGAGCTTTGTTCTGAGG - Intronic
1034819401 7:154202832-154202854 AGGTTCTGTGCTTAGCTCTGGGG - Intronic
1034879737 7:154753882-154753904 AGGCCCTGAGCTGCTTCCTGGGG + Intronic
1035642738 8:1196365-1196387 AGCCCCTGTGCTGACACCTGGGG - Intergenic
1036683484 8:10893154-10893176 GGACCCTGTGCTAAGGTCTGGGG + Intergenic
1037506867 8:19539445-19539467 AGGCCCTGTGCTGAGGACAGAGG - Intronic
1037555024 8:20013806-20013828 AGGCACTGTTCTGGTTTCTGAGG + Intergenic
1037821124 8:22135023-22135045 TGGCCCTGTGCTGGGCGCTGGGG + Intergenic
1038316434 8:26488542-26488564 CGGCCCTGTGCTAGGTTCTGTGG - Intronic
1038613363 8:29072652-29072674 AGGCCCTGTGCTGTGTGCCCAGG + Intronic
1038706490 8:29898732-29898754 GGGCATTGTGCTGAGTGCTGAGG - Intergenic
1038941598 8:32311729-32311751 AGGCATTGTGCTAGGTTCTGGGG - Intronic
1038995075 8:32913349-32913371 AGGCCTTTTGCAGTGTTCTGAGG - Intergenic
1039061085 8:33572719-33572741 AAGCCCTGTGCTCAGGTCTTTGG + Intergenic
1039088484 8:33803110-33803132 ATGCCCTCTGCTCACTTCTGGGG - Intergenic
1039348262 8:36732129-36732151 AGGCACTGGCCTGAGCTCTGAGG + Intergenic
1039385663 8:37133692-37133714 AGGCTCTGTGCTGAGATGAGGGG + Intergenic
1040484931 8:47861164-47861186 AGTGCCTGGGCCGAGTTCTGTGG - Intronic
1040563637 8:48546457-48546479 AGGCCCTGTGCTGAATGCTAGGG - Intergenic
1040806335 8:51401032-51401054 AGGCCCTGGACTGAACTCTGGGG + Intronic
1040943401 8:52855172-52855194 AGGCATTGTGCTGAGTGCAGTGG - Intergenic
1040978152 8:53216775-53216797 AGGCACTGTGCTGGGCCCTGAGG + Intergenic
1041962256 8:63632217-63632239 AGGGTCTGTGCTGAGCTCTGTGG + Intergenic
1042025344 8:64416758-64416780 AGGTGCTGTGCTGAGTGATGAGG - Intergenic
1042617472 8:70666166-70666188 AGGCTCTGTGCTAGGTGCTGGGG + Intronic
1042830044 8:73016737-73016759 AGGACATGTGCTGAGTTCCACGG - Intronic
1042837405 8:73091116-73091138 AGGCCCTGTGCTAGGCCCTGAGG - Intronic
1043755294 8:83995999-83996021 AGGCCATGTACTGACTTCAGTGG + Intergenic
1043878770 8:85517172-85517194 AGGCACTGTGGTATGTTCTGAGG + Intergenic
1044929125 8:97234902-97234924 AGGCCCTGTGCTATGCTCTGGGG - Intergenic
1045406003 8:101867380-101867402 AGGCACTGTGCTAGGTCCTGGGG - Intronic
1045696337 8:104812749-104812771 AGGCACTGTGCTCAGTGTTGAGG + Intronic
1045861218 8:106816757-106816779 AGGCCCTATGCTGAGGACTGAGG - Intergenic
1045891775 8:107166240-107166262 CGGCCTTCTGCGGAGTTCTGCGG + Intergenic
1045891778 8:107166260-107166282 CGGCCTTCTGCGGAGTTCTGCGG + Intergenic
1046050327 8:109014280-109014302 TGGTGCTGTGCTGAGTGCTGGGG + Intergenic
1046527219 8:115395897-115395919 AGACACTATGCTAAGTTCTGGGG - Intergenic
1046667402 8:117019201-117019223 AGGCCTTGTGCTGAATACTCAGG - Intronic
1046752749 8:117942374-117942396 AGCCTCTGTGCTAGGTTCTGGGG - Intronic
1047355745 8:124119873-124119895 TGGCACTGTGCTGAGTGCTAAGG + Exonic
1047466171 8:125116788-125116810 AGGCACTATGCTTTGTTCTGTGG - Intronic
1047720957 8:127638666-127638688 AGGCACTGAGCTGGGTTCAGGGG - Intergenic
1048066784 8:130978015-130978037 AGGCCCTGTGCTCTGCACTGGGG + Intronic
1048066792 8:130978133-130978155 ATGCCTTGTGCTGACTTCTATGG - Intronic
1048320158 8:133393385-133393407 AGTCTCTGTTCTGACTTCTGGGG + Intergenic
1048455817 8:134577636-134577658 AAGCCCTGTTCTAAGTGCTGAGG + Intronic
1048565981 8:135597669-135597691 AGGCACTGTGCTGAGCACCGGGG - Intronic
1048688061 8:136926466-136926488 AGGTCCTGTGCTGAGCTCTGAGG + Intergenic
1048810403 8:138280623-138280645 AAGCACTGTGCCAAGTTCTGTGG - Intronic
1048847745 8:138616210-138616232 CGGCCCTGAGTTGAGGTCTGTGG + Intronic
1048853670 8:138668705-138668727 AGGCCTAGTGCTGTGTGCTGGGG + Intronic
1048881553 8:138876480-138876502 TGGCCTTGTGCTGATTTCTGGGG - Intronic
1049009303 8:139876612-139876634 AGGCACTGTCCTCAGTGCTGGGG - Intronic
1049031962 8:140044582-140044604 AGGCTCTGTGCTGTGCCCTGGGG - Intronic
1049058989 8:140261295-140261317 AGGCGCTATGCTAGGTTCTGGGG + Intronic
1049063559 8:140295210-140295232 ATGCCCTGTGCTATGTGCTGGGG - Intronic
1049159437 8:141087798-141087820 AGGCAATGCACTGAGTTCTGAGG - Intergenic
1049303359 8:141883605-141883627 AGGCCCTCTGCTGAGGACTAGGG + Intergenic
1049344442 8:142130874-142130896 GGGCCCTGTGAGGAGTCCTGCGG - Intergenic
1049353557 8:142176925-142176947 AGGGGCTGTGGTGAGTTTTGTGG - Intergenic
1049693919 8:143974534-143974556 AGGCCAGGTGCTGAGCCCTGGGG - Intronic
1050587019 9:7123587-7123609 AGACACCGTGCTGGGTTCTGTGG + Intergenic
1050682109 9:8123782-8123804 AGGCTCTGTGCTAAAGTCTGGGG - Intergenic
1051246591 9:15117967-15117989 AGTCCATTTCCTGAGTTCTGTGG - Intergenic
1051545424 9:18269291-18269313 AGACCCTATGCTAAGCTCTGTGG - Intergenic
1052319138 9:27149033-27149055 GGGCTCTGTGCTGCTTTCTGTGG - Intronic
1052833280 9:33232625-33232647 AGGCCCTGGGCAGAGCACTGGGG + Intronic
1053108281 9:35432938-35432960 AGGCCCTGTGCTAGGTCCTAGGG - Intergenic
1053306015 9:36985495-36985517 AGGCCCTATGCTGGGCACTGAGG + Intronic
1053306763 9:36989859-36989881 AGGCCCTGTGCTGGGCACTAAGG + Intronic
1053383217 9:37666299-37666321 AGGCACAATGCTGAGTACTGTGG + Intronic
1053462339 9:38280589-38280611 AGGCCCTGTCCTAGGTACTGGGG + Intergenic
1053515724 9:38729211-38729233 GGGCACTGTGCTGGGTTCTGAGG + Intergenic
1053644126 9:40111204-40111226 AGGCCCTGCGCTGAGCCCCGTGG + Intergenic
1053762030 9:41354281-41354303 AGGCCCTGCGCTGAGCCCCGTGG - Intergenic
1054350418 9:64014373-64014395 AGCCCCTGTGCTGGGCCCTGGGG - Intergenic
1054540624 9:66265398-66265420 AGGCCCTGCGCTGAGCCCCGTGG - Intergenic
1054751157 9:68907777-68907799 AGGCTCTGTGCTAAGACCTGTGG + Intronic
1054812852 9:69448308-69448330 AGGCACTGAGCTGCGCTCTGAGG - Intronic
1055341604 9:75290409-75290431 AGGCACTGGGCTGGGTGCTGGGG - Intergenic
1055600112 9:77907790-77907812 AGGCCCTTTGCTAGGTCCTGGGG + Intronic
1055859978 9:80737768-80737790 AGGCCCTCTGCAGATCTCTGAGG - Intergenic
1055989822 9:82093588-82093610 AGGCACTGTGCTAACTTCTGGGG + Intergenic
1056113209 9:83416539-83416561 AGCCCCTTTGCTGAGTTGTAAGG - Intronic
1056315755 9:85388271-85388293 AGGCTCTGTACTGGGTTCTGGGG + Intergenic
1057405621 9:94768181-94768203 AGGCCCTGACCTGATCTCTGGGG - Intronic
1057570184 9:96198419-96198441 AGGCCTTGTCCTAAGTGCTGGGG + Intergenic
1057631070 9:96719671-96719693 AGGCGCTGAGCGGAGGTCTGCGG + Intergenic
1057798889 9:98177278-98177300 AGCCCCTGTGCTGGGCTCTGTGG + Intronic
1057877280 9:98767690-98767712 AGGCCCTGTTCTAAATGCTGAGG + Intronic
1057900251 9:98943144-98943166 AGGCCCTGTGATGAGATGTGGGG - Intergenic
1058015376 9:100026171-100026193 AGGACATCTGCTGAGTGCTGGGG + Intronic
1058428864 9:104900347-104900369 AGGCTCTGTGCTGGGCTCTGAGG + Intronic
1058635761 9:107036956-107036978 AGTCCCTATGTTGAGTACTGGGG + Intergenic
1058704326 9:107626228-107626250 ACGCCTTGTGCTGGGCTCTGGGG + Intergenic
1058770461 9:108226343-108226365 AGGAGCTGAGCTGAGTTTTGTGG - Intergenic
1058813473 9:108663122-108663144 AGGCCCTGCTTTGAGCTCTGTGG + Intergenic
1058878264 9:109262949-109262971 AGGCCCAGTGCTTAGCTTTGGGG - Intronic
1058880163 9:109278756-109278778 GGGCCCTGTGCTGAGCATTGCGG - Intronic
1058952690 9:109918174-109918196 AGGCACTATGCTGAGCACTGGGG - Intronic
1059330363 9:113531479-113531501 AGGCTCTGTGCTAAGTGCTTTGG - Intronic
1059339187 9:113587860-113587882 GCGCCCTGTGCTGAGTTGAGTGG + Intronic
1059353781 9:113684475-113684497 AGGCCCTGTGCGAAGCACTGGGG + Intergenic
1059399886 9:114062203-114062225 AGGCCCTGTGCTGGGCACTAGGG - Intronic
1059534859 9:115071120-115071142 ATGCTCTGTGCTAAGTTCTGGGG - Intronic
1059585294 9:115599477-115599499 AGGCCCTGTGCTAGGCACTGAGG + Intergenic
1059958732 9:119544744-119544766 AGGCCCTGTGATGAGCTGAGAGG + Intergenic
1060035981 9:120256164-120256186 AGGCACTGGGCTGGGTTCTTTGG - Intergenic
1060150531 9:121285466-121285488 CAGCCTTGTGCTGAGTGCTGGGG - Intronic
1060153758 9:121304821-121304843 AGGCCCTGTGATGGGTGCTGGGG + Intronic
1060208524 9:121696788-121696810 GGGTCCTGAGCTGAGTTCTCTGG + Intronic
1060300989 9:122374489-122374511 TGGCCCTGTGCTGAGTATGGGGG + Intronic
1060393949 9:123302628-123302650 AGGCCTTGAGCTGTGTTGTGGGG - Intergenic
1060400205 9:123344232-123344254 AGGCCCTGTGCTAGATGCTGGGG - Intergenic
1060446705 9:123695581-123695603 AGGTCCTTTGCTGGGTCCTGGGG + Intronic
1060449783 9:123726522-123726544 ATGCTCTGTGCTGTGTACTGGGG - Intronic
1060527875 9:124330687-124330709 TGGCCCTGGGCTGTGTGCTGGGG + Intronic
1060652751 9:125343696-125343718 AGGCACTGTGCTAAGTGTTGTGG + Intronic
1060680196 9:125555668-125555690 AAGCCCTGTGCTGGGTGCTCAGG + Intronic
1060774638 9:126364012-126364034 AGGCCCTGTGCTGGGTACTGGGG - Intronic
1060940962 9:127542577-127542599 AGGCCCTTGGCTGGGTCCTGGGG + Intronic
1060992610 9:127857514-127857536 AGGCCCTGGGCTCTGTGCTGGGG - Intergenic
1061026301 9:128051946-128051968 AGGCCCTGTGCAGGGCTCTGGGG + Intergenic
1061054709 9:128216176-128216198 GGGCCCTGTGCCGGGCTCTGGGG - Intronic
1061159645 9:128885896-128885918 AGGCCCTTGGCTGGGCTCTGGGG - Intronic
1061191027 9:129082790-129082812 AGGCCCTGTGCTGGGCTTGGGGG + Intronic
1061294538 9:129669754-129669776 AGGCCCTGAGCTGAGCCCTGGGG - Intronic
1061390830 9:130316267-130316289 AGGCACTGTGTTGAGGGCTGGGG + Intronic
1061571143 9:131478069-131478091 AGGCCCTGGGCTGGGTTCTGGGG + Intronic
1061631362 9:131874237-131874259 AGACCCTGAGCTGAGTCCTGAGG - Intronic
1061902057 9:133678041-133678063 AGGCCCTGGAGGGAGTTCTGTGG + Intronic
1062041216 9:134405135-134405157 CGGCCCTGTGCTGTGCTCCGGGG + Intronic
1062687268 9:137820296-137820318 ATGCCGTGTGCAGAGTTGTGAGG + Intronic
1202791571 9_KI270719v1_random:92934-92956 AGGCCCTGCGCTGAGCCCCGTGG + Intergenic
1203572736 Un_KI270744v1:147089-147111 AGGGCCTGTGCTGACTTTGGTGG - Intergenic
1186172497 X:6891994-6892016 AGCAACTGTGCTGAGTGCTGTGG - Intergenic
1186179628 X:6960188-6960210 AGGCCCTGGGCAGAATTCTGTGG + Intergenic
1187129109 X:16483870-16483892 AGGTCCTGTGCTAAGATTTGGGG - Intergenic
1187159403 X:16750479-16750501 AGGCGCTATGCTGGGTGCTGGGG - Intronic
1187304378 X:18082031-18082053 AGGCGCTGTGCTAAGTACGGGGG - Intergenic
1187444034 X:19344835-19344857 AACACCTGTGCTCAGTTCTGAGG + Intronic
1187546857 X:20263792-20263814 AGGCATTGTGCTGAATGCTGAGG + Intronic
1188082094 X:25855853-25855875 AGCCACTGTGCTGAGTTGGGTGG - Intergenic
1188358199 X:29219344-29219366 AGGCCCTGTGCTAGGACCTGGGG + Intronic
1188818178 X:34741096-34741118 AAGCCCCTTGCTGAGTTTTGGGG + Intergenic
1189055838 X:37698681-37698703 AGACCCTGTGCTGGTCTCTGAGG + Intronic
1189161907 X:38817787-38817809 AACCTCTGTGCTGAGATCTGGGG + Intergenic
1189298206 X:39933963-39933985 AGGCTCTGAGCTGGGTCCTGGGG - Intergenic
1189593551 X:42540906-42540928 ATGCACTGTGCTGAGTACTAAGG + Intergenic
1190282856 X:48942480-48942502 AGGCCCTGTGTTGAGACCTCAGG - Intronic
1190328284 X:49219945-49219967 AGGCACTGTTCTAAGTGCTGTGG - Intronic
1190449589 X:50565281-50565303 AGACCCTGTGCTAGGTGCTGGGG - Intergenic
1190740397 X:53284727-53284749 GTGCCCGGTGCTGAGTGCTGGGG - Intronic
1190931035 X:54949967-54949989 TGGCCCTGTGCTGGGTGCTGGGG + Intronic
1191706461 X:64099306-64099328 AGGCACTTTTCTGGGTTCTGAGG + Intergenic
1192036273 X:67566246-67566268 AAACCCTGTGCTGGATTCTGAGG + Intronic
1192116345 X:68415471-68415493 GTGCCCTGTGGTGACTTCTGTGG + Intronic
1192173504 X:68871740-68871762 AGACCCTGTGCAGTGTGCTGGGG + Intergenic
1192317537 X:70064334-70064356 AGGCCTTTTGCTGAGTTTTGGGG + Intergenic
1192409912 X:70924960-70924982 AGGTCCTGTGGTGGGTGCTGGGG - Intergenic
1192478092 X:71460921-71460943 AGGCACTGTGCTAGGCTCTGGGG + Intronic
1192534710 X:71917517-71917539 CTGCCCTGTGCTGATTTCTGGGG + Intergenic
1192544067 X:71998174-71998196 AGGCCCTGAGCTGAGAGCTGGGG + Intergenic
1192588396 X:72339291-72339313 AGGCCCTGTGCTGGGTGCTGGGG + Intronic
1192773780 X:74221093-74221115 AGGCACTGTGCTGGGTAGTGGGG - Intergenic
1194602929 X:95945332-95945354 AGGCTCTGTGCTGGGAGCTGGGG - Intergenic
1194694695 X:97031623-97031645 AGGCACTGTGCTGAATGCTAGGG + Intronic
1195151021 X:102070368-102070390 AGGTCCTGTGCTCAGTTAAGGGG + Intergenic
1195592692 X:106649581-106649603 AGGCACTGTGCTGAGCTTTATGG + Intronic
1195595403 X:106683163-106683185 AGGCACTGGGCAGAGTGCTGAGG + Intergenic
1195700779 X:107704034-107704056 AGGCACTGTGTTCAGCTCTGAGG + Intergenic
1196174925 X:112629998-112630020 AGATTCTGTGCTAAGTTCTGGGG - Intergenic
1197081348 X:122421669-122421691 AGGCCAGGAGCTGATTTCTGGGG - Intergenic
1197083157 X:122441862-122441884 AGGCCCAGTGCTGGGATCTGAGG + Intergenic
1197152048 X:123230724-123230746 TGGCACTGTGCTGACTGCTGTGG + Intronic
1197228857 X:123981728-123981750 AGGCACTGTGCTAAGCACTGGGG + Intronic
1197332253 X:125168241-125168263 AGGACCTGTGCTAAGCTCTGAGG - Intergenic
1197457948 X:126701443-126701465 AGGCACTGGGCAGAGTTGTGAGG + Intergenic
1197626956 X:128813013-128813035 AGACACTGTGCTGGGTGCTGGGG - Intergenic
1198178127 X:134175057-134175079 AAGCCCTGGGCTGTGGTCTGGGG - Intergenic
1198225406 X:134640757-134640779 AGGCACTGTGCTGGGCTCTAGGG - Intronic
1198252570 X:134894850-134894872 AGGCCCTGTGCTAGGTGCTGAGG + Intronic
1198405100 X:136304564-136304586 AGGCACTGTGCTAACTCCTGGGG + Intronic
1198523355 X:137474617-137474639 AAGCACTGTGCTGAGCCCTGAGG - Intergenic
1198587977 X:138143892-138143914 AGGCTCTGTGCTAGGTCCTGGGG + Intergenic
1199034899 X:143038768-143038790 AGGCACTATGCTGTGTACTGAGG + Intergenic
1199621733 X:149707255-149707277 AGGCACTGTCCTGGGCTCTGAGG + Intronic
1199767618 X:150952581-150952603 AGGCACTGAGCTGAGCCCTGGGG - Intergenic
1199777857 X:151031364-151031386 AGGCACTGTGCTGGGTACTCAGG + Intergenic
1199848318 X:151707447-151707469 AGGCTCTGTGCTGTGTTCTAGGG - Intergenic
1200042260 X:153379153-153379175 AGGCACTATGCTGGGTGCTGGGG - Intergenic
1200296127 X:154922417-154922439 AGGCACTGTTCAAAGTTCTGGGG + Intronic
1201152050 Y:11099871-11099893 AGGCCCTGTGCTGAGCCCCGTGG - Intergenic
1201416603 Y:13753489-13753511 AGACCCAGTGCTCACTTCTGTGG + Intergenic
1201756692 Y:17494132-17494154 AGCACCTGTGCTGTGTTATGGGG - Intergenic
1201844861 Y:18411852-18411874 AGCACCTGTGCTGTGTTATGGGG + Intergenic