ID: 1085084320

View in Genome Browser
Species Human (GRCh38)
Location 11:73656630-73656652
Sequence CAGGCCCTGTGCTGAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1514
Summary {0: 1, 1: 5, 2: 46, 3: 280, 4: 1182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085084320_1085084330 -4 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084320_1085084331 -1 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084331 11:73656652-73656674 GGCATGGGGTGGGTGGCAGGAGG 0: 1
1: 0
2: 42
3: 314
4: 2064
1085084320_1085084333 1 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084333 11:73656654-73656676 CATGGGGTGGGTGGCAGGAGGGG 0: 1
1: 0
2: 11
3: 130
4: 927
1085084320_1085084332 0 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084332 11:73656653-73656675 GCATGGGGTGGGTGGCAGGAGGG 0: 1
1: 0
2: 7
3: 122
4: 1021
1085084320_1085084334 2 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084334 11:73656655-73656677 ATGGGGTGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 39
3: 440
4: 3158
1085084320_1085084328 -8 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084328 11:73656645-73656667 AGGGCCTGGCATGGGGTGGGTGG 0: 2
1: 158
2: 979
3: 3064
4: 7190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085084320 Original CRISPR CAGGCCCTGTGCTGAGTTCT GGG (reversed) Intronic
900402638 1:2478862-2478884 CCAGCCCTGTGCTGAGTGCTGGG + Intronic
900668278 1:3830990-3831012 CAGGCACTGTGGTGAGTGCTGGG + Intronic
900713855 1:4131713-4131735 GAGGCCCAGTGCTCAGCTCTGGG - Intergenic
900778304 1:4600752-4600774 CAGGCCCTGTGCAGGGCTCCGGG - Intergenic
901208044 1:7508572-7508594 CAGGCACAGTGCTGGGTGCTGGG - Intronic
901239766 1:7686145-7686167 CAGGCACTGTTCTGGGCTCTGGG + Intronic
901733448 1:11296923-11296945 CAGGCACTGTGCTGAGTACTGGG - Intergenic
901929560 1:12588303-12588325 CAGACACTGTGCTGAGTACATGG + Intronic
902172936 1:14627611-14627633 CAGGCACTGTGCTAAGCCCTAGG - Intronic
902219034 1:14953078-14953100 CATGCTCTGTGCCGTGTTCTTGG - Intronic
902243173 1:15102031-15102053 CAGGCGCTGTGCTCAGTGCAGGG + Intronic
902318233 1:15640117-15640139 AGGGCCTTGTGCTGAGTGCTTGG + Intronic
902334610 1:15747740-15747762 CAGGGCCTGTGCTGAGCTCTGGG - Exonic
902365653 1:15972214-15972236 CAGGCATTGTGCTGGGTGCTAGG - Intronic
902386681 1:16079847-16079869 CAGGCCCTGTCCTGAGCACTGGG + Intergenic
902395649 1:16131243-16131265 CAGGCCTTGTGCTGGGTTCCAGG - Intronic
902545807 1:17189732-17189754 CAGGCCCTGTGCTGGGTGCTGGG + Intergenic
902572648 1:17356576-17356598 CAGGCACTGTGCCAAGTGCTAGG + Intronic
902604890 1:17563568-17563590 CAAGTCCTGTTCTGAGTACTTGG - Intronic
902644576 1:17789536-17789558 CTGGCACTGTGCTAAGTGCTGGG - Intronic
902718067 1:18286342-18286364 CAGGCACTGTGCTAGGCTCTGGG + Intronic
902719269 1:18293199-18293221 CAGGCCCTGGGCTGAGAGCTGGG - Intronic
902719723 1:18295931-18295953 CAGGCCCTGGGCTGAGAGCTGGG - Intronic
902730943 1:18368565-18368587 CAGGCCCTGTACTAAGTGCTGGG + Intronic
902887084 1:19413235-19413257 CAGGCACTGTGTTTAATTCTGGG - Intronic
902924751 1:19688834-19688856 CAAGCCTTTTGCTAAGTTCTAGG + Intronic
902948828 1:19864571-19864593 CAGGCTCTGTGCTGAGATGCTGG - Intergenic
903070601 1:20725264-20725286 CAGGCCATGTGCTGGATACTGGG - Intronic
903224122 1:21885271-21885293 CGGGCCCTGGGCTGGGTTCTAGG - Intronic
903277947 1:22233488-22233510 CTGGCCCTGAGCTGAGCTCCGGG - Intergenic
903409218 1:23126590-23126612 CAGGTACTGTTCTGGGTTCTAGG - Intronic
903547583 1:24136275-24136297 CAGGCACTATGCTGAGGGCTGGG + Intronic
903568956 1:24290194-24290216 CAGGCCCTGTGCTGAGTATGGGG - Intergenic
903670380 1:25031766-25031788 CAGGCACTGGGCTGGGTTCAGGG + Intergenic
903814726 1:26056710-26056732 CAGGCACTGTGCTAGGCTCTGGG + Intronic
903899595 1:26633905-26633927 CAGGCCCTGTGCAGGGTTACAGG + Intergenic
903945714 1:26960860-26960882 CAGGACCTGTGCTGAGCACCAGG - Intergenic
903993587 1:27290492-27290514 CAGGCGCTGTGCTGGGCTCTAGG - Intronic
903995379 1:27302190-27302212 CAGGCACTGTGCTGGGTCCTGGG + Intronic
904203898 1:28840046-28840068 CTGGCCCTGTGCTGGGTGCTAGG + Intronic
904272374 1:29358580-29358602 CAGGCTCTGTGCTGGGTACTGGG + Intergenic
904282698 1:29432543-29432565 CAGGCACTGTGCTGGGAACTGGG + Intergenic
904300221 1:29549365-29549387 CAGGCCCTGTGCTTAGCCCTGGG + Intergenic
904300645 1:29551273-29551295 CAGGCCCTGTGCTGGGCACTGGG - Intergenic
904440751 1:30527940-30527962 CAGGCCATGTGCAGGGCTCTGGG + Intergenic
904457559 1:30656770-30656792 CAGGCCCTGTGCTGGGCACTGGG + Intergenic
904458015 1:30658750-30658772 CAGGCCCTGTGCTTAGCCCTGGG - Intergenic
904562962 1:31411090-31411112 CAGGCCCTGTACTGTGCTCTGGG + Intronic
904595133 1:31639419-31639441 CAGGCACTGTGCTGGGCCCTGGG - Intronic
904650570 1:32002847-32002869 CAGACACTGTGCTCAGTCCTGGG - Intergenic
904682506 1:32239408-32239430 CAGCCCCTGTGCTCAGTGCTGGG + Intergenic
904700269 1:32353747-32353769 CAGGGCCTGTACTGGGCTCTGGG - Intronic
904935618 1:34127761-34127783 CAGGCCCAGAGCTGAGTTGCAGG + Intronic
904946142 1:34200100-34200122 CAGGCCTTGACCTGAGTGCTGGG - Intronic
905171511 1:36112584-36112606 CAGGTGCTGGGCTGAGTTTTGGG - Intronic
905242141 1:36588256-36588278 CAGGCCCTGAGCTGGGGCCTGGG - Intergenic
905261706 1:36723592-36723614 CAGGCACTGTGCTAGGTTCTGGG + Intergenic
905292912 1:36935190-36935212 CAGGCACCGTGCTGGGTGCTGGG - Intronic
905404239 1:37722556-37722578 CAGGCCCTGTGAGGAGTGCTGGG + Intronic
905485511 1:38293013-38293035 CAGGCCCTGGGCTGGGGGCTGGG - Intergenic
905627836 1:39499997-39500019 GAATCACTGTGCTGAGTTCTTGG + Intronic
905645657 1:39623477-39623499 CAGGCCCTGTGCTCAATGCTGGG + Intergenic
905900154 1:41576031-41576053 CAGGCCCTGTATGGGGTTCTGGG - Intronic
905923278 1:41732950-41732972 CAGGCCCAGGGCTGGGTCCTAGG - Intronic
905925010 1:41743387-41743409 CAGGCTCTGTCCTAAGTGCTGGG - Intronic
905967523 1:42111794-42111816 CAGGTCTTGTGCTAAATTCTGGG + Intergenic
906033375 1:42736794-42736816 CAGGCCCTGTGCTGGGTCCTGGG - Intronic
906186204 1:43863944-43863966 CAAGCCTTGTGCAGAGGTCTAGG + Intronic
906199646 1:43951202-43951224 TGGGCCCTGTGCTGAGCTCTGGG + Intronic
906209422 1:44003866-44003888 CCGGGCCTGTGCTAAGTGCTGGG + Intronic
906216288 1:44042930-44042952 GAGGCCCCGTGCTGTGTTCAGGG + Intergenic
906255672 1:44348004-44348026 CTGGTCCTGTGCTGGGTGCTGGG - Intronic
906327363 1:44855501-44855523 CAGGACCTGTTCTGAGAGCTAGG + Intronic
906513719 1:46425799-46425821 CTTGCCCTGTGCTGAGCTCTGGG + Intergenic
906730845 1:48079843-48079865 CAGGCCCTGTGCTAGGGGCTGGG + Intergenic
906781376 1:48575879-48575901 CAGGCCCTATGCTGGTTTCTGGG - Intronic
906789590 1:48647020-48647042 CAGGCCCTGTGCTGGGCCTTGGG - Intronic
906885053 1:49636016-49636038 CAGGACATTTGCTGGGTTCTAGG + Intronic
906932238 1:50181405-50181427 CAGGCTCTGTGCTAGGTCCTCGG + Intronic
906937856 1:50230097-50230119 TAGACCCTGTGCTGGGTCCTGGG + Intergenic
906943136 1:50273256-50273278 CAGGCTCTGAGCTAAGCTCTGGG + Intergenic
907189231 1:52634374-52634396 CAAGCCCTGTGGTGAGTGCTGGG + Intronic
907221079 1:52907333-52907355 CAAGCCCTGTGCTGGGTGCTGGG + Intronic
907256397 1:53182396-53182418 CATGCCGTGTGGTGAGTGCTGGG + Intergenic
907333127 1:53684266-53684288 CCAGCCCTGTGTTGAGTTCTGGG - Intronic
907374932 1:54028835-54028857 CAGGCCCTATGCTAAATGCTAGG - Intergenic
907397170 1:54199254-54199276 CAGGCACTGTTCTCAGTGCTGGG + Intronic
907464717 1:54627504-54627526 CAGGCACTGTGCTAGGCTCTGGG + Intronic
907507153 1:54927908-54927930 CAGACCCTGTGCTGGGAACTAGG + Intergenic
907508530 1:54940934-54940956 CAGGCTCTGTGTTGAGCACTAGG + Intergenic
907665889 1:56433564-56433586 GAGGCACTGTCCTGAGTGCTGGG - Intergenic
907667813 1:56448803-56448825 CAGGCACAGAGCTGAGTTCTGGG + Intergenic
907701200 1:56789783-56789805 TAGGCCCTGTGCTTGGTGCTGGG - Intronic
907742687 1:57182514-57182536 CAGGAACTGTGCTGTATTCTTGG + Intronic
907927024 1:58964705-58964727 CAGGCCCTGGGCTGGGATCTAGG + Intergenic
907935664 1:59039955-59039977 CAGGCTCTGTGCTAGGTCCTGGG + Intergenic
907996013 1:59633448-59633470 CAGGCACTGTGCTGAGCTACTGG - Intronic
908083802 1:60608974-60608996 CAGGCCCTGTACTAGGTGCTGGG - Intergenic
908257088 1:62311710-62311732 CAGCCCCTGAGCTGATTGCTTGG - Intronic
908348210 1:63257832-63257854 CAGACACTGTGCTGGGTTGTAGG - Intergenic
908701454 1:66906616-66906638 TAGGCACTGTGCTGGGTGCTAGG - Intronic
908776815 1:67648651-67648673 CACGCCCTGTGCTGGGGGCTGGG + Intergenic
908830081 1:68170100-68170122 CCAGGCCTGTGCTGAGTGCTTGG - Intronic
909529997 1:76671370-76671392 CAGGCACTCTGCTGGGTGCTGGG - Intergenic
910178172 1:84453497-84453519 CAGGCACTGTTCTAAGTGCTAGG + Intergenic
910683490 1:89891750-89891772 CTGGCACAGTGCTGAGTTCTTGG + Intronic
910686157 1:89918614-89918636 CCTGCCCTCTGCTTAGTTCTTGG + Intronic
910700280 1:90066603-90066625 CAGGTACTGTGTTGGGTTCTGGG + Intergenic
910802946 1:91163586-91163608 CAGGAACTGTGCCGAGTGCTGGG + Intergenic
911445420 1:97985979-97986001 CAGGCTCTGTGCTAGGTGCTGGG + Intergenic
911676277 1:100661940-100661962 CAGGCACTGTTCTGTGTACTGGG - Intergenic
911696248 1:100893540-100893562 CAGGCTCTGTGCTGGGTGCTGGG - Intronic
911865015 1:103007142-103007164 CAGGCACTGTGCTAAATTTTAGG - Intronic
912366203 1:109135829-109135851 CAGGCCCTGAGCTGGGTGGTGGG + Intronic
912454329 1:109787730-109787752 CAGGCCCTGCTCTGAATTTTAGG + Intergenic
912469650 1:109897661-109897683 CAGGCCCTGTTCTGAGTGCTGGG - Intergenic
912500188 1:110116557-110116579 CAGGCTTTGTGCTGAGATTTAGG + Intergenic
912533233 1:110341184-110341206 CAGTCCGAGTGCTGCGTTCTCGG - Exonic
912557522 1:110527026-110527048 CTGGCCTTCTGCAGAGTTCTGGG + Intergenic
912558372 1:110532355-110532377 CTGGCACTGTGCTGGGTGCTGGG + Intergenic
912580469 1:110716724-110716746 CAGGCCCTGTGCTGGGTACAGGG + Intergenic
912691721 1:111809773-111809795 CAGACACTGGGCTGAGTGCTGGG + Intronic
912777053 1:112512282-112512304 CAGGCACTGTTCTCAGTACTGGG + Intronic
913082196 1:115399056-115399078 CAGGCACTGTGCTAAGTGCTGGG + Intergenic
913142411 1:115954692-115954714 TAGGCCCTGTGCTAGATTCTGGG + Intergenic
914858006 1:151366036-151366058 TAGGCACTGTGCTATGTTCTGGG - Intronic
915237553 1:154495703-154495725 TAGGCCCTGTCCTGAGCTCTGGG - Intronic
915268617 1:154735814-154735836 CAGGCCCTGTGCTGAGGCAGTGG + Intronic
915491492 1:156252376-156252398 CTGGACCTGTGCTGAGCCCTGGG - Intronic
915738702 1:158101561-158101583 CTGGCCCTGTGCTGGGGTCTGGG - Intergenic
916169328 1:161988760-161988782 CAGGACCTGGGCTGAGTTGTTGG - Intronic
916256192 1:162790437-162790459 CAGATCCTGTCCTGAGTGCTAGG + Intergenic
916620274 1:166489385-166489407 CAGGCCCTGTTCTAGGATCTAGG + Intergenic
916628090 1:166581569-166581591 CAGACATTGTGCTGAGTGCTGGG + Intergenic
916859013 1:168782520-168782542 CAGGCACTGTAATAAGTTCTGGG + Intergenic
916975398 1:170072267-170072289 CAGGCACCTTGCTGAGTGCTGGG + Intronic
917170341 1:172165931-172165953 CAGGCACTGTGCTGGGTGCTTGG + Intronic
917655015 1:177117457-177117479 CAGGCACTGGGTTGAGCTCTTGG + Intronic
918406679 1:184218370-184218392 CAGGCACTGTGCTAAGTACTAGG - Intergenic
919064733 1:192679751-192679773 CAGGCTCTGTGATAGGTTCTGGG - Intergenic
919106399 1:193156864-193156886 CTGGCAGTGTGCTGAGTGCTGGG + Intronic
919543328 1:198879036-198879058 CAGGCACTGTTCTAAGATCTTGG + Intergenic
919938016 1:202267805-202267827 CCAGCCTTGTGCTTAGTTCTAGG - Intronic
920248033 1:204602916-204602938 CAGGCCATGTTCTGGGTGCTAGG + Intergenic
920611164 1:207439206-207439228 TGGGCCCTGTGCTGAGTCTTGGG - Intergenic
920673162 1:208020241-208020263 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
920759781 1:208772013-208772035 CAGGCACTGTGCTATGCTCTTGG - Intergenic
920849561 1:209619372-209619394 CAGGCACTGTGCTGGGGTCTGGG - Intronic
921129712 1:212209281-212209303 CAGGAACTGTGCTAAGTGCTGGG - Intergenic
921321116 1:213940108-213940130 AAGGACCTTTGCTGAGTGCTGGG - Intergenic
921358880 1:214312343-214312365 CAGGCACTGTTGTCAGTTCTGGG + Intronic
921503927 1:215942864-215942886 CAAGCACTGTGCTGAGTTGGGGG + Intronic
921744949 1:218729408-218729430 CAGGCCATTTGCAGAGATCTTGG + Intergenic
921819406 1:219600203-219600225 CAGGCACTATTCTGAGTGCTAGG + Intergenic
921948812 1:220907818-220907840 CAGGCACTGTACTAGGTTCTTGG + Intergenic
922129403 1:222762126-222762148 CAGGTTCTGTGCTGTGTGCTGGG + Intergenic
922919903 1:229293595-229293617 CAGGCCCTGTGCTAGGCACTGGG + Intronic
923000822 1:230005099-230005121 TGGGCCCTGTGCTGAGTGTTGGG - Intergenic
923085943 1:230703729-230703751 TGGGCCCTGTGCTCAGTGCTGGG - Intronic
923201775 1:231719291-231719313 CAAGCACTATGCTAAGTTCTGGG - Intronic
923282232 1:232454972-232454994 CAGGAACTGTGCTGAGCACTGGG - Intronic
923322783 1:232852427-232852449 CAGGCCTTATGCTAAGTGCTGGG + Intergenic
923603611 1:235424222-235424244 CAGGCACTATGCTGATTGCTGGG - Intronic
923726812 1:236513010-236513032 CAGGCCCTCTGTTAACTTCTGGG + Intergenic
924077331 1:240353895-240353917 CAGGCCCTGTGGGGAGGTCAGGG + Intronic
924245452 1:242079405-242079427 CAAGTTCTGTGCTGAGTCCTGGG - Intergenic
924420030 1:243899597-243899619 AAGGCACTGTGCTAAATTCTGGG - Intergenic
1062883124 10:994842-994864 CAGGTACTGTTCTGAGTCCTAGG + Intronic
1063000786 10:1919714-1919736 CAGGCCCTGTGCTCATTACATGG + Intergenic
1063043015 10:2362259-2362281 CAGGGTCTGTGCTGGGTTGTTGG + Intergenic
1063124160 10:3125018-3125040 CAGGGCCTGTGCTGAGGTCCAGG - Intronic
1063373332 10:5536314-5536336 CAGGCCCTGTGCTGTTTACCAGG + Intergenic
1063606957 10:7531142-7531164 CGGGCACCGTGCTGCGTTCTAGG + Intergenic
1064211116 10:13361243-13361265 CAGGCACTGGGCTGGGTACTGGG + Intergenic
1064723824 10:18257388-18257410 CAGTCACTGTGCTAAGTGCTAGG + Intronic
1064979515 10:21151991-21152013 CAGGCGCTGTTCTAAGTACTTGG - Intronic
1065069350 10:22005686-22005708 CAGGACATTCGCTGAGTTCTGGG + Intergenic
1065252248 10:23827551-23827573 CAGGCACTGTACTGAGTAGTGGG + Intronic
1065278935 10:24115191-24115213 CAGGTGCTGTGCTGAGTTTGGGG - Intronic
1065414401 10:25468776-25468798 CAAGCACTGTGCTAATTTCTGGG + Intronic
1066088476 10:31994572-31994594 CAGGCCCTATGCTAGGTGCTGGG - Intergenic
1066333672 10:34453438-34453460 AAGCCACTGTGCTGAGTGCTTGG - Intronic
1066722656 10:38356091-38356113 CAGATCCTGTCCTGAGTGCTAGG + Intergenic
1068937391 10:62649172-62649194 CAGCCCCTGTGGTAAGTTCCTGG - Intronic
1068981476 10:63066997-63067019 CAGGCATTGTGCTAGGTTCTGGG - Intergenic
1069578466 10:69547375-69547397 CAGGCCCTGTGCTCACTGCTGGG + Intergenic
1069678645 10:70267739-70267761 CAGGCCAGTGGCTGAGTTCTCGG - Intronic
1069771538 10:70903602-70903624 CAGGCCCCGTGCTGGGACCTGGG + Intergenic
1069883831 10:71610962-71610984 CAGGTGCTGTCCTGAGTTCCAGG - Intronic
1069998800 10:72360743-72360765 CAGGCACTGTGCAGAGATTTAGG + Intergenic
1070344773 10:75531108-75531130 CAGGCACTGTGCTGGTCTCTAGG + Intronic
1070517873 10:77225008-77225030 CATGCTCTGTGCTGGGTGCTGGG - Intronic
1070645078 10:78196203-78196225 CAGGCACTGTGCCAGGTTCTGGG - Intergenic
1070838110 10:79464112-79464134 CAGGCCTGGTGCTGAGGTCCAGG + Intergenic
1070948511 10:80412467-80412489 CAGGATCTGTGTTGAGTGCTGGG + Intronic
1070959653 10:80489669-80489691 CAGGCCCTGTTTTAGGTTCTGGG + Intronic
1071438359 10:85667700-85667722 TAGGGGCTGTGCTCAGTTCTGGG - Intronic
1071522329 10:86339109-86339131 CAGGCACTGTGTTGGGTGCTGGG - Intronic
1071563159 10:86658452-86658474 CAGCCCCTGCTCTGAGTCCTGGG - Intronic
1071719196 10:88125911-88125933 CAGGCACTGTGCCAGGTTCTAGG + Intergenic
1071967255 10:90864342-90864364 TAGGCACTGTGCTAAGTGCTGGG + Intergenic
1072227886 10:93387172-93387194 CAGGGCCTGTCCTGTGTGCTTGG + Intronic
1072263617 10:93706037-93706059 CTGGCACTGTGCTGAGCACTGGG - Intergenic
1072576013 10:96700959-96700981 CAGGCCCTGTGGTCTGTTATAGG - Intronic
1072775276 10:98185258-98185280 TAGGCCCTGTGCTCAGTGTTGGG + Intronic
1072790827 10:98316515-98316537 CAGGCACCGTGGTGAGTGCTGGG + Intergenic
1072791689 10:98322541-98322563 AAAGCCCTGTGCAGAGTTCTTGG - Intergenic
1072962802 10:99944610-99944632 CAGGCACTGTGCTAAGGGCTGGG - Intronic
1073436307 10:103518421-103518443 CAGGCACTGTTCTAAGTACTAGG + Intronic
1074157083 10:110808510-110808532 CCTGCCCAGTGCTGAGTTCCTGG + Intronic
1074462449 10:113650715-113650737 CAGGCACTGTGCTGGGTATTGGG - Intronic
1074844974 10:117389796-117389818 GAGGCCCTGTGCTGAGTGCTGGG - Intergenic
1074857610 10:117485029-117485051 CAGGCCCTGGGCCAAGTGCTGGG + Intergenic
1074858293 10:117489787-117489809 CAGGCCCTGAGCTCAGCTCTGGG - Intergenic
1075087603 10:119423943-119423965 CTGGCACTGTGCTGGGTGCTGGG + Intronic
1075090102 10:119439366-119439388 CAGGCCCTGTTCTGCCTTCAGGG + Intronic
1075150169 10:119922016-119922038 CAGGCACTGTGTTCAATTCTTGG + Intronic
1075250577 10:120867739-120867761 AAGGTACTGTGCTGAGTGCTGGG - Intronic
1075341724 10:121651611-121651633 CAGGTTCTGTGCTGGGTCCTGGG - Intergenic
1075439279 10:122466535-122466557 CTGACCCTGTACTGAGCTCTGGG + Intronic
1075548212 10:123372242-123372264 CAGTCACTGTGCTAAGCTCTAGG + Intergenic
1075652623 10:124139181-124139203 CAAGCCCTCTGCTGGGTGCTGGG + Intergenic
1075864245 10:125704196-125704218 CAGGTCATGTGCTGGGTGCTGGG - Intergenic
1076032678 10:127172815-127172837 CAGGCACTGTGCCATGTTCTGGG + Intronic
1076102086 10:127790689-127790711 CACACACTGTGCTGAGCTCTGGG - Intergenic
1076233126 10:128838469-128838491 CAGGCCCTGTGCTAAATACTGGG - Intergenic
1076348360 10:129796379-129796401 CAGGCACTGTTCTGGGGTCTGGG + Intergenic
1076554770 10:131313973-131313995 GAAGCCCTGTGCTGGGTCCTTGG - Intergenic
1076989802 11:267161-267183 CAGGCCCTGTTCTAGGTGCTTGG + Intergenic
1077049275 11:559466-559488 CAGGCCCCTAGGTGAGTTCTGGG + Intronic
1077281997 11:1750002-1750024 CTGGTCCTGTGCTGAGGTCCTGG + Intronic
1077727162 11:4686105-4686127 CAGGCACTGTGCTGAGTTTAGGG + Intronic
1078093994 11:8285349-8285371 CACGCCCTGTGCTGGGCACTGGG + Intergenic
1078314612 11:10283215-10283237 CAGGCATTGTGCTAAGTGCTAGG - Intronic
1078335159 11:10457447-10457469 CAGGTCCTGTGGTCAGTTATTGG - Intronic
1078531885 11:12142962-12142984 CAGGTCCTGGGCTTGGTTCTTGG + Intronic
1078570866 11:12456852-12456874 CAGGCCCTGTGCTGTGTCCTGGG - Intronic
1078643290 11:13115626-13115648 CAGGGCCTGGGCTAGGTTCTGGG + Intergenic
1078731714 11:13981105-13981127 CAGGCTCTGTGCTAGGTTCTGGG + Intronic
1078830027 11:14969902-14969924 GAGGCCCTGTGCTGAGCGCTTGG + Intronic
1078922071 11:15840109-15840131 CAGGCGCTGTGCTCAGTGGTGGG + Intergenic
1079041883 11:17066970-17066992 CAGGCTCTGTGCTGGGCACTGGG + Intergenic
1079087462 11:17456904-17456926 CAGGCAGTGGGCTGAGTGCTGGG + Intronic
1079145544 11:17848094-17848116 CAGGCCCTTTGCTGAATCCTAGG + Intronic
1079183219 11:18212488-18212510 CATGCCCTGTGCTGAGTAGCTGG - Intronic
1079291263 11:19190032-19190054 CAGGCCTTGTGCTAAATTCTCGG - Intronic
1079369757 11:19840866-19840888 CAGACACTGTGCTAAGCTCTGGG + Intronic
1079440283 11:20507343-20507365 GAGGCCCTATGGTGGGTTCTGGG - Intronic
1079522789 11:21348358-21348380 CGGACCCTGTGCTGAGCTCTAGG + Intronic
1079626847 11:22626298-22626320 CAGGCGCTATGCTGAATTCTGGG + Exonic
1079978659 11:27125018-27125040 CAGGCTCTATGTTGAGTGCTAGG + Intronic
1080038452 11:27733589-27733611 CAGGCCCCTTGCTGAAGTCTTGG - Intergenic
1080407040 11:31988543-31988565 CAGGCGCTGTGCTAGGCTCTGGG + Intronic
1080647735 11:34199056-34199078 CAGACCCTGTGCAGGGCTCTGGG - Intronic
1080808128 11:35675136-35675158 CAGGCACTGTGCTAGGTGCTGGG - Intronic
1080888718 11:36390009-36390031 TAGGCCCTGTGCTAAGCCCTGGG + Intronic
1081429190 11:42957165-42957187 CAGACACTGTGCTGAGTACCAGG + Intergenic
1081484565 11:43517550-43517572 CAGGCACTATGCTGGGTGCTGGG + Intergenic
1081535181 11:43991173-43991195 CAGGCCCTGTTCTGAGCACTGGG + Intergenic
1081540669 11:44032504-44032526 CAGACACTGTGCTGAGCACTTGG - Intergenic
1081578135 11:44332447-44332469 CTGGCTCTGTGCTGGGTTCCGGG - Intergenic
1081582857 11:44364590-44364612 CAGGCCCTATCCTGGGTGCTGGG + Intergenic
1081631721 11:44694077-44694099 CAGGCCCTGGGCTGGGGGCTAGG + Intergenic
1081736041 11:45404988-45405010 CAGCCCTTGTGCTCAGTACTGGG + Intergenic
1082051699 11:47775583-47775605 CAGGAGCTGTGCTGAGTACAAGG + Intergenic
1082784748 11:57310793-57310815 CAAGCACTATGCTGAGTGCTTGG - Intronic
1082799788 11:57406173-57406195 CAGGCCCTGTCCTGGGTGCTGGG - Intronic
1082926551 11:58553599-58553621 CAGGCCCTGTGCTGAGCATTGGG + Intronic
1083187011 11:61023508-61023530 CCAGCTCTGTGCTGAGCTCTGGG + Intergenic
1083188627 11:61033704-61033726 CAGGCCCTCTTCTGCGTGCTGGG - Intergenic
1083213591 11:61204506-61204528 CAGGGCCTGTGCTGGGCTCAGGG + Intronic
1083216474 11:61223342-61223364 CAGGGCCTGTGCTGGGCTCAGGG + Intronic
1083219356 11:61242168-61242190 CAGGGCCTGTGCTGGGCTCAGGG + Intronic
1083306062 11:61762583-61762605 CTGCCCCTGTCCTGGGTTCTTGG + Intronic
1083552299 11:63599071-63599093 CAGACCCTGCACTGAGTGCTGGG + Intronic
1083614797 11:64021077-64021099 CAGGCGCTGTGCTGAGAGCCGGG - Intronic
1083619064 11:64040082-64040104 CAGGCACAGTGCTGGGCTCTGGG + Intronic
1083883411 11:65559064-65559086 CAGGCCCTGAGCTCAGACCTTGG - Intergenic
1083998056 11:66281959-66281981 CAGGCCCTGTGCTGAGCACTGGG - Intronic
1084020426 11:66414014-66414036 CAGGCCTTGTGCTGGATGCTGGG + Intergenic
1084070655 11:66731819-66731841 CAGGCACTGTGCTGGGATCTGGG + Intergenic
1084110712 11:67012641-67012663 CAGCCCCAGTGCTGACTTCAAGG - Intronic
1084301165 11:68253631-68253653 CAGGCCCTGGGCTGAGCTCTGGG - Intergenic
1084475697 11:69387400-69387422 CAGGCACTGTGCTAGGTGCTGGG - Intergenic
1084489070 11:69468466-69468488 CAGGCGCTGTGCTAGGTGCTTGG + Intergenic
1084644906 11:70450872-70450894 CAGGATCTCTGCTGTGTTCTCGG + Intergenic
1084855600 11:71983654-71983676 CAGGCCCTGTGCTGAGTGCTGGG + Intronic
1084876594 11:72137987-72138009 CAGGCACTGTGCTAGGTCCTAGG - Intronic
1085084320 11:73656630-73656652 CAGGCCCTGTGCTGAGTTCTGGG - Intronic
1085237187 11:75024191-75024213 CAGGCCCTGTGCTGGGTGCTCGG - Intergenic
1085241200 11:75057927-75057949 CAGACTCTGTGCTGAGTCCCAGG + Intergenic
1085280412 11:75326268-75326290 CAGGCCCTGGGCTGCTTTCTGGG - Intronic
1085287877 11:75375823-75375845 CAGGCACTGCGCTGGGTGCTGGG - Intergenic
1085322979 11:75585907-75585929 CAGGCTCAGTGCTGAGCACTGGG - Intergenic
1085325314 11:75602010-75602032 CAGGCACTGTGCTGGGCACTAGG - Intronic
1085408298 11:76277043-76277065 CAGGCCCTGTCCTGGGTTCCGGG + Intergenic
1085444389 11:76590727-76590749 CAGCCTCTGTGCTGAGCTCCTGG + Intergenic
1085450407 11:76628808-76628830 CAGGCCCTGGGCTGAGGGTTGGG + Intergenic
1085451149 11:76634377-76634399 CAGGCCCTGTGCTGGGCACTAGG - Intergenic
1085513909 11:77101507-77101529 CAAGCCCTGGGGTCAGTTCTGGG - Intronic
1085515861 11:77111640-77111662 CAGGCCCTGGGCTAGGTGCTGGG + Intronic
1085521252 11:77140186-77140208 CAGGCCCTGTGCTGGGTTGAGGG + Intronic
1085525364 11:77160638-77160660 CAGGCCCTGGGCTGGGTTCGGGG + Intronic
1085540803 11:77268099-77268121 CAGGCCTTCTTCTGAGTGCTTGG - Intronic
1085603025 11:77872422-77872444 CAGGTCCTGTGCTAGGCTCTTGG + Intronic
1085635857 11:78159031-78159053 CAAGCACTGTGCTGAGGGCTGGG - Intergenic
1085703835 11:78768558-78768580 CAGGCCCTGTCCAGGGTACTGGG - Intronic
1085719090 11:78897492-78897514 CAGGTGCTGTTCTAAGTTCTTGG - Intronic
1085757828 11:79216266-79216288 CAAGCCCTGTGCTGGGTGCTTGG - Intronic
1086408522 11:86520357-86520379 CAGGCATTGTGCTGAGTACATGG + Intronic
1086421672 11:86643757-86643779 CAGGCACTGTGCTGGGTTCATGG - Intronic
1086823475 11:91466162-91466184 CAGGCATTGTGCTAAGTGCTAGG + Intergenic
1087179426 11:95127153-95127175 CAGGCCTTGGGCTGGGTTCTGGG + Intronic
1087756103 11:102056066-102056088 TAGGCCCTGTTCTAAGTCCTGGG + Intronic
1088086079 11:105982030-105982052 CAGGCACTGTGCTGGGTGCTGGG - Exonic
1088118984 11:106345623-106345645 CAGGCCCTATGCTAGGTTCTGGG + Intergenic
1088352736 11:108908735-108908757 CATGTACTTTGCTGAGTTCTGGG + Intronic
1088384326 11:109236429-109236451 CAGACCCTGTGCTTACATCTGGG + Intergenic
1088458730 11:110060378-110060400 CAGGCCCTTTACTGAGCACTGGG + Intergenic
1088646973 11:111925364-111925386 CAGGCTCTGTGCCATGTTCTGGG - Intronic
1088668628 11:112119607-112119629 CAGGCACTGTGCTGGGTCCTGGG + Intronic
1088678248 11:112217288-112217310 GAGGCACTGTGCTAGGTTCTGGG + Intronic
1088813354 11:113406129-113406151 CAGGCTCTGTGCTGCGTCCAGGG - Intergenic
1088851179 11:113704803-113704825 CAGGCTCTGTGCTTAGCCCTGGG - Intronic
1089052292 11:115556440-115556462 CAGGCACTATGCTGAGTGCTGGG - Intergenic
1089052435 11:115557368-115557390 CAGGCCCTGTGCTAAAGTCTGGG + Intergenic
1089077827 11:115752906-115752928 CTGACCCTGTGTTAAGTTCTGGG + Intergenic
1089104886 11:115994236-115994258 CAGGCACTGTGCTAGGTCCTGGG + Intergenic
1089163235 11:116455620-116455642 CAGGCACTGTGCTGGGTGCTGGG + Intergenic
1089340307 11:117752863-117752885 CAGGCTCTGTGCTGGGCCCTGGG - Intronic
1089586406 11:119512514-119512536 CAGGCTCTGAGCTGAGTGCTGGG + Intergenic
1089600301 11:119610248-119610270 CAGCCCAATTGCTGAGTTCTGGG + Intergenic
1089668389 11:120034703-120034725 CAGGCCCAGTGCTGGGCTCTGGG - Intergenic
1089715493 11:120354895-120354917 CATCCGCTATGCTGAGTTCTGGG + Intronic
1089834107 11:121355095-121355117 TAGGCACTGTGCTAAGTGCTGGG - Intergenic
1089977506 11:122745306-122745328 CAGGAACTGTGCTAAGTACTGGG - Intronic
1090257706 11:125297342-125297364 CAGGCCTTCTGCTAATTTCTGGG + Intronic
1090425930 11:126607077-126607099 CAAGCCCTGTGGTTGGTTCTTGG - Intronic
1090521967 11:127489194-127489216 GAGGCCCTTTGCTGAGGCCTGGG + Intergenic
1090641441 11:128732439-128732461 CAGGCATTGTGCTAAGTCCTTGG + Intronic
1090806930 11:130208701-130208723 CAGGCCCTCTGCGGAGCCCTAGG - Intronic
1090893131 11:130945254-130945276 GAGGCCCTGGGCTGAGTTCTGGG - Intergenic
1090915983 11:131162370-131162392 CAGGCTCTGTGCTAAATGCTAGG - Intergenic
1091209180 11:133842164-133842186 CAGCCCCTGTGCCGTGGTCTGGG - Intronic
1091243757 11:134073606-134073628 CAGGCACTGTTCTGTGTGCTAGG + Intronic
1091640285 12:2230793-2230815 AAGGTCCTGTTCTGAGTGCTTGG + Intronic
1091651915 12:2316918-2316940 CAGGCACTATGCTGGGTGCTTGG - Intronic
1091831625 12:3554390-3554412 CGAGCCCTGTGCTCAGTGCTGGG + Intronic
1091881090 12:3978781-3978803 CAGGCACTGTTCTGAGTACTTGG - Intergenic
1091887418 12:4026796-4026818 CAGGCCCAGTGCTAAGTGATGGG + Intergenic
1091932370 12:4406327-4406349 CAGTCGCTCTGCTGGGTTCTAGG + Intergenic
1091983159 12:4882897-4882919 CAGGCCTTGTACTGGGTTCTAGG + Intergenic
1092252801 12:6910260-6910282 CAGGCCTTGTGCTGTGTTTTGGG + Intronic
1092489457 12:8932141-8932163 CAGGCCCTGGGCTGTGTTTTAGG + Intronic
1092757266 12:11775386-11775408 CAGGCCTTGTGATGAGTGCTGGG + Intronic
1093149166 12:15601599-15601621 AAGACCCTTTGCAGAGTTCTGGG + Intergenic
1093996547 12:25649092-25649114 CAGGCACTGTGCTCAGTGCTAGG + Intergenic
1094044409 12:26151560-26151582 CAGGCACTATTCAGAGTTCTTGG + Intronic
1094426015 12:30317914-30317936 CAGGTGCTGTGCTGGGTGCTGGG - Intergenic
1094776478 12:33734482-33734504 TAGGCCCTGTGCTTGGTGCTGGG - Intergenic
1094811538 12:34143078-34143100 CAGCACCTGTGCTGTGTTATGGG - Intergenic
1094834848 12:34317504-34317526 CAGCCCCTGTGCAGAGTCCCGGG - Intergenic
1094837021 12:34326847-34326869 CAGCCCCTGCGCTGTGTCCTGGG - Intergenic
1095545060 12:43357733-43357755 TAGGCCCTGTTCTGGGCTCTGGG - Intronic
1096002456 12:48141087-48141109 CAGGCACTGTGCTGAGCTTTGGG - Intronic
1096004462 12:48157695-48157717 CAGGCTCAGTGCAGCGTTCTCGG + Intronic
1096228244 12:49882810-49882832 CAGGCCCTGTTCTGGGCACTGGG + Intronic
1096601780 12:52734749-52734771 CTGGCCCTGTGCTTGGTGCTGGG - Intergenic
1096607074 12:52774674-52774696 CAGGCTCTGTGCTGGGCTCTGGG - Intronic
1096762669 12:53855493-53855515 CAGGTGCTGTGCTAGGTTCTGGG + Intergenic
1096805766 12:54140314-54140336 CAGGCACTGTGCTGGGAACTAGG + Intergenic
1096860318 12:54522099-54522121 AAAGCCCTGTGCTGGGTTTTTGG + Intronic
1097338277 12:58409047-58409069 CAGGCACTGTGTTAAGTTTTGGG + Intergenic
1097413243 12:59282061-59282083 CAGGCACAGTGCTGAATTTTGGG + Intergenic
1097706100 12:62869988-62870010 CAGGCCCTGTGTTGGGTACTGGG - Intronic
1098007866 12:66018498-66018520 CAGGCTCTGTGCCGAATTGTTGG + Intergenic
1098138822 12:67430802-67430824 GATGCCCTGAGCTGAGTTTTTGG - Intergenic
1098238257 12:68439740-68439762 CAGACCCTATGCTAGGTTCTTGG + Intergenic
1098313234 12:69168252-69168274 CAGGCACTGTGCTTAGAGCTGGG - Intergenic
1098364452 12:69687938-69687960 CAGGCACTGTGCTGGGCACTGGG - Intronic
1099142689 12:78998486-78998508 CAGGCCCTATGCTAGGTGCTGGG - Intronic
1099362155 12:81717668-81717690 CAGGCACTGTCCTGGGTGCTAGG + Intronic
1099397181 12:82155325-82155347 CAAGCACTGTGCAAAGTTCTGGG + Intergenic
1100343620 12:93705166-93705188 CAGGCACTGTCCTGGGGTCTGGG - Intronic
1100467232 12:94857065-94857087 CAGGCCCAATGCTAGGTTCTGGG + Intergenic
1100468618 12:94871788-94871810 CAGGCGCTGTTCTGAGCTCTAGG - Intergenic
1100788923 12:98109215-98109237 CAGGCTCTGTGCTAGGTGCTAGG - Intergenic
1101195573 12:102378609-102378631 CAGGCACTGGGCTGACTGCTGGG + Intergenic
1101229740 12:102727997-102728019 CAGGCACTGTTCTAAGTACTTGG - Intergenic
1101561681 12:105863144-105863166 CAGGCACTGTGCTGGGCACTAGG + Intergenic
1101608502 12:106268834-106268856 CAGGTCTTGTGCTGGGTACTGGG - Intronic
1101790177 12:107918899-107918921 CATGCTCTGTGCTCAGTGCTGGG - Intergenic
1101814926 12:108138860-108138882 CAGGTCCTGTGCTGGGCCCTGGG + Intronic
1101874263 12:108588499-108588521 CAGGCCCTGCTCTCAGTACTTGG - Intergenic
1101953960 12:109197521-109197543 CAGGCGCTGTGCTGGGTGTTGGG + Intronic
1101968548 12:109296715-109296737 CCGGCCCTGTGCTGGGCACTGGG - Intronic
1102030331 12:109736646-109736668 CAGGCCCTGTGCTAGATGCTGGG - Intronic
1102226649 12:111233520-111233542 CAGGACCTCTGCTCAGTTCTGGG - Intronic
1102288057 12:111675502-111675524 CAGGCCCTGTGCTATGTACTAGG + Intronic
1102365483 12:112330666-112330688 CAGACACTGTGCTCAGCTCTGGG - Intronic
1102416726 12:112769080-112769102 CAGGCACTGTGCTAGGTACTAGG - Intronic
1102434669 12:112911476-112911498 CAGGCTCTGTTTTAAGTTCTGGG - Intronic
1102470780 12:113158775-113158797 CTGGCCCTGTGCTGGGCACTGGG - Exonic
1102760714 12:115382452-115382474 CAGACACTGTGCTAAGTACTTGG - Intergenic
1102887055 12:116530219-116530241 CAGGGACTGTGCTAAGTGCTGGG + Intergenic
1102993156 12:117329234-117329256 CAGGCACTGTCCTAAGCTCTAGG - Intronic
1103039600 12:117684337-117684359 CAGGCTTTGTGCTGGGTGCTGGG - Intronic
1103070617 12:117938200-117938222 CAGGCACCGTGCTGGGTACTGGG - Intronic
1103125510 12:118418797-118418819 GAGGCACAGTGCTGAGCTCTGGG - Intergenic
1103222323 12:119256145-119256167 TAGGCACTGTGCTGGGTGCTGGG + Intergenic
1103232962 12:119347524-119347546 CAGCCCCTGTGCTAGGCTCTAGG - Intronic
1103235578 12:119369786-119369808 CAGGCCCCGTGCTAGGTACTGGG - Intronic
1103861013 12:124014001-124014023 CAGGCACTGTGCTAGGTGCTGGG + Exonic
1104242886 12:127008084-127008106 CAGGCCCTGTGATTGCTTCTGGG - Intergenic
1104343832 12:127977722-127977744 CAGGCTTTGTGCTGAGTATTGGG - Intergenic
1104626348 12:130358835-130358857 AAGGCCCTGTTCTCAGTGCTGGG - Intronic
1104807077 12:131596475-131596497 CAGGCTCTCTGATGAGTCCTTGG - Intergenic
1105939611 13:25135697-25135719 CAGGCACAGTGCTGGGTTCAGGG - Intergenic
1106054333 13:26223864-26223886 CAAGTGCTGTGCTAAGTTCTGGG - Intergenic
1106139545 13:27000790-27000812 GAGGCCCTGTGCTAAGCACTGGG + Intergenic
1106159114 13:27184834-27184856 CAGGCACTGTTCTAGGTTCTTGG + Intergenic
1106594816 13:31127045-31127067 CAGGCTCTGTGCTAAGCTCTGGG + Intergenic
1106678870 13:31989532-31989554 CAGGCACTGTGCTTAGTTCTAGG + Intergenic
1106814013 13:33387419-33387441 CTGGCCCTGTGCTAAGTGCTGGG + Intergenic
1107555397 13:41513250-41513272 CAGGCCCTGTGCTAGGTGTTGGG + Intergenic
1107579080 13:41762816-41762838 CAGGCACTGTGCTGAGCTCTGGG - Intronic
1107608144 13:42082877-42082899 CAGGCCCTGTGATGAGCCCCAGG - Intronic
1107699060 13:43029190-43029212 CAGGACTTATGCTAAGTTCTGGG - Intronic
1107740733 13:43447227-43447249 CAGGCACTGTGCTGGGCCCTTGG - Intronic
1107850501 13:44567843-44567865 CATTCACTGTGCTGAGTACTTGG - Intronic
1108044708 13:46372554-46372576 CTGGCCATGTGGTGAGTTCAGGG - Exonic
1108699922 13:52934927-52934949 CAGGCCCTGTACTAAGCCCTTGG + Intergenic
1108712412 13:53046608-53046630 CTGGCCCTGTTCTGGGTACTGGG + Intronic
1109270781 13:60252872-60252894 CAGGCCTTGTGCTGAGTATTGGG - Intergenic
1110326690 13:74224283-74224305 CAGGCCCTGGGCTACCTTCTGGG + Intergenic
1111801299 13:92984353-92984375 CAGGCCCCATGCTCAGTGCTGGG - Intergenic
1112044490 13:95582597-95582619 CAGGCCCTGAGCTGAATGCTGGG - Intronic
1112105882 13:96238745-96238767 CAAGCACTGTGCTGGGTACTGGG - Intronic
1112564098 13:100537552-100537574 GATGCCCTGTGCTAAGTGCTGGG + Intronic
1112650767 13:101394859-101394881 CAGCCCCTGTGCTGGGTTGTGGG + Intronic
1113130494 13:107031369-107031391 CAGGCACTGTCCTAAGTGCTTGG - Intergenic
1113351646 13:109535362-109535384 CAGGCACTGTTCTAAGTTCTTGG + Intergenic
1113444108 13:110352497-110352519 CATGCACTGTGCTGGGCTCTGGG - Intronic
1113474197 13:110568498-110568520 CAAGCCCTGTGCTCAGTGCCGGG - Intergenic
1113603154 13:111585613-111585635 CAGGTGCTGTGCTGTTTTCTGGG + Intergenic
1113809582 13:113130181-113130203 CAGGCACCGTGCTGGGTTCGCGG - Intronic
1114075746 14:19160238-19160260 CAGGCCCTGTGTTGACTACCTGG - Intergenic
1114086415 14:19239334-19239356 CAGGCCCTGTGTTGACTACCTGG + Intergenic
1114392363 14:22323603-22323625 CAGGCACTATGCTAAGTACTGGG - Intergenic
1114638778 14:24205163-24205185 CAGACACTGTGCTGAATACTTGG - Intronic
1115812265 14:37122427-37122449 CAGGCTCTATGCTAAGTGCTGGG + Intronic
1115963543 14:38862880-38862902 CAGTCCTTGTGCAGAGATCTTGG - Intergenic
1116591306 14:46778580-46778602 CAGGCACTGTTCTTAGTGCTGGG - Intergenic
1117017439 14:51532903-51532925 CAGGCCATGTGCTGAGCACTGGG - Intronic
1117206113 14:53445438-53445460 CAGGTACTGTGCTGGGCTCTGGG + Intergenic
1117477002 14:56105722-56105744 CAGGCCTAGTGCTGGGCTCTGGG - Intergenic
1117489736 14:56234589-56234611 CAGGGCCTGTGGTGGGTTGTGGG + Intronic
1117627544 14:57655306-57655328 GAGGCACTGCGCTGAGTGCTGGG + Intronic
1117789809 14:59328526-59328548 CAGGCACTGTGCTGAGCTCTGGG + Intronic
1117829939 14:59740186-59740208 CAGGCACTGTGCTGGGTGCAAGG - Intronic
1117956218 14:61125639-61125661 CAGGTCCTTTGCTGTGTTCCAGG - Intergenic
1118352856 14:64986257-64986279 CAGGCATTGTGCTAGGTTCTAGG - Intronic
1118851421 14:69586811-69586833 CAGGCCCAGGGCTGGGTGCTCGG + Intergenic
1118911758 14:70067500-70067522 CAGGCACTGTGCTGGGCACTGGG - Intronic
1118997269 14:70848036-70848058 TAGGCCTTGTGCTCAGTTCTAGG + Intergenic
1119197477 14:72727759-72727781 CAGGCACTGTGCTGGGTGCTAGG - Intronic
1119387172 14:74264840-74264862 CAGGCCCTTTGATGGGTCCTGGG - Intergenic
1119416483 14:74473705-74473727 CAGGCACTGTGCTGGGCACTGGG - Intergenic
1119482533 14:74967313-74967335 CAGGCCCTGTGCTGGGTACTGGG + Intergenic
1119567249 14:75639229-75639251 CAAGCCCTCTGCTATGTTCTTGG - Intronic
1119695252 14:76708393-76708415 CAGGCCCTGTGCTGGGTGCTGGG - Intergenic
1119883778 14:78123149-78123171 CAGGCGCTGTGCTTATTTCTGGG - Intergenic
1120219678 14:81718242-81718264 CAGGCACTGTGCTAGGCTCTGGG - Intergenic
1120569023 14:86094972-86094994 AAGGAGCTGTGTTGAGTTCTTGG - Intergenic
1120825444 14:88950752-88950774 CAGGCTCTGTGCTATGTCCTGGG - Intergenic
1120908476 14:89642892-89642914 CAGGCACTGTGCTAGGTACTGGG - Intergenic
1121029964 14:90649840-90649862 CAGGCCCTATGCTAACTTCTGGG + Intronic
1121331233 14:93051026-93051048 CGGGCCCTGTGCTGAGCACTGGG - Intronic
1121384001 14:93500373-93500395 CAGGCACTGTCCTAAGTACTGGG + Intronic
1121568898 14:94931663-94931685 CAGGCCCTGTGCTGAGGACTGGG - Intergenic
1121575360 14:94980571-94980593 CAGGCACCGTGCTGGGTGCTGGG - Intergenic
1121718637 14:96094148-96094170 CAGGCACTGTGCTGGGTGGTGGG - Intergenic
1121774581 14:96582409-96582431 CAGGCCCTGGGCTGGCCTCTTGG + Intergenic
1121795846 14:96734723-96734745 AAGGCTCTGTGCTAGGTTCTGGG + Intergenic
1121838828 14:97116053-97116075 CAGGCCCTGTGCTGAAAGCTGGG + Intergenic
1121916855 14:97843427-97843449 CGTGCCCTTTGCTGAATTCTAGG - Intergenic
1122201902 14:100127940-100127962 CAGGCACTGTGCTAGGTGCTGGG - Intronic
1122248668 14:100422812-100422834 CAGGCCCTGTGCTCCATCCTGGG + Intronic
1122406080 14:101501911-101501933 CAGGCCCTGTGCCAAGTGCCTGG - Intergenic
1122436972 14:101706952-101706974 CAGGCACTGTGCTGGGTGCTGGG - Intergenic
1122772463 14:104103493-104103515 CAGGCACTGGGCTGGGGTCTCGG + Intronic
1122807850 14:104269668-104269690 CAGGCCCGGTGCCCAGGTCTTGG - Intergenic
1122943627 14:104994886-104994908 CAGGACCTGTCCTGTGTTCTGGG + Exonic
1202897959 14_GL000194v1_random:20953-20975 CAGGCCCTGTGTTGACTACCTGG + Intergenic
1202899520 14_GL000194v1_random:27326-27348 CAGCCCCTGTGCTGGGTACCGGG - Intergenic
1124156710 15:27232586-27232608 CAGACCATGTTCTGAGTGCTGGG + Intronic
1124195194 15:27619367-27619389 CAAGCCCTGTGCTGAGGTGGAGG + Intergenic
1124392766 15:29274583-29274605 CAGGCACTGTGCTAGGTACTGGG - Intronic
1124494052 15:30175719-30175741 CAGGCTCCGTGCTAAGTGCTGGG + Intergenic
1124749518 15:32362926-32362948 CAGGCTCCGTGCTAAGTGCTGGG - Intergenic
1124856259 15:33392160-33392182 CTGGCTCTGTGCTAGGTTCTAGG - Intronic
1124904540 15:33856478-33856500 CAGGCCCTTTGCAGTGTCCTAGG - Intronic
1125172515 15:36781850-36781872 CAGGCCCTGTGCTTGGCCCTAGG + Intronic
1125350456 15:38761728-38761750 CAGGCACTGTGCTCAGTTCTGGG + Intergenic
1125464587 15:39938199-39938221 CAGGCACTGTGCTTAGTCCACGG - Intronic
1125639172 15:41215299-41215321 CAGGCACTGTTCTGAGCTCTTGG - Intronic
1125677087 15:41507948-41507970 CAGGCCCTGTGGTGGGTGCTGGG - Intronic
1125972833 15:43926031-43926053 CAGGCCCTGTGCTAAGTTCTGGG - Intronic
1125976091 15:43953128-43953150 AAGTCCCTGTGCTGTGCTCTTGG - Intronic
1126068757 15:44847310-44847332 CAGGCCCTCTGTTAAGCTCTGGG - Intergenic
1126090069 15:45043487-45043509 CAGGCCCTCTGTTAAGCTCTGGG + Intronic
1126118608 15:45231341-45231363 CTGGTCATGTGCTCAGTTCTAGG - Intergenic
1126342242 15:47653942-47653964 CTGGCACTGTGCTGGGCTCTGGG + Intronic
1126682894 15:51220434-51220456 CAGGCACTGTTCTAGGTTCTGGG - Intronic
1126994977 15:54432140-54432162 CAGGCACTGTGCTAAGTACTTGG + Intronic
1127278880 15:57471869-57471891 CAGGCACTGCGCTGGGTTGTAGG + Intronic
1127283966 15:57516651-57516673 CAGGCCCTGTGCTGAGCCAGGGG - Intronic
1128131369 15:65229301-65229323 CAGGCCCTGAGCTAGGTGCTGGG + Intergenic
1128380255 15:67107092-67107114 CAGGTACTGTGCTGAGCCCTGGG - Intronic
1128565288 15:68697034-68697056 CAGGCCCTGTGCTGGATGCATGG - Intronic
1128770573 15:70278663-70278685 CAGGCCCTGTGCTGGGCACTGGG + Intergenic
1128847282 15:70910777-70910799 CAGGCACTGTTATGAGTGCTGGG + Intronic
1128899817 15:71410230-71410252 CAAGCTCTGTGCTGGGTTCCTGG + Intronic
1129024375 15:72555765-72555787 CAGGCACTTTGCTAGGTTCTGGG - Intronic
1129225689 15:74169149-74169171 CAGGCCCTTTGCTGGGCACTAGG + Intergenic
1129238376 15:74237241-74237263 CAGGCACTGTTCTGAGTGCTGGG - Intronic
1129362085 15:75030294-75030316 CAGGCTCTGTGCTGAGTCACTGG - Intronic
1129695778 15:77739981-77740003 CAGGCACTGAGCTGAGAGCTGGG + Intronic
1129802710 15:78428263-78428285 CAGGCCCTGTGGTAAGGGCTGGG - Intergenic
1129889618 15:79063223-79063245 CAGGCCCAGTGCACAGTGCTGGG - Intronic
1129941343 15:79499701-79499723 CAAGCTCTATGCTGAGTTTTGGG - Intergenic
1130101017 15:80894112-80894134 CAGGCCCTGGGCTGAATGCTGGG + Intronic
1130136465 15:81185636-81185658 CAAGCACTGTGCTGGGCTCTGGG + Intronic
1130529550 15:84735741-84735763 AAGGCACTGAGCTGAGTGCTGGG - Intergenic
1130673540 15:85933167-85933189 CAGGCGCTGTGCTGGATACTAGG - Intergenic
1130874684 15:88003421-88003443 CAGGCACTGTTTTGAGTCCTTGG + Intronic
1131050125 15:89342192-89342214 CAGGCCCTGTGCTAGGTGCTGGG - Intergenic
1131062821 15:89414637-89414659 CAGACCCTGTGCCCAGTGCTTGG + Intergenic
1131455444 15:92579532-92579554 CAGGTCTTGTGCTGAGAGCTGGG - Intergenic
1131630172 15:94167803-94167825 CAGGCCCTGTGCTAGGCTTTGGG + Intergenic
1132047201 15:98574178-98574200 CAAGCACTGTGCTGAGCACTGGG - Intergenic
1132141820 15:99403259-99403281 CAGGCGCTGTGCTGGGCTCTGGG + Intergenic
1132347406 15:101116552-101116574 CAGGCCCTGTGATGTGTGCTGGG - Intergenic
1132810592 16:1794843-1794865 CAGGCCCCGTGCAGAGCTGTGGG + Intronic
1132892526 16:2211210-2211232 CAGGCCCTGTGCCCAACTCTGGG - Exonic
1133198449 16:4187357-4187379 CAGGCACTGTGCTAAGTACCTGG + Intergenic
1133326721 16:4946423-4946445 CAGGCCACGTGCTGAGTACCAGG + Intronic
1133502898 16:6382284-6382306 CAGGCCCTGTGCTAAACTTTAGG - Intronic
1133556799 16:6913524-6913546 CAGGCACTGGGCTCAGTGCTGGG - Intronic
1133631280 16:7624532-7624554 CAGGCACTGTGCTGGGCTTTGGG - Intronic
1133744627 16:8676734-8676756 CAGGACCTGTCCAAAGTTCTTGG - Intronic
1133808689 16:9144809-9144831 CAGGCACTGTGCTGGGTGTTAGG + Intergenic
1134013136 16:10869925-10869947 CAGGCCCTGTGCTAGGTATTTGG - Intergenic
1134072210 16:11267381-11267403 CAGGGACTGTGCTGGGCTCTGGG - Intronic
1134099455 16:11441370-11441392 CAGGACCTGTGCTAAGTATTAGG - Intronic
1134129254 16:11637541-11637563 CAGGCACTGTGCTGAGTCCTTGG - Intergenic
1134219646 16:12343755-12343777 CAGGCACTGATCTGAGCTCTGGG - Intronic
1134433795 16:14236407-14236429 CAGGCACTGTTCTGGGTACTAGG + Intronic
1134766184 16:16760202-16760224 TAGGCCCTGTGCAGAAGTCTAGG + Intergenic
1134791832 16:16995986-16996008 CAGGCCCTGTGCCAGGTTCCAGG - Intergenic
1134830671 16:17320241-17320263 CAGGCACTGTGCTAGGTTTTTGG - Intronic
1134846495 16:17445304-17445326 CAGGCACTGGGCTAGGTTCTTGG - Intronic
1134856960 16:17528016-17528038 CAGGCACTGTGCTAGGTGCTGGG - Intergenic
1134979866 16:18599009-18599031 TAGGCCCTGTGCAGAAGTCTAGG - Intergenic
1135048593 16:19173983-19174005 CAGGCCCTGGGCTAAGTGCTAGG - Intronic
1135829864 16:25763514-25763536 CAGGCACTGTGATGGGTGCTGGG + Intronic
1135876080 16:26201237-26201259 CAGGCACTGTGCTGGGTCCTGGG - Intergenic
1135877132 16:26213089-26213111 CAGGCCCTGTGCATGGTGCTTGG + Intergenic
1136024874 16:27462867-27462889 CACGCCATGTGCAGAGTTCCAGG + Intronic
1136181113 16:28553020-28553042 CAGGCACTGTGCTAGGTACTAGG + Intergenic
1136268591 16:29135063-29135085 CAGGCCCTGGGCAGAGTCCCTGG - Intergenic
1137483560 16:48872917-48872939 CAGGCCCCATACTGAGCTCTTGG + Intergenic
1137560174 16:49497293-49497315 CAGGCCCTGGGCTGGGCACTGGG + Intronic
1137573295 16:49580457-49580479 CAGGCGCTTTGCTGGGCTCTGGG - Intronic
1137589723 16:49686193-49686215 CAGGCTGTGTGCTGAGTGCTGGG - Intronic
1137591069 16:49694267-49694289 CAGGCACTGTGCTGGGCACTTGG - Intronic
1137630052 16:49936843-49936865 CAGGCACTGTGCTGGGTGTTGGG + Intergenic
1137748818 16:50842922-50842944 CAGGGACTGTGCTCAGTGCTGGG - Intergenic
1137770116 16:51009442-51009464 CAGGAACTGTGCTGGATTCTAGG - Intergenic
1137906984 16:52333255-52333277 CAGGCCATGTGCTGGGTGCTGGG - Intergenic
1137934263 16:52618902-52618924 CAGGCTCTCTGCTAAGTGCTGGG + Intergenic
1138046232 16:53728482-53728504 CAGGCCCTGGTCTAAGTTCTAGG + Intronic
1138077396 16:54056343-54056365 CAAACCCTGTGCTGGGTGCTGGG - Intronic
1138121740 16:54405775-54405797 AAGTCACTGTGCTGAGCTCTCGG - Intergenic
1138197374 16:55061438-55061460 TGGACCCTGTGCTGAGTGCTGGG + Intergenic
1138375799 16:56563253-56563275 CAGGCACTGTGCTGGGCACTGGG - Intergenic
1138451532 16:57096013-57096035 CAGGCACTGTTCTAAGTGCTGGG - Intronic
1138527766 16:57618988-57619010 CAGGCCCTGTGCTGGTTCTTGGG + Intronic
1138650629 16:58458979-58459001 CAGGCCCTGTGCTGAGCTCAGGG - Intergenic
1139101609 16:63773938-63773960 CAGGCCCTCGGCTAAGATCTTGG + Intergenic
1139113744 16:63923927-63923949 CAGGTACTGTGCTGAGTACTTGG + Intergenic
1139197594 16:64938965-64938987 CAGGCACTGTTCTAGGTTCTGGG + Intergenic
1139314876 16:66059604-66059626 CAGGCACTGTGCTGGGCACTGGG - Intergenic
1139471920 16:67182966-67182988 CAGGCACTGTTCTGGGTTCTGGG - Intronic
1139477225 16:67208756-67208778 CAGGCCCAGTGCTGGGATCATGG + Intronic
1139702128 16:68714297-68714319 CAGGTCCTGTGCTTGGTGCTGGG - Intronic
1139776833 16:69321670-69321692 CCGGCCCTGTCCTAAGTGCTGGG + Intronic
1140014829 16:71171910-71171932 CAGGCCCTGTGCCAGGTACTGGG + Intronic
1140246635 16:73255853-73255875 CAGGCCATGTTCAGAGCTCTGGG - Intergenic
1140844526 16:78873845-78873867 CAGGCCATGTGCTTAGTCCCTGG + Intronic
1140897522 16:79337995-79338017 CAGGCCCTGTGCTAGGCACTTGG + Intergenic
1141068201 16:80931028-80931050 CAGGCACTGTTCTAAGTACTAGG + Intergenic
1141116035 16:81310065-81310087 CAGGCACTGTACTGGGTGCTGGG + Intergenic
1141146399 16:81533254-81533276 CAGGCCCTGTTCTAAATGCTGGG - Intronic
1141147253 16:81539942-81539964 CAGGCCCAGTGCTCAGGGCTGGG - Intronic
1141159024 16:81616981-81617003 CCGGCCCACTGCTGAGTTGTTGG - Intronic
1141203564 16:81915288-81915310 CAGGCACTGTTCTGGGCTCTGGG + Intronic
1141588447 16:85050819-85050841 CAGGCTCTGTGCTAAGTGCTGGG - Intronic
1141882039 16:86866678-86866700 CAGGTACTGTGCTCAGTTCTGGG + Intergenic
1142071903 16:88095430-88095452 CAGGCCCTGGGCAGAGTCCCTGG - Intronic
1142645149 17:1306912-1306934 CAGACACTGTGCTGTGTTTTGGG + Intergenic
1142870392 17:2816055-2816077 CAGCACCTGGGCTGAGCTCTGGG + Intronic
1142885059 17:2907370-2907392 CAGGCCCAGTGCTCGGTTCTGGG + Intronic
1143108823 17:4542430-4542452 CAGGCCCTGGGCTGGGAGCTGGG + Intronic
1143269857 17:5667509-5667531 CAGGCCCTGTGCTGAGCAATGGG - Intergenic
1143281567 17:5758424-5758446 CAGGCACTGTGCTGGGGGCTGGG - Intergenic
1143336414 17:6174832-6174854 CAGGGCCTGAGCTGAGAGCTGGG + Intergenic
1143363611 17:6390920-6390942 CTGGCCCTATACTGAGCTCTAGG - Intergenic
1143866514 17:9927645-9927667 CAGTCACTGTGCTGAGTGCTTGG - Intronic
1144125444 17:12198481-12198503 CAGGCCCTTGGCTAAGTACTGGG + Intergenic
1144409616 17:14988010-14988032 CAGGCACTGTGCTGAGACATGGG + Intergenic
1144573076 17:16412549-16412571 CAGGCACTGTGCTGGTTGCTGGG + Intergenic
1144654372 17:17025848-17025870 CAGACCCTGGGCTGGGCTCTGGG - Intergenic
1144769181 17:17749822-17749844 CATGCCCTATGCTGGGTGCTGGG - Intronic
1144930144 17:18852383-18852405 CAGGCCCAGTGCTGAGGGTTGGG - Intronic
1145076876 17:19862876-19862898 CAGGCATTGTTCTGAGTGCTGGG - Intronic
1145260846 17:21353627-21353649 CAGGCACTGTGCTGGGCACTGGG + Intergenic
1145975095 17:28979282-28979304 CAGGTTCTGTGCTGGCTTCTGGG - Intronic
1146024699 17:29309492-29309514 CAGGCACTGTGCTAGGCTCTGGG - Intergenic
1146374223 17:32283742-32283764 CAGGCTCTGTGCTAAGTACCGGG + Intronic
1146448082 17:32949160-32949182 CAGGCTCTGTGCTGGGCTCTGGG + Intergenic
1146590615 17:34125267-34125289 CAGGACCTGTGCTGGGTGCCTGG - Intronic
1146673058 17:34755227-34755249 CAGGCATTGTTCTGGGTTCTGGG + Intergenic
1146694318 17:34897258-34897280 CAGGTCCTGTGCTGGGTGCTAGG - Intergenic
1147188515 17:38725707-38725729 CAGAGCCTGTGCTGAGGTCCAGG + Exonic
1147250064 17:39147821-39147843 CAGGCACTGTGCTGGGTGCTGGG + Intronic
1147252717 17:39162996-39163018 CAGGCCCCGTGCTGGGCCCTGGG + Intronic
1147554647 17:41469068-41469090 CAGGCATGGTGCTGAGTGCTTGG + Intergenic
1147572051 17:41577350-41577372 CAGGCATTGGGCTGAGTGCTGGG + Intergenic
1147656959 17:42096529-42096551 CAGGCCCTGGCCTGATCTCTAGG - Intergenic
1147763327 17:42815565-42815587 AAGGCACTGTGCTGAGTGCTAGG - Intronic
1147951072 17:44108373-44108395 CAGGCACTGTGCTAGGTGCTGGG + Intronic
1148083694 17:44981445-44981467 CAGGTCCTGAGCTGCGTCCTGGG + Intergenic
1148262804 17:46198068-46198090 CAGGCCCTGGGCTAGGTCCTAGG - Intronic
1148545335 17:48514424-48514446 CAGGACCTGGGCTGAGTTATAGG + Intergenic
1148743734 17:49907286-49907308 CAGGCTCTCTGCTGAGATCAGGG - Intergenic
1148773654 17:50081092-50081114 CAGGTCCTGTGCTGGATGCTGGG - Intronic
1148777387 17:50103247-50103269 CGGGCTCTGTGCAGAGCTCTGGG + Intronic
1148798221 17:50207628-50207650 CAGGCACTTTGCTGGGTACTGGG + Intergenic
1148823971 17:50378561-50378583 CCCTCCCTGTGCTGTGTTCTGGG + Intronic
1148843615 17:50515349-50515371 CAGGCACTGTGCTAGGTTCTAGG - Intronic
1148864805 17:50622935-50622957 CAGGCCCTGTGCTGGGACCTGGG + Intronic
1149084666 17:52700841-52700863 CAGGCAATGTTCTGAGTGCTAGG + Intergenic
1149229940 17:54521037-54521059 CAAGCACTGTGCTGAGTCCCGGG - Intergenic
1149432058 17:56602293-56602315 CAGGCCCTGTGCTAGGCTCTGGG - Intergenic
1149994950 17:61401430-61401452 TAGGCCTTGTGCTCAGATCTGGG - Intronic
1150393359 17:64802967-64802989 CAGGCACTGTTCTAAGTGCTGGG - Intergenic
1150646917 17:66984529-66984551 CTAGCCCTGTGCTATGTTCTGGG + Intronic
1150656626 17:67044029-67044051 CAGGCCCTGGACTGGGTTCCCGG + Intergenic
1151062881 17:71116806-71116828 CAAGCTCTGTGCTGGGTGCTAGG + Intergenic
1151171184 17:72247623-72247645 CAGGTCCTGTGCTATGTGCTGGG - Intergenic
1151315568 17:73319969-73319991 TGGGCCATGTGCTGAGCTCTAGG - Intergenic
1151407197 17:73896267-73896289 GAAGCCCTGTGCTGACTTCTGGG - Intergenic
1151432972 17:74077156-74077178 CAGGCACTGTGCTGAGCCTTGGG - Intergenic
1151559688 17:74863626-74863648 TAGGCCCTGTGCTTAGTGCTGGG - Intronic
1151643268 17:75412068-75412090 CATGCACTGTGCTGGGTACTGGG - Intergenic
1151973082 17:77469078-77469100 CAGGCCCTCTGCTGGGTCCTGGG - Intronic
1152268919 17:79312485-79312507 CAGGCGCTGTCCTGTGCTCTCGG + Intronic
1152334970 17:79695559-79695581 CAGGGCCTGTGCTGGGAGCTGGG - Intergenic
1152773304 17:82184222-82184244 CAGGCCATGTGCCAGGTTCTTGG + Intronic
1153523963 18:5977771-5977793 CAGGCCCTGTCCAGAGCACTTGG + Intronic
1155052214 18:22158346-22158368 CAGGCTCTGTTCTGGGCTCTGGG + Intergenic
1155074426 18:22342271-22342293 CAGGCCCTGTGCTCGATGCTGGG - Intergenic
1155347314 18:24871104-24871126 CAGGCACTGTGCTAGGCTCTGGG + Intergenic
1155637732 18:27975546-27975568 CAGGCCCTGTGGTGGCGTCTAGG + Intronic
1155832511 18:30535498-30535520 CAGGCACTGTTCTGAGTGCTGGG + Intergenic
1155912275 18:31517761-31517783 CAGCCCATGTTCTGACTTCTCGG - Intronic
1156001976 18:32395297-32395319 CAAGCACTGTTCTGAGTGCTAGG + Intronic
1156456711 18:37298953-37298975 CAGGCCCTATGCTAAGTGCTAGG - Intronic
1157114992 18:44854153-44854175 CAGGCCTTGTGATGCATTCTGGG - Intronic
1157185468 18:45536871-45536893 CAGGGCCTGTCCTGAATGCTGGG + Intronic
1157204743 18:45688576-45688598 CTGGTCCTGTGCTGAGCTCTTGG + Intergenic
1157285723 18:46375862-46375884 CAGGCCCTGGGCTAAGGGCTGGG + Intronic
1157402314 18:47398796-47398818 CATGCACTGTGCTGTGTGCTGGG - Intergenic
1157502974 18:48203783-48203805 CAGGCTCTGGGCTGGGTGCTGGG - Intronic
1157586642 18:48805352-48805374 CAGGCCCTGGGCTGTGTGATAGG + Intronic
1157622870 18:49026266-49026288 CAGGCTCTGGGCAGAGCTCTTGG + Intergenic
1159923756 18:74248563-74248585 CAGGCTATGTGCTGAGGCCTTGG + Intergenic
1160261853 18:77301448-77301470 CAGGCCCAGAGCTGTGTTCTAGG + Intergenic
1160390436 18:78527435-78527457 CAGTCCCAGAGCTGAATTCTGGG - Intergenic
1160669478 19:352581-352603 GAGGACGAGTGCTGAGTTCTGGG + Intergenic
1160963938 19:1737370-1737392 CAGGCTCTGTGCTGGATGCTGGG + Intergenic
1161031266 19:2058754-2058776 CGGGCCCTGTGCTGGGTGGTCGG - Intergenic
1161314396 19:3611134-3611156 CAGGCCCTGTGCTCAGAGGTGGG + Exonic
1161317442 19:3624246-3624268 CAGGCACTGTTCTAGGTTCTGGG + Intronic
1161516729 19:4700554-4700576 CACACCCTGTGCTGAGAGCTGGG + Intronic
1161701418 19:5797987-5798009 CAGACCCTGTGCTGGGCGCTAGG - Intergenic
1161747402 19:6069542-6069564 GAGGCCTAGGGCTGAGTTCTGGG + Intronic
1161796026 19:6387297-6387319 CAGGCCCTGTGCTGGGAGCTGGG - Intronic
1161854902 19:6758742-6758764 CAGGCCCTGCACGGAGTGCTAGG - Intronic
1161858103 19:6777305-6777327 CAGGCCCTGTTCTTGGTGCTGGG + Intronic
1161961115 19:7523601-7523623 CTGGCCCCGTGCTGCTTTCTAGG - Intronic
1161961448 19:7525646-7525668 CAGACCCTGTGCTGGGCTCTGGG + Intronic
1161962833 19:7532166-7532188 CAAGATCTGTGCTGGGTTCTGGG + Intronic
1162295422 19:9810194-9810216 CAGGCACTGTTCTAGGTTCTGGG - Intergenic
1162379742 19:10324326-10324348 CACGCCCTGTGCCAAGGTCTGGG + Intronic
1162873254 19:13601510-13601532 CTGGCCCTGTGCTAGGTCCTGGG + Intronic
1163434390 19:17286538-17286560 CAGGCCCGGGGCTGAGTGCTGGG + Exonic
1163564983 19:18045736-18045758 TAGGCCCTGGGCTGTGGTCTGGG - Intergenic
1163725927 19:18922984-18923006 CAGCCCATTTGCTGTGTTCTGGG + Intronic
1164145715 19:22511303-22511325 CAGGCTCTGTGCTGGGCACTGGG - Intronic
1164581323 19:29437141-29437163 CAGGCCCTGGGCTGGTTGCTGGG - Intergenic
1164714449 19:30381272-30381294 CAGGCACTGTGCTGGGGACTGGG + Intronic
1164725364 19:30462219-30462241 CAGCCCCTCTACTGAGTCCTGGG - Intronic
1165070692 19:33253434-33253456 CAGGCCTTATCCTGGGTTCTTGG - Intergenic
1165088003 19:33364658-33364680 CAGGCCCTGTCCCAAGTTCTGGG - Intergenic
1165308296 19:35015604-35015626 CAGCCACTGTGCTTGGTTCTGGG - Intronic
1165324824 19:35108474-35108496 CAGACCCTGGGCTCAGTGCTGGG + Intergenic
1165849003 19:38838268-38838290 CTGGCCCTGGGTTGAGTGCTAGG - Intronic
1165858740 19:38895396-38895418 CAGACCCTGTTCTCAGTGCTGGG - Intronic
1166007420 19:39917030-39917052 CAGGCCCTGTCCTTGGTGCTGGG - Intronic
1166228060 19:41409437-41409459 CAAGCCCTGTGCTGGGTTCTGGG - Intronic
1166386086 19:42382104-42382126 CAGGCACTGTGCTGGGTGCTTGG + Intergenic
1166549010 19:43652582-43652604 CAGGCACCGTGCTGGGTGCTGGG + Intronic
1167016200 19:46842642-46842664 CTGGTCCTGTGCTGAGGGCTGGG - Intronic
1167054948 19:47104436-47104458 CTGGCCCTGTGCTGGGCCCTTGG - Intronic
1167207977 19:48115414-48115436 CAGGGTCTGTGCTGGGCTCTGGG - Intergenic
1167267242 19:48489629-48489651 CAGGCGCTGTGCTGCATACTCGG + Intronic
1167299073 19:48668895-48668917 CAGGCCCTGGGATGGGTGCTCGG + Intronic
1167451560 19:49573230-49573252 CAGGCACTGTGCTGAACTCTGGG + Intronic
1167487081 19:49768915-49768937 CAGGCCCTGTTCTAGGTACTGGG + Intronic
1167489447 19:49783082-49783104 CAGGCACTGTGCTGATTGCTGGG + Intronic
1167496778 19:49824086-49824108 CAGGCCCTGTGCTGGCTGCCAGG - Intronic
1167588033 19:50385947-50385969 CAGGCCCTCTGCTGAGCACTGGG + Intronic
1167695476 19:51013255-51013277 CAGGCCCAGTGCTGGGTGCTGGG - Exonic
1168340064 19:55617579-55617601 CAGGCCCTGAGCTGGGCACTGGG + Exonic
1168706413 19:58472793-58472815 CAGCTCCTGTCCTGAGTACTGGG + Exonic
925431852 2:3801657-3801679 CAGGCTCTGTGCTGGGCTCCGGG - Intronic
925874996 2:8303890-8303912 CAGGCCCTGTGCTAGGCCCTGGG - Intergenic
925915253 2:8600132-8600154 GAGGCCCTGTGGAGAGTGCTGGG - Intergenic
925973779 2:9126483-9126505 CAGGCCCTCTGCTGCGAACTGGG + Intergenic
926041794 2:9679554-9679576 CAGGCCCTGGACTGAGTGCATGG + Intergenic
926405083 2:12543249-12543271 CAGGCACTGTGCTGACTCCTAGG + Intergenic
926422601 2:12715084-12715106 CGGGCTCTGTGCTGAGTGTTAGG - Intergenic
926611514 2:14952734-14952756 CAGGCGCTCTGCTGGGTGCTGGG - Intergenic
926721888 2:15967055-15967077 CAGGCCCTGTGCTCAGTTCTAGG + Intergenic
926749619 2:16188275-16188297 CAGACCCTGTGCTCAGTACTGGG + Intergenic
926812817 2:16771548-16771570 CAGGTCCTGTGCTACGTTCAGGG - Intergenic
927213069 2:20650641-20650663 CAGGCCCGGTGCTGGGCACTGGG - Intronic
927271628 2:21216351-21216373 CAGGCACTGTGCTAAGGTCTGGG + Intergenic
927313647 2:21657315-21657337 CAGGCCCTGTGCTAAGTGCAAGG - Intergenic
927554997 2:24024977-24024999 CAGGCTCTGTGCTGGGCTCTTGG - Intronic
927732776 2:25489332-25489354 CAGGCACTGTGCTAGCTTCTGGG + Intronic
927868142 2:26606156-26606178 CAGACACTGCGCTGAGTCCTGGG + Intronic
928070679 2:28212280-28212302 CAGGCACTGTTCTAGGTTCTAGG + Intronic
928108092 2:28485690-28485712 CAGGCTCTGTGCTAAGTGCTGGG + Intronic
928411094 2:31054522-31054544 TAGGCGCTATGCTGGGTTCTGGG - Intronic
928420632 2:31135830-31135852 CAGGCTCTGTGCTGGGTTTGGGG - Intronic
928453870 2:31401909-31401931 CAGGCACTCTGCTGAGGGCTGGG + Intronic
928727532 2:34192003-34192025 CAGGCTCTGATCTGAGTTCTGGG + Intergenic
928960326 2:36919162-36919184 CAGGCACTGTGCTGGCTGCTGGG + Intronic
929072669 2:38049369-38049391 GAGGCCCTGTCCTGTGTCCTCGG + Intronic
929212799 2:39376570-39376592 CAGGCCCTAAGCTCAGTGCTGGG + Intronic
929443851 2:41987846-41987868 CAGTCCCTGTGCCAGGTTCTGGG + Intergenic
929559517 2:42947128-42947150 CAAGCCCTTTTCTAAGTTCTTGG + Intergenic
929598761 2:43192032-43192054 CAGGCACTGTGCTGAGCCCTGGG + Intergenic
929624316 2:43390784-43390806 CAGGCACTGTTCTGGGTGCTTGG - Intronic
929713353 2:44287086-44287108 CAGGCCCTGTTCTAAGCACTGGG + Intronic
929825039 2:45303453-45303475 CAGGCACTGTGCTGGGTGCTGGG - Intergenic
929914825 2:46126266-46126288 CAGGCACTGTGCAGCGTGCTGGG + Intronic
929962814 2:46509169-46509191 CAGGCACTGTGCTGGGTGCTGGG - Intronic
930882793 2:56291321-56291343 CAGGCACTGTGCTGGGCACTGGG + Intronic
931760331 2:65411153-65411175 CAGGTGCTGTGCTGAGCACTTGG + Intronic
932281499 2:70496767-70496789 CATGCACTGTGCTGGGTACTGGG + Intronic
932342467 2:70974968-70974990 CTGGCCCTGTGCTGTCTTCCAGG - Intronic
932562635 2:72887017-72887039 CAGGCCCTGCACTGGGTGCTGGG - Intergenic
932576109 2:72963293-72963315 CAGGCCATGGGCTCAGTCCTTGG + Intronic
933351240 2:81154655-81154677 CAGGCCCTTAGCTGACTCCTGGG - Intergenic
933675149 2:85048947-85048969 CAGGCCCTGTTCTGATAGCTGGG + Intronic
933989585 2:87624675-87624697 CAGGCACTGTGCTGGGGGCTGGG + Intergenic
934087958 2:88525910-88525932 CAGGCCCTGTCCTGGGCTTTGGG + Intronic
934769225 2:96897256-96897278 CAGGCACGGTGCTAGGTTCTGGG - Intronic
934782229 2:96978143-96978165 CAGGCCATGGGCTGAGTGCTAGG - Intronic
934864587 2:97794836-97794858 CAGCCACTGTTCTGAGTGCTAGG - Intronic
935235569 2:101135658-101135680 CAGGCCCTGGCCTGAGTTCATGG + Intronic
935350010 2:102144586-102144608 CAGGCACTGTGGTGAGTGGTGGG + Intronic
935530103 2:104221711-104221733 CAGGCCCTGTCCCAAGTGCTGGG - Intergenic
936377505 2:111954490-111954512 CAGGCACTGTGCTGGGTGATGGG - Intronic
936864869 2:117065881-117065903 CAGGTCCTGTGCTGGGTGTTGGG + Intergenic
936896697 2:117435677-117435699 CAGGCACTGTGGTGGGTGCTGGG + Intergenic
937069538 2:119052820-119052842 CAGGCACTGTGCTGGGTAGTGGG - Intergenic
937081377 2:119142421-119142443 CAGGCCCTGTAGTAAGTTCTGGG - Intergenic
937101926 2:119278321-119278343 CAGGCCCTGTGCTAGGTCCTAGG + Intergenic
937451069 2:122002535-122002557 CCGGCCCTGTGCAGAGGCCTGGG - Intergenic
937456366 2:122044998-122045020 CAGGCACTGTGCTTGGCTCTGGG - Intergenic
937713680 2:125008255-125008277 CAGGCACTGCTCTGAGCTCTAGG + Intergenic
938071356 2:128310150-128310172 CAGGCCCTGGGCTGTGTGTTGGG - Intronic
938390122 2:130898439-130898461 CAGGCCCTGTGCTTGGCACTAGG - Intronic
938902092 2:135807054-135807076 CAGGCTCTGGGCTCAGTGCTGGG - Intronic
939996070 2:148921101-148921123 CAGGCACAGTGCTGAGTGCTGGG - Intronic
939996122 2:148921542-148921564 CAGGCCCTTTGCTGTCTGCTGGG + Intronic
940048491 2:149435686-149435708 CAGGCACTGTGCTGGGCACTTGG - Intronic
940074556 2:149726684-149726706 CAGGTCCTGTGCTAAGTGCTGGG - Intergenic
940718015 2:157249753-157249775 TAGGCCCTGTGCTAAGCTTTGGG - Intergenic
940736120 2:157454329-157454351 CAGGCTCTGTGCTAGGTTATGGG - Intronic
941886725 2:170535729-170535751 CAGGCACTGTGCTGAGGACTTGG - Intronic
941962418 2:171266795-171266817 CAGGCCCTGTGCTGAGTGCCTGG - Intergenic
942117055 2:172738292-172738314 CAGGCACTGTGCTGGGCACTGGG + Intronic
942131111 2:172880448-172880470 CAGGCACTGTATTGAGCTCTGGG - Intronic
942353833 2:175084857-175084879 CAGGCAATGTGCTGTGCTCTGGG - Intronic
942425478 2:175855964-175855986 CAGCTCCTGTTCTGAGCTCTGGG + Intergenic
942721935 2:178963059-178963081 CAGTCACTGTGCTAAGTGCTGGG - Intronic
942781629 2:179650021-179650043 CAGGCTCTGTGCTGAGCACTGGG - Intronic
943328534 2:186530976-186530998 CAAGCACTGTGCTGGGTACTGGG + Intergenic
944301006 2:198124671-198124693 CGGGCCCTGTGCTAACTCCTGGG + Intronic
944869955 2:203900056-203900078 CAGTCCCTGGGCTCAGTTTTGGG + Intergenic
945094559 2:206206705-206206727 CAGGCACTGTGCTAGGCTCTGGG - Intronic
945098937 2:206246201-206246223 CAGGCACTGTGCTAGGCTCTGGG + Intergenic
945185618 2:207136697-207136719 CAGGTACTGTGCTGGGTGCTGGG - Intronic
945466381 2:210174628-210174650 CAGGCCCTGTCCTAGGCTCTAGG - Intergenic
945780119 2:214159982-214160004 CAGGCACTGTTCTAAATTCTAGG + Intronic
946355875 2:219184285-219184307 GAGGCCATCTGCTCAGTTCTGGG - Exonic
946491463 2:220152974-220152996 CAGGCCGTGTGCTAAATGCTGGG - Intergenic
947441336 2:230124385-230124407 CAGCCACTGGGCAGAGTTCTAGG + Intergenic
947990606 2:234484704-234484726 CAGGCCCTGTGCTAGGCTCTGGG + Intergenic
948336375 2:237210634-237210656 CAGGCACTGTTCTTGGTTCTGGG + Intergenic
948388486 2:237596329-237596351 CAGGCACTGTGCTAAGTCCTTGG + Intronic
948393648 2:237629137-237629159 CTGGCTCTGTGCTGAGCTCTTGG - Intronic
948550766 2:238771833-238771855 CAGAGCCTGCGCTGAGTTCCAGG + Intergenic
948578027 2:238966560-238966582 TAGGCCCTGTGCCAAGTGCTGGG + Intergenic
1168837034 20:884407-884429 CAGGCCCAGTGCTGGGTGCTGGG - Intronic
1168857300 20:1017656-1017678 CAGACCCTGCTCTGAGGTCTGGG + Intergenic
1168896423 20:1326806-1326828 CAGGCACTGTGCTCAGCACTGGG - Intronic
1168948271 20:1779156-1779178 CAGACCCTGTGCTCAGTGCTGGG - Intergenic
1168966852 20:1903963-1903985 CAGGCCCTGTGCTGAGGTCCTGG - Intronic
1169205210 20:3735862-3735884 CAGGCTCTGTGCTAAGCACTGGG - Intronic
1169495912 20:6114992-6115014 CAGGCATTGTGGTGAGTGCTAGG - Intronic
1170079974 20:12464065-12464087 CAGGTCCTGGGCTGATTTCAGGG - Intergenic
1170119050 20:12892652-12892674 CAGGAACTCTGCTGAGCTCTGGG + Intergenic
1170568214 20:17618402-17618424 CAGGCCCAGCTCAGAGTTCTGGG + Intronic
1172007028 20:31824651-31824673 CAGGCCCTGTGCTGGGCACTGGG + Intronic
1172029710 20:31973336-31973358 CAGGCACTGTTCTAAGTGCTGGG + Intronic
1172038538 20:32027802-32027824 CAGGCACTCTGCTGTGTGCTGGG + Intronic
1172082107 20:32350206-32350228 CCAGCCCTGTGCTGAGCCCTGGG - Intergenic
1172093963 20:32451740-32451762 CAGGCCCTGAGCTGAGGCCTGGG + Intronic
1172177208 20:32979755-32979777 CAGGCTCTGTGCTAGGCTCTGGG + Intergenic
1172206180 20:33164411-33164433 CAGACCCTGTGCTGGGTACTGGG + Intronic
1172286647 20:33745352-33745374 CAGGCACTGTGCTGGGCACTGGG + Intronic
1172490144 20:35329814-35329836 CAGGCACTGTGACGAGCTCTTGG - Intronic
1172516446 20:35537547-35537569 CCTGCCCTGTGTTGAGTCCTGGG - Intergenic
1172582132 20:36056699-36056721 CAGGCACTGTGCTGAGTGCCAGG - Intergenic
1172602367 20:36192666-36192688 CAGGCCTTGTGTTGGGTCCTGGG + Intronic
1172678335 20:36691880-36691902 CAGACCCTGGTCTGAGTTGTGGG + Intronic
1172701769 20:36857743-36857765 CAGGCCCTGTGCTGGGTGTCTGG - Intronic
1172730353 20:37082029-37082051 CATGCTCTGTGCTGTCTTCTAGG - Intronic
1172824173 20:37766400-37766422 CAGGCACTGTGCTAGGTACTAGG + Intronic
1173008565 20:39159948-39159970 CAGGCACTGTGCTGAACACTGGG + Intergenic
1173223955 20:41150963-41150985 CAGGCCCTGGGCTGGGTCCTAGG - Intronic
1173288608 20:41694651-41694673 CAGGCAGTGTGTTGAGTGCTGGG + Intergenic
1173339386 20:42139859-42139881 CAGGCCCTGTGATGGGCACTGGG - Intronic
1173404766 20:42754918-42754940 CAGGCACTGCGCTGAGTGCAGGG + Intronic
1173562623 20:44017082-44017104 CAGGCCCTTTGCTAGATTCTGGG - Intronic
1173564764 20:44030705-44030727 CAGGCCCTGTGCTGAGCACTGGG - Intronic
1173581725 20:44151765-44151787 CTGGCCCTGGGCTGCCTTCTCGG + Intronic
1173622514 20:44447710-44447732 CAGGCACAGTGCTGGGTGCTAGG + Intergenic
1173747407 20:45448477-45448499 CAGGCACTGTCCTAAGTGCTGGG - Intergenic
1173911222 20:46672433-46672455 CAGGCACTGTGCTGAACACTGGG + Intronic
1173943794 20:46933962-46933984 CAGGCCCTGTTCTGGTTGCTGGG + Intronic
1173965034 20:47106272-47106294 CAGGCCCTGTGCTAGGTCCGGGG - Intronic
1173967548 20:47124547-47124569 CAAACCCTGTTCTGAGTCCTTGG + Intronic
1174075683 20:47934277-47934299 CAAGCCCTGTGCTGAGCAGTGGG - Intergenic
1174159732 20:48542261-48542283 CAGGCACTCTGCTAAGTTCTGGG + Intergenic
1174169880 20:48609610-48609632 CAGGCCCTGGCCTGGGGTCTGGG + Intergenic
1174174372 20:48635774-48635796 CAGGCCCTGAGCTGGGAGCTGGG - Intronic
1174264861 20:49323991-49324013 CAGGCCCTGTGCTTGGTGATGGG + Intergenic
1174276691 20:49409298-49409320 CAGGCACTGTGCTGGGCTCTGGG + Intronic
1174401316 20:50277548-50277570 CAGGCGCTGTGCTGGGGGCTGGG - Intergenic
1174404611 20:50295189-50295211 CAGGTCCTGGGCTGGGTGCTGGG + Intergenic
1174405219 20:50298584-50298606 CCAGCCCTGTGCTGAGTGCTGGG - Intergenic
1174407611 20:50312397-50312419 CTGACACTGTGCTGAGCTCTGGG - Intergenic
1174413762 20:50353445-50353467 CAGGCACTGTGCTGGGTGGTGGG + Intergenic
1174421924 20:50404829-50404851 CAGGCACTGGGCTGAGTGCAGGG - Intergenic
1174452459 20:50628722-50628744 CTGGCCCTGTCCTGGGCTCTGGG - Intronic
1174574417 20:51526506-51526528 CAGGCCCTGTGGTAGGTGCTTGG - Intronic
1174600991 20:51724684-51724706 CAGGCCCTGTGCTGGGTTCTGGG - Intronic
1174750735 20:53108967-53108989 CAAGAACTGTCCTGAGTTCTTGG - Intronic
1174768114 20:53272797-53272819 CAGGCTCTGTTCTGAGTCCTGGG + Intronic
1174823007 20:53743810-53743832 CAGGCACTGCCCTGTGTTCTGGG + Intergenic
1174856331 20:54048865-54048887 CAGGCCTTGTGCTGAGCTCTGGG + Intronic
1175202834 20:57289954-57289976 CTGGCCCTTTGCTGAATCCTGGG + Intergenic
1175268919 20:57720150-57720172 CAGGCCCTGTGCTGGGCTGGTGG + Intergenic
1175308457 20:57994305-57994327 CGGGCACCGTGCTGAGCTCTTGG - Intergenic
1175386007 20:58595652-58595674 CCAGGCCTGTGCTGAGCTCTGGG + Intergenic
1175412272 20:58778033-58778055 CAGGCACTGTGCTGGGAGCTGGG - Intergenic
1175462192 20:59159992-59160014 CAGGCCCTGTGCTGGATGCTGGG + Intergenic
1175717303 20:61263736-61263758 CAGTCCCTGTGCTGAAATCAAGG + Intronic
1175743522 20:61436999-61437021 CAGGCCCTGCGCTGGGTGCTAGG - Intronic
1175755864 20:61529659-61529681 GAGGCCCTGTCCTGTGTTCATGG + Intronic
1175913766 20:62416334-62416356 CAGGCCCTGGGCTACGTGCTGGG - Intronic
1176249762 20:64114932-64114954 CAGGCCCTGGGCTCAGTGCTGGG + Intergenic
1176618896 21:9042098-9042120 CAGCCCCTGTGCTGGGTACCGGG - Intergenic
1176660459 21:9630242-9630264 CAGACACTGTGCTGGGCTCTCGG + Intergenic
1176877494 21:14147435-14147457 CAGGCACTGTGTTAAGTGCTGGG - Intronic
1177849258 21:26327129-26327151 CAGGCACTGTGCTGGACTCTAGG - Intergenic
1177955297 21:27590985-27591007 CAGGCTCTGTTCTAAATTCTGGG - Intergenic
1178461584 21:32807211-32807233 CAGGCCCTGTGCTAAGGACTGGG - Intronic
1179180578 21:39041591-39041613 CAGGCACTGTGCTGTGTGCTAGG - Intergenic
1179975262 21:44861804-44861826 CAGGCTGTGTCCTGTGTTCTTGG - Intronic
1180143168 21:45905310-45905332 TGGGCCGGGTGCTGAGTTCTTGG - Intronic
1180219267 21:46347781-46347803 CTGCCCCTGAGCTGTGTTCTGGG + Intronic
1180291448 22:10853404-10853426 CAGGCCCTGTGTTGACTACCTGG - Intergenic
1180494253 22:15882826-15882848 CAGGCCCTGTGTTGACTACCTGG - Intergenic
1181544202 22:23591906-23591928 CCAGCCCTGTGCTGTATTCTGGG - Intergenic
1181661098 22:24349382-24349404 AAGGCCCTGTGTTGAGCTCTGGG - Intronic
1181729637 22:24835371-24835393 CAGGCCCTCTGCTGGGTCTTGGG + Intronic
1181790894 22:25265473-25265495 CAGGCTCTGGGCTGAGTCCTGGG + Intergenic
1181859341 22:25806069-25806091 CAGGCCCTGTGCTAGGCCCTGGG - Intronic
1181909910 22:26230450-26230472 CAGGCACAGAGCTGAGTGCTAGG + Intronic
1182061459 22:27401216-27401238 CAGTCCCTGTGCTGGGCACTGGG - Intergenic
1182077199 22:27502992-27503014 CAGGCACTGAGCTCAGTGCTAGG + Intergenic
1182222171 22:28767347-28767369 CAGGCCCTGCCCTGAGCTCCTGG - Intergenic
1182255188 22:29032759-29032781 CAGGCCTTTTGCCGGGTTCTGGG + Intronic
1182739238 22:32555049-32555071 CAGGCCTTATGCTGGGTGCTAGG - Intronic
1182923369 22:34100556-34100578 CAGCCACTGTGCTTAGTACTTGG + Intergenic
1183107486 22:35625057-35625079 CAGGCTCCGTGCTGGGCTCTGGG + Intronic
1183206665 22:36424116-36424138 CAGGCCCTGTGCCAGGCTCTGGG - Intergenic
1183365585 22:37405009-37405031 CAGGCCCTGGGCTGAATCCTGGG + Intronic
1183407669 22:37638468-37638490 CAGGCCCTGGGCTAGGTGCTGGG + Intronic
1183517569 22:38275978-38276000 CAGACCCTGTACTAAGTACTGGG - Intergenic
1183563980 22:38599659-38599681 CAGGCGCTGTGCTAAGGCCTGGG + Intronic
1183656656 22:39189566-39189588 CAGGCCCTGCGCTAAGCTCCTGG - Intergenic
1183735734 22:39643871-39643893 CAGGCCCTGAGCCAAGTGCTAGG + Intronic
1183752125 22:39727380-39727402 CAGCCCCTGTGCTGGGCACTAGG + Intergenic
1183785509 22:40027030-40027052 CAGGCCCTGCTCTAAGTTCCTGG + Intronic
1183801799 22:40172372-40172394 CAGACTCTGTGCTAAGTGCTAGG - Intronic
1183866690 22:40709875-40709897 CAGGCCCTGTGCTTATGACTTGG - Intergenic
1183924994 22:41199441-41199463 CAGGCCCGGTGCTGGACTCTGGG + Intergenic
1184107560 22:42377004-42377026 GAGGCTCTGTGCTGAGCTGTTGG - Intergenic
1184193034 22:42907781-42907803 CGGGCCCTGGGCTAAGTCCTGGG - Intronic
1184225690 22:43127857-43127879 CCAGCCCTGTGCTGTGTTCAGGG - Intronic
1184253299 22:43273093-43273115 CAGGCCCTGGGCTGAGACCGAGG + Intronic
1184341280 22:43887441-43887463 CTGGACCTGAGCTGAGTACTGGG - Intronic
1184349868 22:43936476-43936498 CAGGCCCTGTCCTGGGTGCTGGG - Intronic
1184355048 22:43974268-43974290 CAGGGCTTCTGCTGGGTTCTTGG - Intronic
1184401259 22:44275974-44275996 CAGGCCCTGTTCTATGTGCTGGG + Intronic
1184406840 22:44305261-44305283 CAGGCCCTGGGCTGGGCTCTAGG + Intronic
1184530476 22:45052139-45052161 CAGGCCCTGTGCCCAGGGCTCGG - Intergenic
1184537248 22:45095515-45095537 CAGGCAGTGTGCTGAGGTGTTGG + Intergenic
1185400179 22:50611487-50611509 CACGCCCCGTGCTGTGTTCCTGG + Exonic
1185414480 22:50702323-50702345 CAGGTGCTGTGCTGGGTGCTAGG + Intergenic
949096713 3:95066-95088 CTGGCCCTGTGCTAAGTACATGG - Intergenic
949484519 3:4525011-4525033 CAGGCTCTGTACTAAGTACTGGG - Intronic
949590057 3:5484841-5484863 CAGGCCTTGTGATAAGGTCTAGG - Intergenic
949597937 3:5567366-5567388 CACGCATTGTGCTAAGTTCTTGG - Intergenic
949890316 3:8728798-8728820 CAGACCCTGTGTAGAGTCCTGGG - Intronic
949924351 3:9029116-9029138 CAGGCTGTTTGCTCAGTTCTGGG - Intronic
950344825 3:12283886-12283908 CAGGCCCTCTGCTAAGTGCGGGG - Intergenic
950450316 3:13061595-13061617 CAGGCCCTGTGCTGATGCCAGGG + Intronic
950760439 3:15219182-15219204 CAGGCACTCTGCTGGGTACTTGG - Intronic
951373071 3:21876586-21876608 CATGCCTTGTGCTCAGTGCTGGG + Intronic
952486962 3:33822287-33822309 CAGGCACTGTGCTAGGTGCTCGG - Intronic
952494349 3:33902803-33902825 CAGGCCCTGTGCTGGGCTCTGGG + Intergenic
952500310 3:33955697-33955719 CAGGCACTGTGCTGAGTACCGGG - Intergenic
952630662 3:35461974-35461996 CAGTTCCTGTGCTGGGTGCTGGG - Intergenic
952960044 3:38583373-38583395 CTGGCCCTGGGCTGAGTGCTTGG + Intronic
953194121 3:40715805-40715827 CTGGCCCTATGCTGAGCACTGGG - Intergenic
953373604 3:42410223-42410245 TAGGTTCTGTTCTGAGTTCTGGG - Intronic
953384896 3:42500983-42501005 CAGGCCCTGTGCTGTGCACTGGG - Intronic
953406578 3:42662858-42662880 CAGGACCTGTGCTGATTCCCAGG - Intronic
953570917 3:44071018-44071040 CAGGCACTGTGCTGCGTACTTGG - Intergenic
953646182 3:44757548-44757570 CAGGCACTGTGCTAGGTGCTGGG + Intronic
953998216 3:47536652-47536674 CAAGCCCTGTCCAGAGCTCTCGG - Intergenic
954143871 3:48624484-48624506 CAGGCTCTGTGCAGGGGTCTGGG - Intergenic
954369260 3:50161689-50161711 CAGGCCCCGTGCTGAGTGCTGGG + Intronic
954616412 3:51970916-51970938 AAAGCCCTGAGCTGGGTTCTAGG - Intronic
954649786 3:52154144-52154166 CAGGCCCTGCGCTGGGTTTCTGG - Intronic
954710136 3:52501505-52501527 TAGGCCCTGTGCTCAGCTCTGGG + Intronic
954712914 3:52513861-52513883 CAGGCCCTGTGCTCTGTACCAGG + Exonic
954744603 3:52780015-52780037 CAGGCCCTGTGATCAGGGCTGGG + Intronic
954786018 3:53092965-53092987 CAGGCCCTGTGAGGAGTGCTGGG + Intronic
954898902 3:54002016-54002038 CAGGCACTGTGCTGATTCCTAGG - Intergenic
954931142 3:54282640-54282662 CAGGCTATGTGCTGGGCTCTGGG + Intronic
955183664 3:56694241-56694263 CAGGCACTGTGGTGAGCCCTGGG - Intergenic
955221335 3:57025807-57025829 CAGGCACTGTGCTGGGCTCATGG - Intronic
955244525 3:57212015-57212037 CAGGCACTGTGCTGGGTGCAGGG - Intronic
955326888 3:58015508-58015530 CAGGCCCTGTGCTGGGTGCTAGG + Intronic
955522536 3:59788669-59788691 CAGGCCCTGGGCTGGGTGCAGGG - Intronic
955780296 3:62477503-62477525 CAGGCACAGGGCTAAGTTCTTGG - Intronic
955791618 3:62593934-62593956 CTAGCACTGTGCTAAGTTCTGGG - Intronic
955983732 3:64551979-64552001 CAGGCCCTGTGACGGGTCCTGGG + Intronic
956620318 3:71215305-71215327 CAGGCCCTGTACTGAGTGTTAGG + Intronic
956790755 3:72678276-72678298 CAGGCCCTGGGCTAACTGCTAGG - Intergenic
957405587 3:79772967-79772989 CAGGCCCAGGGCTCAGTGCTGGG - Intergenic
959854900 3:111141029-111141051 CAGGCCTTGTGCTAAGTGCCAGG - Intronic
960137834 3:114123536-114123558 CAGGCATTGTGCTTAGTACTGGG - Intergenic
960238074 3:115307853-115307875 TAGGCTCTGTGCTGGGTGCTAGG - Intergenic
960870945 3:122249148-122249170 CAGGTGCTGTGCTGGGTGCTAGG + Intronic
960961224 3:123071813-123071835 CAGGCCCTGGGCTAGGTGCTGGG - Intronic
960986630 3:123285314-123285336 CAGGGCCTGTGCTTAGGTCCAGG + Intronic
961021786 3:123513704-123513726 CAGGTCTTGTGCTGAGCACTGGG - Intronic
961203152 3:125060237-125060259 CCAGCACTGTGCTGAGTGCTGGG + Intergenic
961264032 3:125625885-125625907 CAGGCACTGTGCTAAGAGCTGGG - Intergenic
961456518 3:127027313-127027335 CTGGCCCTGTGCTGTGTGCTTGG + Intronic
961584076 3:127907961-127907983 CAAGCACTGTGCTGGGCTCTGGG + Intergenic
961623978 3:128246676-128246698 CAGGCCCTGTGCTAGGCACTTGG - Intronic
961950443 3:130744220-130744242 CAGGCACTGTCCTAAGTGCTAGG - Intronic
962236587 3:133712222-133712244 CAAGCCCTGTGCTGGGCTCCAGG - Intergenic
962613676 3:137103365-137103387 CAGGCCCTGTGCTGGGTGGGGGG + Intergenic
962876859 3:139541756-139541778 CAGGCACTGTGCTGAGCATTTGG - Intergenic
962923940 3:139974856-139974878 CTGGCCCTGTACAGAGGTCTAGG + Intronic
963383685 3:144563421-144563443 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
963645009 3:147903151-147903173 AAAGGGCTGTGCTGAGTTCTTGG + Intergenic
963774751 3:149427203-149427225 CAGGCACTGTTCTAAGTGCTGGG - Intergenic
963867038 3:150372778-150372800 CTGGCAGTGTGCTGAGTGCTGGG + Intergenic
964733753 3:159894651-159894673 CAGGCCCTGTGCTAGGCTCTGGG - Intronic
964846971 3:161054773-161054795 CAGGCTCTGTACTTAGTCCTTGG - Intronic
964914546 3:161824076-161824098 CAGGCCCTGTGCTAAGAGCTGGG - Intergenic
965428452 3:168557031-168557053 CAGGCCCTGTGCAGATTATTTGG - Intergenic
965605143 3:170491064-170491086 CAGGCACTGTGCTTAGTGATGGG + Intronic
965629097 3:170712313-170712335 CAGGCTCTGTGCTGGGCACTGGG + Intronic
965632674 3:170749364-170749386 CAGGCTTTGTGCTGGGTGCTGGG + Intronic
966674547 3:182571447-182571469 CAGGCACTGCACTGAGTGCTGGG - Intergenic
966868933 3:184277507-184277529 CAGGCCCTGTGCTGGGCACAAGG - Intronic
966916298 3:184585907-184585929 CAGGCACTGTGCTGGGCACTGGG + Intronic
967060568 3:185868803-185868825 CAGGCACTGTGCTGAGTACATGG - Intergenic
967093898 3:186160986-186161008 CAGGCACTGTTCTACGTTCTGGG + Intronic
967144153 3:186591982-186592004 CAGGCACTGTGCTAGGTGCTGGG + Intronic
967197276 3:187039367-187039389 CAGGCACTGTGCTGGGTACTAGG + Intronic
967303602 3:188040111-188040133 CAGGCCCTGTGCTAAGTGCCGGG + Intergenic
967325028 3:188230409-188230431 CAGGCCTTACGCTGAGTGCTTGG + Intronic
967850745 3:194080876-194080898 CAGTCCCTTTCCTGAGTCCTTGG + Intergenic
968123292 3:196141327-196141349 CAGGCACTGTGGTGGGTTCTGGG - Intergenic
968549467 4:1214729-1214751 CAAGCCCTGAGCTGAGGACTGGG + Intronic
968734509 4:2288415-2288437 CGGGCCCTGGGCTGGGTGCTGGG + Intronic
968793509 4:2686371-2686393 CAGGCCCTGTGCTAGACTCTAGG + Intronic
968841749 4:3012074-3012096 CAGGCACTGTGCTGAGAGCTGGG - Intronic
968979141 4:3837312-3837334 GAGGCATTGTGCTGAGGTCTGGG - Intergenic
969009400 4:4049152-4049174 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
969135295 4:5024542-5024564 CAGGCCCTGTCCTGAGAAGTAGG + Intergenic
969291257 4:6241519-6241541 CAGGCCCTGAGCTGGGCACTGGG + Intergenic
969377322 4:6771517-6771539 CAGGCCCTGGGCTGGGTGCCCGG + Intergenic
969378697 4:6780282-6780304 CAGGCTCCGTGCTGGGCTCTGGG + Intergenic
969502230 4:7560043-7560065 GAGGCCCTGGCCTGAATTCTGGG + Intronic
969533838 4:7743945-7743967 CAGGCCCTGGGCTGGGCTCTGGG + Intergenic
969689486 4:8696367-8696389 CAGGCTCTGTGCTGGTCTCTGGG + Intergenic
969696323 4:8737175-8737197 CAGGCACTGGGCTGAATTCTGGG + Intergenic
969744956 4:9063172-9063194 CAGGCACTGTGCTGTGTTGCGGG + Intergenic
970355435 4:15246328-15246350 AAGGCACTGTGCTAAGTTCTAGG - Intergenic
970497226 4:16638719-16638741 CAAGCACTGTGCTGGGTACTAGG + Intronic
970609709 4:17713796-17713818 CAGGCTCTGTGCTGGGCACTGGG + Intronic
971417237 4:26443003-26443025 CAGGCACTGTGCTAGGGTCTGGG - Intergenic
971462489 4:26915848-26915870 CAGGCTCTGTGCTTGGTGCTGGG - Intronic
971501957 4:27327775-27327797 CAGGGCCTGTGCTGCATTATAGG + Intergenic
972277111 4:37567731-37567753 CAGGCACTGTGCTAGGTTCTGGG - Intronic
972598864 4:40554085-40554107 CAGGCACCGTGCTGGGTCCTGGG - Intronic
972645995 4:40967852-40967874 CAGGCACTGTGCTTAGTGCTAGG - Intronic
973637370 4:52872535-52872557 CAGGCACTGTGCTAGGTTCTGGG - Intergenic
973778335 4:54264467-54264489 CAGGCACTGTGCTAGGTTCTGGG + Intronic
973809679 4:54557702-54557724 CAGGCCCTGTTCTAGGTGCTGGG + Intergenic
974026013 4:56733736-56733758 CAGGCACTCTGCTAAGTGCTGGG + Intergenic
974034272 4:56803768-56803790 CAGGCACTGTGCCAAGTGCTGGG + Intergenic
974106944 4:57480399-57480421 CAAGCCCTGTGTTGTGTTCTTGG + Intergenic
975166681 4:71186477-71186499 CACGCCCTGGGCTGGGTCCTAGG - Intergenic
975580114 4:75898647-75898669 CAGGCACTGTGCTAAATCCTGGG - Intronic
975633696 4:76424770-76424792 TAGACCCTGTGCTGGGTACTGGG + Intergenic
975809768 4:78155153-78155175 CAGGCCCTGTCCTAGGTGCTAGG - Intronic
976303317 4:83535935-83535957 AAGGACCTTTGCTGAGTGCTGGG + Exonic
977171828 4:93771908-93771930 CAGGCACTGTGCTAAGTTCTGGG - Intronic
977223666 4:94369482-94369504 TAGGCACTGTGCTGTGTTCTAGG - Intergenic
977388971 4:96383545-96383567 CAGGCACTGTGCTGAGTGTTGGG + Intergenic
977557955 4:98503768-98503790 CAGGGCTTGTGCTGAATTCTAGG - Intronic
977656158 4:99523160-99523182 CAGGCACTGTGCTGGGACCTGGG - Intronic
978193116 4:105939082-105939104 CAGACACTGTGCTGAGTGCTAGG + Intronic
978264402 4:106805148-106805170 CAGGCCCAGTGCGCAGTGCTGGG - Intergenic
978597372 4:110392901-110392923 CAGACACTGTGCTGGGCTCTAGG + Intronic
979485838 4:121269410-121269432 CAGGCACTGTGCTAAGTATTAGG + Intergenic
979507076 4:121510527-121510549 CAGGCCCCATGCTGAGCACTGGG - Intergenic
979653247 4:123161133-123161155 CAGGCACTCTGCTAAGTTTTTGG - Intronic
979697034 4:123624200-123624222 AAGACACTGTGCTGAGTCCTTGG + Intergenic
979824237 4:125214010-125214032 CCGACCCTGGGCTGACTTCTTGG + Intergenic
980054755 4:128068618-128068640 CAGGCCCAGTCTTGAATTCTTGG + Intronic
980283765 4:130756155-130756177 CAGGCCCAGTGTTGAGGTGTAGG + Intergenic
980879045 4:138690846-138690868 CAGGCCCTGTGCTAGATTCGGGG - Intergenic
980970041 4:139558919-139558941 CAGGCACTGTGTTGTGTTCTAGG - Intronic
981180129 4:141731987-141732009 CAGGCCCTGTGCTAAATGCTAGG + Intronic
981453841 4:144931104-144931126 CAGGACCTGAACTGAGTACTGGG - Intergenic
982091195 4:151881289-151881311 CAGGCACTGTTCTAAGTGCTAGG + Intergenic
982099960 4:151958113-151958135 CAGGCACTTTCCTGAGTACTGGG - Intergenic
982114753 4:152088870-152088892 CAGGCACTGTGCTAGGTGCTGGG + Intergenic
982227638 4:153180911-153180933 CAGGCATTGTCCTGAGTGCTGGG + Intronic
982680350 4:158420339-158420361 CGGGCACTGTGCTGAGTGCATGG - Intronic
982703903 4:158686794-158686816 CAGCCCCTATGCTGAGTACCTGG - Intronic
982734716 4:158993616-158993638 CAGGCACTCTTCTGAGTGCTTGG + Intronic
982737984 4:159025919-159025941 CAGGCCCTGTGCTACCTACTAGG - Intronic
983954377 4:173680056-173680078 CAGGGACTGTGCTAAGTTCTTGG + Intergenic
984954751 4:185034215-185034237 CAGACTCTGTGCTAAGTTCTGGG - Intergenic
985170842 4:187148347-187148369 CAAGCACTGTGCTAAGTACTGGG + Intergenic
985682978 5:1266113-1266135 CAGGCCCTGTGCACAGCTCCTGG + Intronic
986209397 5:5656433-5656455 CAGGCACTGTTCTGGGTACTGGG - Intergenic
986245487 5:6003119-6003141 CAGGCTCTATGCTGAGCACTGGG - Intergenic
986338125 5:6769774-6769796 CTTCCCCTGTGCTGTGTTCTCGG + Intergenic
986763231 5:10899006-10899028 CAGGCCCTGTGCTGACTGCCAGG + Intergenic
987031622 5:13981351-13981373 CAGGCACGGTGCTGGGTGCTGGG - Intergenic
987079671 5:14415352-14415374 CAAGCTCTGCGATGAGTTCTGGG - Intronic
987277022 5:16373311-16373333 CAGGCACTGTGCTGAGCATTGGG - Intergenic
987540463 5:19248018-19248040 CAGGCACTGAGCTTAGTTTTGGG + Intergenic
987619065 5:20315934-20315956 CAGGCACTATTCTTAGTTCTAGG - Intronic
988890234 5:35608793-35608815 CAGGCACTGTTCTAGGTTCTGGG + Intergenic
989034104 5:37151487-37151509 TAGGCCCTGTGCTAAATTCTAGG - Intronic
989101923 5:37831336-37831358 CAGGCACTGTCCTAAGTGCTAGG - Intronic
989159755 5:38379025-38379047 CAGGCTCTGAGCTCTGTTCTGGG + Intronic
989196498 5:38721773-38721795 CAGGCACAATGCTGAATTCTGGG + Intergenic
989276810 5:39598990-39599012 CAGCCACTGTGCTGCGCTCTGGG + Intergenic
991067517 5:62440088-62440110 CAGGCACTGTGCTAGATTCTAGG + Intronic
991184443 5:63790871-63790893 CAGGCACTGTGCTAGGCTCTGGG - Intergenic
991738097 5:69645004-69645026 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
991760097 5:69911420-69911442 CAGGCCCAGTGGCGACTTCTGGG + Intergenic
991787235 5:70206680-70206702 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
991789673 5:70224730-70224752 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
991814422 5:70499840-70499862 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
991817557 5:70521132-70521154 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
991839328 5:70786471-70786493 CAGGCCCAGTGGCGACTTCTGGG + Intergenic
991879681 5:71207070-71207092 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
991882121 5:71225099-71225121 CAGGCCCAGTGGCGACTTCTGGG - Intergenic
992181718 5:74204082-74204104 CAAGCACTGTGCTGTGTTCTGGG + Intergenic
992733487 5:79695636-79695658 CAGGCCCTGTGCTGGATACCAGG + Intronic
992763463 5:79972357-79972379 CAAGCACTGTGCTCAGTGCTGGG + Intergenic
993177395 5:84504455-84504477 CATGCCCTGTGCTAAGAACTAGG + Intergenic
993373512 5:87120456-87120478 CAGGCACTGTTCTGAGCTCTGGG - Intergenic
994156941 5:96514395-96514417 CAGGCACTGTGGTAGGTTCTGGG - Intergenic
994262117 5:97672017-97672039 CTAGCACTGTGCTGTGTTCTGGG + Intergenic
994264172 5:97695130-97695152 CAGTCACTGTTCTGAGTGCTTGG + Intergenic
994384535 5:99114220-99114242 TAGGCACTGTTCTGAGTTCTGGG - Intergenic
995225939 5:109701093-109701115 CAGGCACTGTTCTAGGTTCTGGG + Intronic
995438121 5:112160430-112160452 CAGGCCCTGGCCTGAGTGCCTGG - Intronic
996105854 5:119501716-119501738 CAGGCACTGTTATAAGTTCTGGG + Intronic
996568173 5:124903966-124903988 GAGGCACTGTGCTAAGTGCTGGG + Intergenic
997353334 5:133246454-133246476 CAGGCACTGAGCTGGGTCCTTGG + Intronic
997423641 5:133788118-133788140 CAGGCCCTGGGCTGGGCGCTGGG - Intergenic
997431078 5:133841677-133841699 CTGGCCCTGTGCTGTGTGTTGGG - Intergenic
997445073 5:133934617-133934639 CAGGCCCCATGCTAAGTGCTAGG + Intergenic
997446957 5:133947312-133947334 CAGGCCCTGTGCTGAGTTTTGGG - Intergenic
997447331 5:133951302-133951324 CAGGCCCTGTGCTGCGTGCTGGG - Intergenic
997447611 5:133952864-133952886 CAGGCCCTGTGCTGCGTGCTGGG + Intergenic
997480135 5:134178395-134178417 CAGACCCTGTGCTGGGTCCCCGG - Intronic
997656427 5:135558138-135558160 CAGGCCCTGTACTAGGTACTTGG - Intergenic
997826421 5:137110798-137110820 CAGGCACTGTGCTAGGTGCTGGG - Intronic
997964156 5:138344853-138344875 CTGTTCCTGTGCTGAGTTCCAGG + Exonic
998017185 5:138741745-138741767 CAGGCCCTGTGTTAAATTATGGG + Intronic
998080124 5:139268129-139268151 CAGGCCCTGTGCTAGGCTCTAGG - Intronic
998108034 5:139481080-139481102 CCTGCCCTGAGCTGAGTACTGGG - Intronic
998366286 5:141634623-141634645 CAGGCCCTGTGCTAAGTGCTGGG - Intronic
998387650 5:141767041-141767063 CAGGCCCTGTGCTATGGGCTGGG - Intergenic
998448599 5:142217336-142217358 CAGGCGCTGTGCTCAGAACTGGG - Intergenic
998516433 5:142758702-142758724 CAGGCCCAGTACTGAAGTCTTGG - Intergenic
998637357 5:143971058-143971080 CAGGCACTGTTCTCAGTGCTGGG + Intergenic
998850326 5:146345324-146345346 GAGGCCCTGCGTTGAGTTCAGGG - Intergenic
998900439 5:146847551-146847573 CAAGCCCTGTGGTGGGTTCCTGG - Intronic
998923446 5:147096601-147096623 CAGGCACTGTGCTTGGTGCTAGG - Intergenic
999080696 5:148840761-148840783 CAGAACCTGTGCTAACTTCTGGG + Intergenic
999091728 5:148941961-148941983 CAGGCCCTGTGTTGGGAGCTAGG - Intronic
999117354 5:149175550-149175572 GAGGCCCTGTGCTGAGCCCACGG + Intronic
999438319 5:151581578-151581600 CAGGCCCTGTGGTGAGCACTTGG + Intergenic
999519069 5:152331860-152331882 CAAGCACTGTGCTGAATGCTGGG + Intergenic
999734799 5:154505268-154505290 CAGACCCTGTGCTGAATGCTTGG + Intergenic
999827325 5:155286279-155286301 CAGGCACTGTGCTGGATCCTGGG + Intergenic
1000278805 5:159764258-159764280 CAGGCACTGGGCTGGGTGCTGGG - Intergenic
1000293875 5:159896089-159896111 CAGGCACTGTGCTAGGTCCTGGG - Intergenic
1000347517 5:160327306-160327328 CAGGCACTGTGCTAGGCTCTTGG + Intronic
1000423825 5:161067640-161067662 CAGGCCCTATGCTAGGTTCAAGG - Intergenic
1000703236 5:164478915-164478937 CAGGCTCTGTGCTAAGTACTGGG - Intergenic
1000953616 5:167515494-167515516 CAGGGCCTATGCTAAGTCCTAGG + Intronic
1000986452 5:167865970-167865992 CAGGCTCTGTACTGGGTGCTAGG + Intronic
1001029177 5:168249393-168249415 GTGGCACTGTGCTAAGTTCTGGG + Intronic
1001149351 5:169213775-169213797 CAGGCACTGTTCTTAGTTCTGGG - Intronic
1001164946 5:169356028-169356050 CAGGCTCTCTGCTAGGTTCTGGG + Intergenic
1001309942 5:170603449-170603471 CAGGCCCTGTGCTGGGAGCCAGG + Intronic
1001319882 5:170671674-170671696 CAGGCTCTGTGCTAAGCACTAGG - Intronic
1001659200 5:173378047-173378069 AAGCTCCTGTGCTGAGCTCTAGG - Intergenic
1001711612 5:173783429-173783451 CAGGCACTGTTCTCAGTCCTGGG - Intergenic
1001732076 5:173968187-173968209 CAGTCCCAGTGCTGAGTTGAGGG + Intergenic
1001809953 5:174619946-174619968 CAGGCCCTGTGTTAGGTGCTAGG - Intergenic
1002026470 5:176399222-176399244 CAGGCACTGTGCTGGGCTCTGGG - Intronic
1002082554 5:176746103-176746125 CAGGCCATGTGGGGTGTTCTGGG + Intergenic
1002139567 5:177130835-177130857 CAGGCAGTGTGCTGAGTGCTGGG - Intergenic
1002317093 5:178350340-178350362 CAGGCACTGTGCTGGCTGCTGGG - Intronic
1002453501 5:179332625-179332647 CTGGCCCTGAGCTGAGGTCTGGG - Intronic
1002923289 6:1588997-1589019 CAGTCACTGTGCTGAGTACTAGG - Intergenic
1003110287 6:3247482-3247504 CAGGCACTGTCCTGAGTGCTGGG - Intronic
1003478087 6:6503619-6503641 CAGGCATTGTGCTGAATGCTGGG + Intergenic
1003622600 6:7714324-7714346 CAGGCACTGTGCTATGTGCTGGG + Intergenic
1003947903 6:11092205-11092227 CAGGCACTGTTCTAAGTGCTGGG - Intergenic
1004021122 6:11776362-11776384 CAGCCACTGTGCTGAATTCAAGG + Intronic
1004315490 6:14583599-14583621 TAGGCCCTGTGCTAAGTGCTGGG - Intergenic
1004568697 6:16824033-16824055 CAGGCACTGTGCTGAGCAGTAGG + Intergenic
1004949005 6:20647215-20647237 CAGGCCCTGTAATAAGTGCTGGG + Intronic
1005525205 6:26640703-26640725 CAGGCACTTTTCTGAGTGCTGGG - Intronic
1005977604 6:30812094-30812116 CAGGCCCTGTTTTCAGTTCTAGG - Intergenic
1006240081 6:32670052-32670074 ATGGCCTTGAGCTGAGTTCTTGG - Intergenic
1006290383 6:33130915-33130937 CAGACCCTTTGCTGAGTGCTAGG + Intergenic
1006367542 6:33624297-33624319 CAGGCACTGTACTGGGTGCTGGG + Intronic
1006500326 6:34454708-34454730 CAGGCACTGTTCTAAGTGCTGGG - Intergenic
1006634877 6:35454919-35454941 CTGGCGCTGTGCTGAGTCCTAGG + Intronic
1006835699 6:36997665-36997687 CAGGCACTGTACTAACTTCTGGG + Intergenic
1006925444 6:37651831-37651853 CAGGCACTGTGCTAGGTCCTGGG - Intronic
1007132174 6:39485510-39485532 CAAGCCCTGTTCTAAGTGCTGGG - Intronic
1007167700 6:39840749-39840771 CAGGCTCTGTGCTGAGCACCAGG + Intronic
1007239240 6:40413372-40413394 CAGGCCCAGTGCTGAGTGGCAGG - Intronic
1007413555 6:41678996-41679018 CTGGCCCTGTGCTGGGTGCTGGG - Intergenic
1007428548 6:41762912-41762934 CAGGCACTGTGCTGAGTGCTGGG - Intergenic
1007995868 6:46307165-46307187 CAGGCACTGTGCTGGGTGCTGGG + Intronic
1008047847 6:46869616-46869638 TAGACCCAGTGCTGAGTACTGGG - Intronic
1008543999 6:52569778-52569800 CTGGGCCTGTGCTGAGCTCTGGG - Intronic
1008716993 6:54300661-54300683 CAGGCCCTATGCTATATTCTGGG - Intergenic
1008946962 6:57108790-57108812 CAGGCTCTGTGCTGATTGCAAGG + Intronic
1009566246 6:65314389-65314411 CAGGCACTATTCTGAGTGCTAGG - Intronic
1009857255 6:69280712-69280734 CAGGCATTGTGCTGAGGTTTTGG - Intronic
1010428871 6:75755768-75755790 CAGGCACTATTCTAAGTTCTAGG + Intronic
1011582279 6:88882419-88882441 CAGGTACTGTGCTAGGTTCTGGG - Intronic
1011775998 6:90731205-90731227 CAGGCACTTTGATGGGTTCTAGG + Intergenic
1012015590 6:93845749-93845771 CAGTCCCGGTGCTGGTTTCTGGG - Intergenic
1012076477 6:94692724-94692746 CAGGTCCTGTGCTTAGATCCAGG - Intergenic
1013006296 6:106077283-106077305 CAGGCACTGTGCTAAGGGCTGGG + Intergenic
1013611137 6:111796669-111796691 CAGGCCCTGTTCTGAGAGCTGGG + Intronic
1013613322 6:111816925-111816947 CAGACACTGTGCTAAATTCTGGG - Intronic
1014606590 6:123481619-123481641 CAGGTACTGTGCTAAGTTCTAGG - Intronic
1014779370 6:125545795-125545817 CAGACACTGTGCTTAGTGCTGGG - Intergenic
1015446518 6:133311811-133311833 CCGGCACTGTGCTGAGTACTGGG + Intronic
1015752394 6:136573612-136573634 AAGGGCCTATGCAGAGTTCTGGG + Intronic
1016021956 6:139245373-139245395 CAGGCCCTGGGCTGGGTACGAGG + Intronic
1016991853 6:149935614-149935636 CAGGCACTGTGCTAGGTGCTGGG - Intergenic
1017035816 6:150266279-150266301 CAGGCACTGTGCTGGGTGCTGGG - Intergenic
1017137117 6:151157700-151157722 CAGGCGCTGTGCTAAGCACTGGG - Intergenic
1017307686 6:152938303-152938325 CAAGCACTGTGCTGTGTTCAGGG - Intergenic
1017429306 6:154354903-154354925 CAGGCACTGTTCTGAGCACTTGG + Intronic
1017538406 6:155373295-155373317 CAGGCCCTGTTCTAAGCACTAGG + Intergenic
1017699976 6:157059619-157059641 CAGGCCCTGTGGAAAGCTCTGGG + Intronic
1017707930 6:157140983-157141005 CAGGCTCTGTGCTAAATGCTGGG - Intronic
1018229122 6:161658974-161658996 GAGGCCCAGTGCTGAGTCCCTGG + Intronic
1018480998 6:164190229-164190251 CAGGCCCTGGGTTGGGTTATAGG - Intergenic
1018486584 6:164246588-164246610 CAGGCCCTGTTCTAAGCACTGGG - Intergenic
1019034556 6:169043381-169043403 CAGGCTCAGTGCTGGGCTCTGGG + Intergenic
1019344856 7:524526-524548 CAGGCACTGTACTAAGTGCTGGG + Intergenic
1019362247 7:610912-610934 CAGAGGCTGTGCTGGGTTCTGGG + Intronic
1019372853 7:672077-672099 CAGGCTCCGTGCAGGGTTCTGGG - Intronic
1019603630 7:1897755-1897777 CTTGCCCTGTGCTGGCTTCTGGG + Intronic
1019656178 7:2197353-2197375 CAGGCCTGGTGCTGGGTGCTGGG - Intronic
1020020838 7:4867307-4867329 GAGGGCTTGTGCAGAGTTCTCGG - Intronic
1021404600 7:20250432-20250454 CAGGCACAGTGTTGAGTACTGGG + Intergenic
1021456036 7:20830552-20830574 CAGGTCCTGTGTTGAGTCCATGG - Intergenic
1021982267 7:26066242-26066264 CAGGCACTTTGCTGGTTTCTTGG - Intergenic
1022146437 7:27546753-27546775 CAGGCCCTGTGGTAAGCCCTTGG + Intronic
1022192766 7:28033133-28033155 CAGGCACTTTGCTTTGTTCTAGG - Intronic
1022455765 7:30556947-30556969 CAGGCCCTGGGCTGAGTGCTTGG - Intergenic
1022785095 7:33630875-33630897 CAGGCACTGTGCTTAGTGTTGGG + Intergenic
1022806302 7:33825846-33825868 CAGGCACTGTGCTGGGTGGTAGG + Intergenic
1022845601 7:34206719-34206741 CAGGCACTGTGCTGGGTTCTGGG - Intergenic
1023682891 7:42706050-42706072 GAGGCACTGTGCTAACTTCTTGG - Intergenic
1023912900 7:44568026-44568048 CAGCCCCTGTGCTTGGTGCTGGG - Intronic
1024604377 7:51012329-51012351 CAGACCCTGTGATGAGTGCTAGG - Intergenic
1024669341 7:51577810-51577832 CATGCCCTTCCCTGAGTTCTGGG + Intergenic
1024894534 7:54242697-54242719 CAGGCACTGTGCTAAGTTCAGGG + Intergenic
1026824588 7:73573528-73573550 CAGGTCCTGTGCTGGGTTCTCGG + Intronic
1027140543 7:75653929-75653951 CAGGCCCTATTTTGAGTGCTGGG + Intronic
1027192225 7:76003412-76003434 GAGGCTCTGGGCTGAGCTCTGGG - Intronic
1027221995 7:76220150-76220172 CAAGCCCTGTGCTGAGCACTAGG + Intronic
1027413904 7:77953284-77953306 CAAGCCCTGTGCTAGGCTCTGGG - Intronic
1027484778 7:78747786-78747808 CAGGCCCTGTGCTAACTCCCAGG - Intronic
1028002025 7:85510751-85510773 CAGGCACTGTTCTAAGTGCTTGG + Intergenic
1028167707 7:87557331-87557353 CAGGCACTGTGCTAGGTTCTAGG - Intronic
1028971713 7:96866437-96866459 CAGGCTCTATGCTGGGTACTTGG + Intergenic
1029068357 7:97874675-97874697 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
1029876838 7:103763366-103763388 CAGGTACTGTGCCAAGTTCTGGG + Intronic
1030082418 7:105789292-105789314 CAGGCACTGTGCTAGGTGCTGGG + Intronic
1030099612 7:105933901-105933923 CAGGCCCTCTGCTAAGCACTGGG + Intronic
1030687507 7:112502458-112502480 CAGGCCCTGTGCAGAGTGCTGGG + Intergenic
1030737546 7:113067484-113067506 CAGGCACTGTGCTGGATTTTAGG + Intergenic
1030937861 7:115608068-115608090 AAGTCCCAGTGCTGAGTTGTTGG - Intergenic
1032345528 7:131113003-131113025 CAGGTACTGTGCTGGGTGCTGGG + Intronic
1033157180 7:138967116-138967138 CAGGCACTGTGCTGGGCCCTTGG - Intronic
1033252485 7:139773072-139773094 CAGGCCCTGTGGCAGGTTCTGGG - Intronic
1033599224 7:142876925-142876947 CAAGCCCTGAGCTGAGATGTGGG - Intronic
1033639338 7:143246156-143246178 CATGCACTGTTCTGAGTGCTTGG - Intronic
1033663239 7:143418143-143418165 CAGGCACTGTTCTAAGTGCTGGG + Intergenic
1034075882 7:148230838-148230860 CAGGTACTGTGCTGGGCTCTGGG - Intronic
1034106566 7:148495650-148495672 CAGGCTATGCGCTCAGTTCTTGG - Intergenic
1034120747 7:148625362-148625384 CAGGCACTGTGCTGAAAGCTGGG + Intergenic
1034166270 7:149027712-149027734 CAGTCCCTGTACTGGGTTCTGGG - Intronic
1034569207 7:151941562-151941584 CAGCCCCAGTCCTGTGTTCTGGG - Intergenic
1034657667 7:152742155-152742177 CAGGCTCTGTGCTGGGTGCAGGG + Intergenic
1034745489 7:153520109-153520131 CAGGCACTGTGCTGAGTGATGGG + Intergenic
1034819402 7:154202833-154202855 CAGGTTCTGTGCTTAGCTCTGGG - Intronic
1035208325 7:157309452-157309474 CAGCCCCTGTGACGAGTGCTGGG - Intergenic
1035783185 8:2244531-2244553 CAGGCCCAGTGCTGAGGCTTAGG + Intergenic
1035913956 8:3598612-3598634 CAGGAACTGTACTGAGCTCTTGG - Intronic
1036250682 8:7159827-7159849 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
1036366807 8:8127627-8127649 CAGGCACTGTGCTGTGTTGCGGG + Intergenic
1036482384 8:9150667-9150689 CAGGGCCTGGGCTGGGTTCCCGG + Exonic
1036625338 8:10466642-10466664 CAGCCCTTGTGCTCATTTCTTGG + Intergenic
1036713912 8:11102343-11102365 CAGGCACTGTTCTGGGCTCTTGG - Intronic
1036759516 8:11497572-11497594 CAGGCACTGCGCTGGGTGCTGGG - Intronic
1036884073 8:12538034-12538056 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
1037407755 8:18562149-18562171 CAGGCACTGTGCTGGGTGCTGGG + Intronic
1037581589 8:20248916-20248938 GAGGCCCTGGGCTGGGTGCTGGG - Exonic
1037734280 8:21554522-21554544 CAGGCCCTGTGCTAGGTTTTGGG - Intergenic
1037822162 8:22140263-22140285 CAGGCCCCATGCTGACCTCTGGG - Intronic
1037890013 8:22619084-22619106 CAGGCCCTGCCCTGTGCTCTGGG + Intronic
1037994290 8:23341325-23341347 CAGGCCCTGCAGTGAGCTCTGGG + Intronic
1038419347 8:27422411-27422433 AGGGCGCTGTGCTGAGCTCTGGG + Intronic
1038532776 8:28331858-28331880 CACACACTGTGCTGAGTGCTGGG - Intronic
1038639014 8:29309040-29309062 CAGGCACTGGCCTGAGATCTAGG + Intergenic
1038941599 8:32311730-32311752 CAGGCATTGTGCTAGGTTCTGGG - Intronic
1039088485 8:33803111-33803133 CATGCCCTCTGCTCACTTCTGGG - Intergenic
1039097986 8:33907659-33907681 CAGGCTCTGTGCTAAGCGCTAGG - Intergenic
1039425048 8:37478627-37478649 CAGGCACTGTGCTAGGTACTGGG + Intergenic
1039777780 8:40753604-40753626 CAGGCAGTGTGCTGATTGCTGGG - Intronic
1039949948 8:42162545-42162567 CAGGCACTGTGCTGGGTACTGGG + Intronic
1040035136 8:42862805-42862827 CAGGCACTCTGCTTAGTGCTAGG + Intronic
1040563638 8:48546458-48546480 CAGGCCCTGTGCTGAATGCTAGG - Intergenic
1040575397 8:48647232-48647254 CAGGCGCTATGTTGAGTGCTGGG - Intergenic
1040723931 8:50358103-50358125 CAGGCTCTGTGCTGGGTGCTAGG + Intronic
1041261334 8:56022821-56022843 CAAGCCCTGTGCTGGGTGCTGGG + Intergenic
1042046886 8:64663332-64663354 CAAGCCCTGTGCTAAGAGCTTGG - Intronic
1042316867 8:67434966-67434988 CAGAGCCTGTGCTGAGGTCCAGG + Intronic
1042673300 8:71287772-71287794 CAGGCACTGTGCTTGGTGCTGGG - Intronic
1043438030 8:80253238-80253260 CAGGCACTGTGCTAGGCTCTGGG + Intergenic
1043704962 8:83337074-83337096 CTGGCACTGTGCTAAGTGCTAGG + Intergenic
1044218778 8:89645646-89645668 CAGGCCCTGTGCTAGGTGATAGG - Intergenic
1044929126 8:97234903-97234925 CAGGCCCTGTGCTATGCTCTGGG - Intergenic
1045285621 8:100788954-100788976 CAGGCCCTTTGCTGGCTCCTAGG + Intergenic
1045406004 8:101867381-101867403 CAGGCACTGTGCTAGGTCCTGGG - Intronic
1045554431 8:103201773-103201795 CAGGCTCTATGCTGGGTGCTGGG - Intronic
1046054953 8:109068253-109068275 AAGGCCCTGTAGTAAGTTCTGGG - Intergenic
1046752750 8:117942375-117942397 CAGCCTCTGTGCTAGGTTCTGGG - Intronic
1047170764 8:122490300-122490322 CTGGCCCTCTGCACAGTTCTGGG - Intergenic
1047306316 8:123655749-123655771 CAGGCCCTGTGCTGGGTGCTAGG - Intergenic
1047351397 8:124078121-124078143 CAGGCCCTGTCCTAGGTGCTAGG - Intronic
1047523270 8:125612031-125612053 CAGGCCCTGTTCTGGGCTCTGGG + Intergenic
1047552953 8:125896579-125896601 CAGACCCTTTGCTGAGTAATAGG + Intergenic
1047795560 8:128251650-128251672 CAGTCACTGTGCTAAGTTCCAGG - Intergenic
1047828950 8:128610888-128610910 CAGGCACTGTGCTAAGTTGTAGG + Intergenic
1048038198 8:130697792-130697814 CAGGCACTGTGCTAAATTCTAGG - Intergenic
1048066783 8:130978014-130978036 CAGGCCCTGTGCTCTGCACTGGG + Intronic
1048419990 8:134268648-134268670 CAGTTCCTGTGCTCAGTGCTGGG + Intergenic
1048487097 8:134858462-134858484 CAAGCTCTTTGCTGAGTGCTTGG - Intergenic
1048565982 8:135597670-135597692 CAGGCACTGTGCTGAGCACCGGG - Intronic
1048704502 8:137136426-137136448 CAGGCACTATGTTGAGTTTTGGG - Intergenic
1048791695 8:138110132-138110154 CAGACACTGTGCTGGGTTCTGGG + Intergenic
1048836332 8:138522382-138522404 CAGACCCTGGGCTGACTTTTAGG + Intergenic
1048853669 8:138668704-138668726 CAGGCCTAGTGCTGTGTGCTGGG + Intronic
1048881554 8:138876481-138876503 ATGGCCTTGTGCTGATTTCTGGG - Intronic
1049009304 8:139876613-139876635 CAGGCACTGTCCTCAGTGCTGGG - Intronic
1049031963 8:140044583-140044605 CAGGCTCTGTGCTGTGCCCTGGG - Intronic
1049058988 8:140261294-140261316 CAGGCGCTATGCTAGGTTCTGGG + Intronic
1049152255 8:141042616-141042638 CAGGCCCTGGGCTCAGCTCAGGG - Intergenic
1049245562 8:141560449-141560471 CAGGCTCTGTGCTGAGGGCAGGG + Intergenic
1049282377 8:141756705-141756727 CAGGCCCTGGGATGAGGCCTTGG - Intergenic
1049303358 8:141883604-141883626 CAGGCCCTCTGCTGAGGACTAGG + Intergenic
1049417767 8:142503359-142503381 CAGGCCCTGTACTGGGCACTGGG - Intronic
1049424309 8:142531321-142531343 CAGGCCCTGTGCCAAGTGCAGGG + Intronic
1049494061 8:142921520-142921542 CAGGCCCTATGCTGGGTGCAAGG + Intergenic
1049555748 8:143280963-143280985 CAGGCCCTGTGCTAGGTGCTGGG - Intergenic
1049558092 8:143293597-143293619 CAGGCCCTGCTGTGAGGTCTGGG + Intronic
1049604636 8:143523640-143523662 CAGACCCTCTGCTGCATTCTAGG + Intronic
1049700210 8:144007556-144007578 CGGGGCCTGTGCTGAGCTCTGGG + Intronic
1050064356 9:1743259-1743281 CAGTGCCTGTGCTGAGTTTGGGG + Intergenic
1050183011 9:2940818-2940840 CAGGCACTGTTCTGGGTGCTTGG + Intergenic
1050682110 9:8123783-8123805 CAGGCTCTGTGCTAAAGTCTGGG - Intergenic
1051484926 9:17597918-17597940 CAGGCTCTGTGCTGAGTTTTAGG + Intronic
1052273510 9:26652379-26652401 AAGGCCCTCTCCTGAGCTCTGGG - Intergenic
1052833279 9:33232624-33232646 CAGGCCCTGGGCAGAGCACTGGG + Intronic
1052862500 9:33445688-33445710 CAACCCCTGCCCTGAGTTCTCGG + Intronic
1052868337 9:33480145-33480167 CAGGCCCTGTGCTAATATCAGGG - Intergenic
1053108282 9:35432939-35432961 CAGGCCCTGTGCTAGGTCCTAGG - Intergenic
1053344226 9:37366116-37366138 CAGGTCCTGTGCTGACATCTAGG + Intergenic
1053354432 9:37434048-37434070 CAGGCCGTGAGCTGAATTCCAGG - Intronic
1053422048 9:37985871-37985893 CAGGCACTGTCCTGTGTCCTGGG + Intronic
1053462338 9:38280588-38280610 CAGGCCCTGTCCTAGGTACTGGG + Intergenic
1053644697 9:40113465-40113487 CAGGCCCTGTGTTGACTACCTGG - Intergenic
1053761287 9:41351386-41351408 CAGGCCCTGTGTTGACTACCTGG + Intergenic
1053912340 9:42920385-42920407 AAGGCCCTTTGCTAATTTCTTGG - Intergenic
1054325717 9:63711345-63711367 CAGGCCCTGTGTTGACTACCTGG - Intergenic
1054539879 9:66262504-66262526 CAGGCCCTGTGTTGACTACCTGG + Intergenic
1054865300 9:69994207-69994229 CAGGCACTGTGCTTGGTTCAAGG - Intergenic
1055003409 9:71479325-71479347 CAGGCACTGAGCTAAGTACTAGG - Intergenic
1055017185 9:71631460-71631482 CAGGGCCTGTGCTCGGTCCTGGG - Intergenic
1055056142 9:72025972-72025994 CAGGCACTGTGCTAAATGCTGGG - Intergenic
1055341605 9:75290410-75290432 CAGGCACTGGGCTGGGTGCTGGG - Intergenic
1055600111 9:77907789-77907811 CAGGCCCTTTGCTAGGTCCTGGG + Intronic
1055964202 9:81849644-81849666 CAGGCACTGTGCTGGGCTCTGGG + Intergenic
1055989821 9:82093587-82093609 AAGGCACTGTGCTAACTTCTGGG + Intergenic
1056315754 9:85388270-85388292 TAGGCTCTGTACTGGGTTCTGGG + Intergenic
1056602184 9:88054960-88054982 CGGGCCCTGTGCTCGGCTCTGGG - Intergenic
1056667799 9:88595554-88595576 CAGGCACTCTGCTGTCTTCTAGG - Intergenic
1056959900 9:91114001-91114023 CAAGCCCTGTGCTGAGTGCCTGG + Intergenic
1057047633 9:91898320-91898342 CTGGCACTGTGCTTAGTGCTGGG + Intronic
1057183544 9:93042826-93042848 CAGGCCATGTGCTGAGGTTCTGG - Intergenic
1057570183 9:96198418-96198440 CAGGCCTTGTCCTAAGTGCTGGG + Intergenic
1057704161 9:97385976-97385998 CGGGCACTGTGCTGCGTGCTTGG + Intergenic
1057833440 9:98425497-98425519 CACGCACTGTGCTGGGCTCTAGG + Intronic
1057900252 9:98943145-98943167 CAGGCCCTGTGATGAGATGTGGG - Intergenic
1057902531 9:98960737-98960759 CAGGCACTGTGCTAAGAGCTTGG - Intronic
1057973482 9:99579510-99579532 CAGGCACTGTTTTGAGTGCTAGG + Intergenic
1058482743 9:105413697-105413719 CAGGCACTATGCTAAGTCCTAGG + Intronic
1058704325 9:107626227-107626249 CACGCCTTGTGCTGGGCTCTGGG + Intergenic
1058763187 9:108156463-108156485 AATGCCCTGTGCTGATATCTTGG - Intergenic
1058878265 9:109262950-109262972 CAGGCCCAGTGCTTAGCTTTGGG - Intronic
1058952691 9:109918175-109918197 CAGGCACTATGCTGAGCACTGGG - Intronic
1059142138 9:111863800-111863822 CAGGCCCTGTGCTCAAAGCTTGG + Intergenic
1059325132 9:113499639-113499661 TGGGCCCTGTGCTGGGTGCTGGG + Intronic
1059353780 9:113684474-113684496 CAGGCCCTGTGCGAAGCACTGGG + Intergenic
1059399887 9:114062204-114062226 CAGGCCCTGTGCTGGGCACTAGG - Intronic
1059528215 9:115012895-115012917 CAGGCTCTGTTCTGGGTGCTAGG + Intergenic
1059534860 9:115071121-115071143 CATGCTCTGTGCTAAGTTCTGGG - Intronic
1059578329 9:115516355-115516377 CATGCCTTGTGCTAAGTGCTAGG - Intergenic
1059945149 9:119402053-119402075 CCAGCTCTGTGCTGAGTGCTTGG - Intergenic
1060039411 9:120286842-120286864 CAGGCACTATGCTGGGTGCTGGG - Intergenic
1060150532 9:121285467-121285489 CCAGCCTTGTGCTGAGTGCTGGG - Intronic
1060153757 9:121304820-121304842 CAGGCCCTGTGATGGGTGCTGGG + Intronic
1060235874 9:121862391-121862413 CAGGCACCATGCTGGGTTCTTGG - Intronic
1060281402 9:122218205-122218227 CAGGCCCTGGGCTGACTTCTGGG - Intronic
1060300988 9:122374488-122374510 CTGGCCCTGTGCTGAGTATGGGG + Intronic
1060393950 9:123302629-123302651 CAGGCCTTGAGCTGTGTTGTGGG - Intergenic
1060400206 9:123344233-123344255 CAGGCCCTGTGCTAGATGCTGGG - Intergenic
1060517600 9:124275727-124275749 CAGGCCCTGGGCTGAGCACTGGG - Intronic
1060527874 9:124330686-124330708 CTGGCCCTGGGCTGTGTGCTGGG + Intronic
1060547980 9:124471760-124471782 CAGGCACTGTGCTGGGTGCCAGG + Intronic
1060766942 9:126301424-126301446 CAGGCTCTGTGTTGAGTGATTGG - Intergenic
1060774639 9:126364013-126364035 CAGGCCCTGTGCTGGGTACTGGG - Intronic
1060940961 9:127542576-127542598 CAGGCCCTTGGCTGGGTCCTGGG + Intronic
1060999472 9:127894944-127894966 CAGGCCCTGCCCTGGGATCTAGG - Intronic
1061026300 9:128051945-128051967 CAGGCCCTGTGCAGGGCTCTGGG + Intergenic
1061054710 9:128216177-128216199 CGGGCCCTGTGCCGGGCTCTGGG - Intronic
1061091119 9:128427067-128427089 CAGGCTCTGTGCTCAATGCTGGG + Intronic
1061159646 9:128885897-128885919 CAGGCCCTTGGCTGGGCTCTGGG - Intronic
1061191026 9:129082789-129082811 CAGGCCCTGTGCTGGGCTTGGGG + Intronic
1061294539 9:129669755-129669777 CAGGCCCTGAGCTGAGCCCTGGG - Intronic
1061485079 9:130916417-130916439 CGGGCCCTGTGCTAGGATCTCGG + Intronic
1061571142 9:131478068-131478090 CAGGCCCTGGGCTGGGTTCTGGG + Intronic
1061618026 9:131792887-131792909 CAGGCCCTGTGCTAGGCTCTGGG - Intergenic
1061824952 9:133252287-133252309 CAGGCCCTTTCCTGTGTCCTCGG - Intronic
1061838337 9:133343497-133343519 CAGGCCCCGTGCTGGGTCCCAGG - Intronic
1061970930 9:134045110-134045132 CAGGCTCTGAGCTGGGTTCCAGG - Intronic
1062318669 9:135980006-135980028 CGGCCCCCGTGCTGAGTTCACGG + Intergenic
1062326943 9:136017037-136017059 CAGTCCCAGGGCTGTGTTCTTGG - Intronic
1062342655 9:136100632-136100654 GAGGCCCTGTGCAGTGTCCTGGG - Intergenic
1203638029 Un_KI270750v1:132085-132107 CAGACACTGTGCTGGGCTCTCGG + Intergenic
1186508321 X:10111427-10111449 CAGCCCAGGTGCTGAGTCCTGGG + Intronic
1186897512 X:14019046-14019068 AAAGCCCAGTGCTCAGTTCTTGG + Intronic
1187159404 X:16750480-16750502 CAGGCGCTATGCTGGGTGCTGGG - Intronic
1187218565 X:17300867-17300889 CAGGGCCTGTGCTGAACACTGGG + Intergenic
1187304379 X:18082032-18082054 CAGGCGCTGTGCTAAGTACGGGG - Intergenic
1188276107 X:28203068-28203090 CAGGCACAGTGCTAAATTCTAGG + Intergenic
1188358198 X:29219343-29219365 CAGGCCCTGTGCTAGGACCTGGG + Intronic
1188682033 X:33020995-33021017 CAGACAGTGTGCTAAGTTCTGGG - Intronic
1189298207 X:39933964-39933986 CAGGCTCTGAGCTGGGTCCTGGG - Intergenic
1189358240 X:40327734-40327756 CAGGCCTTCTGCTGACTGCTGGG - Intergenic
1189755795 X:44270169-44270191 CAGGCACTGTGCTATGTTTTGGG - Intronic
1189759208 X:44304220-44304242 CAGGGTCTGGGCTCAGTTCTAGG + Intronic
1190407931 X:50106020-50106042 TAGGCACTGTGCTGAGTGCTGGG + Intergenic
1190449590 X:50565282-50565304 CAGACCCTGTGCTAGGTGCTGGG - Intergenic
1190469706 X:50766053-50766075 CAGGCCTTGTGGTGGGTCCTAGG - Intronic
1190752425 X:53373762-53373784 CAGGCCCTGTGCTAGGTTCTGGG - Intergenic
1190931034 X:54949966-54949988 GTGGCCCTGTGCTGGGTGCTGGG + Intronic
1192157240 X:68755780-68755802 CAGGCCCAGTCCTGGGCTCTGGG + Intergenic
1192173503 X:68871739-68871761 CAGACCCTGTGCAGTGTGCTGGG + Intergenic
1192225865 X:69227433-69227455 CAGGCCCTCTGCTAGGTGCTGGG + Intergenic
1192317536 X:70064333-70064355 AAGGCCTTTTGCTGAGTTTTGGG + Intergenic
1192322905 X:70106479-70106501 CAGGCACTGTGCTAACTGCTGGG - Intergenic
1192340467 X:70259570-70259592 CAGGACCTGGGCTGAGGCCTAGG + Exonic
1192478091 X:71460920-71460942 CAGGCACTGTGCTAGGCTCTGGG + Intronic
1192534709 X:71917516-71917538 CCTGCCCTGTGCTGATTTCTGGG + Intergenic
1192544066 X:71998173-71998195 CAGGCCCTGAGCTGAGAGCTGGG + Intergenic
1192588395 X:72339290-72339312 TAGGCCCTGTGCTGGGTGCTGGG + Intronic
1192656833 X:73002367-73002389 CAGGCCCTGTTCCCAGTCCTGGG + Intergenic
1192665287 X:73080634-73080656 CAGGCCCTGTTCCCAGTCCTGGG - Intergenic
1192773781 X:74221094-74221116 CAGGCACTGTGCTGGGTAGTGGG - Intergenic
1193486005 X:82086255-82086277 CAGCCCCTTTGCTGAGCTCATGG + Intergenic
1193761687 X:85474818-85474840 CAGGCACTGTGCTAGGTACTGGG - Intergenic
1193872581 X:86819328-86819350 CAGGCCCTCAACTGAGTTATAGG - Intronic
1194694694 X:97031622-97031644 TAGGCACTGTGCTGAATGCTAGG + Intronic
1195461082 X:105125243-105125265 CAGGCACTGTGCTAAGTTCTGGG - Intronic
1195653823 X:107315179-107315201 CAGGCACTATGCTAAGCTCTGGG + Intergenic
1195928298 X:110048431-110048453 CAGGCACTATGCTAAGTGCTGGG - Intronic
1195996985 X:110741479-110741501 CTTGCACTGTGCTGAGTTCAGGG - Intronic
1196174926 X:112629999-112630021 CAGATTCTGTGCTAAGTTCTGGG - Intergenic
1196254742 X:113503793-113503815 CAGGCACTGTTCTGGGGTCTGGG + Intergenic
1196759745 X:119190487-119190509 CTGGCCCTGTGCTGTGTCCCAGG + Intergenic
1197081349 X:122421670-122421692 CAGGCCAGGAGCTGATTTCTGGG - Intergenic
1197228856 X:123981727-123981749 CAGGCACTGTGCTAAGCACTGGG + Intronic
1197458507 X:126708470-126708492 CAATCCCTGTGCTCACTTCTAGG - Intergenic
1197626957 X:128813014-128813036 CAGACACTGTGCTGGGTGCTGGG - Intergenic
1197715580 X:129703941-129703963 CAGGCTCTCTGCTGGGGTCTGGG - Intergenic
1197865130 X:131009439-131009461 CAGGCACTGTGCTAGGTCCTAGG + Intergenic
1198126470 X:133649059-133649081 CAGCCCCTATGCTCAGTGCTTGG + Intronic
1198225407 X:134640758-134640780 CAGGCACTGTGCTGGGCTCTAGG - Intronic
1198405099 X:136304563-136304585 CAGGCACTGTGCTAACTCCTGGG + Intronic
1198529135 X:137532500-137532522 TAGGCACTATGCTGTGTTCTGGG + Intergenic
1198587976 X:138143891-138143913 CAGGCTCTGTGCTAGGTCCTGGG + Intergenic
1198638904 X:138734092-138734114 CAGGCACTGTGCTAGCTTCTAGG - Intronic
1198675511 X:139126517-139126539 CAGGCCATGCCCTGTGTTCTGGG - Intronic
1198738898 X:139819852-139819874 CAGGCACTGTGTTGAGTGTTGGG - Intronic
1199297618 X:146176905-146176927 CATTCCCAGTGCTGACTTCTGGG - Intergenic
1199767619 X:150952582-150952604 CAGGCACTGAGCTGAGCCCTGGG - Intergenic
1199783452 X:151083420-151083442 CAGGCACATTGCTGGGTTCTGGG + Intergenic
1199848319 X:151707448-151707470 CAGGCTCTGTGCTGTGTTCTAGG - Intergenic
1200042261 X:153379154-153379176 CAGGCACTATGCTGGGTGCTGGG - Intergenic
1200121317 X:153792227-153792249 CAGGTACTGTGCTGGGTCCTAGG - Intronic
1200296126 X:154922416-154922438 CAGGCACTGTTCAAAGTTCTGGG + Intronic
1200361782 X:155614157-155614179 CAGGCACTGTACTAAGATCTGGG + Intronic
1200385154 X:155882822-155882844 TAGGCACTGTGCTGAGCACTGGG + Intronic
1201151030 Y:11095780-11095802 CAGGCCCTGTGTTGACTACCTGG + Intergenic
1201756693 Y:17494133-17494155 CAGCACCTGTGCTGTGTTATGGG - Intergenic
1201844860 Y:18411851-18411873 CAGCACCTGTGCTGTGTTATGGG + Intergenic