ID: 1085084321

View in Genome Browser
Species Human (GRCh38)
Location 11:73656631-73656653
Sequence CCAGGCCCTGTGCTGAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1433
Summary {0: 1, 1: 4, 2: 41, 3: 274, 4: 1113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085084321_1085084330 -5 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084321_1085084333 0 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084333 11:73656654-73656676 CATGGGGTGGGTGGCAGGAGGGG 0: 1
1: 0
2: 11
3: 130
4: 927
1085084321_1085084331 -2 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084331 11:73656652-73656674 GGCATGGGGTGGGTGGCAGGAGG 0: 1
1: 0
2: 42
3: 314
4: 2064
1085084321_1085084334 1 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084334 11:73656655-73656677 ATGGGGTGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 39
3: 440
4: 3158
1085084321_1085084328 -9 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084328 11:73656645-73656667 AGGGCCTGGCATGGGGTGGGTGG 0: 2
1: 158
2: 979
3: 3064
4: 7190
1085084321_1085084332 -1 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084332 11:73656653-73656675 GCATGGGGTGGGTGGCAGGAGGG 0: 1
1: 0
2: 7
3: 122
4: 1021

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085084321 Original CRISPR CCAGGCCCTGTGCTGAGTTC TGG (reversed) Intronic
900402636 1:2478861-2478883 CCCAGCCCTGTGCTGAGTGCTGG + Intronic
900502201 1:3011807-3011829 GCAGGCCCTGGGCTGTGTCCTGG - Intergenic
900668277 1:3830989-3831011 CCAGGCACTGTGGTGAGTGCTGG + Intronic
900778247 1:4600471-4600493 CTAGGCCCTGTGATGGGTCCTGG - Intergenic
900778305 1:4600753-4600775 GCAGGCCCTGTGCAGGGCTCCGG - Intergenic
900791187 1:4681920-4681942 CCAGGTGCTGCTCTGAGTTCTGG + Intronic
901079245 1:6574555-6574577 CCTGGCCCTGTGCTGGGTGTGGG - Intronic
901208045 1:7508573-7508595 CCAGGCACAGTGCTGGGTGCTGG - Intronic
901239765 1:7686144-7686166 CCAGGCACTGTTCTGGGCTCTGG + Intronic
901665102 1:10821605-10821627 CCAAGCCCTGTGTTGAGTGCTGG + Intergenic
901733449 1:11296924-11296946 CCAGGCACTGTGCTGAGTACTGG - Intergenic
901803022 1:11720103-11720125 CCAGGCACTGTGCTAAGTGCTGG + Exonic
902243172 1:15102030-15102052 CCAGGCGCTGTGCTCAGTGCAGG + Intronic
902248781 1:15139853-15139875 CCAGGCCCTGTGCAGTCTGCGGG - Intergenic
902334611 1:15747741-15747763 CCAGGGCCTGTGCTGAGCTCTGG - Exonic
902386680 1:16079846-16079868 CCAGGCCCTGTCCTGAGCACTGG + Intergenic
902403393 1:16170348-16170370 CCAGGGCCTGAGCTGAGTACTGG - Intergenic
902545806 1:17189731-17189753 CCAGGCCCTGTGCTGGGTGCTGG + Intergenic
902575611 1:17375342-17375364 CCAGGCCATGTGCCGAGTCTAGG - Intronic
902644577 1:17789537-17789559 CCTGGCACTGTGCTAAGTGCTGG - Intronic
902718066 1:18286341-18286363 CCAGGCACTGTGCTAGGCTCTGG + Intronic
902719270 1:18293200-18293222 CCAGGCCCTGGGCTGAGAGCTGG - Intronic
902719724 1:18295932-18295954 CCAGGCCCTGGGCTGAGAGCTGG - Intronic
902730942 1:18368564-18368586 CCAGGCCCTGTACTAAGTGCTGG + Intronic
902753939 1:18536971-18536993 CCAGGCCCTATGCTGGGCACTGG + Intergenic
902819621 1:18936054-18936076 CCAGGCTCTGTGCTGGGCACTGG - Intronic
903009935 1:20322521-20322543 CTAGGCCCTGTGTTAAATTCTGG + Intronic
903070602 1:20725265-20725287 CCAGGCCATGTGCTGGATACTGG - Intronic
903252610 1:22067031-22067053 CCAGGCTCTGTCCTGCCTTCAGG - Intronic
903277948 1:22233489-22233511 CCTGGCCCTGAGCTGAGCTCCGG - Intergenic
903547582 1:24136274-24136296 CCAGGCACTATGCTGAGGGCTGG + Intronic
903568957 1:24290195-24290217 CCAGGCCCTGTGCTGAGTATGGG - Intergenic
903604705 1:24567209-24567231 GCAGGCCTTGTGCTGGGTGCTGG + Intronic
903670379 1:25031765-25031787 CCAGGCACTGGGCTGGGTTCAGG + Intergenic
903814725 1:26056709-26056731 CCAGGCACTGTGCTAGGCTCTGG + Intronic
903835050 1:26198239-26198261 CCAGGCCCTTTGGTGAAGTCGGG + Intronic
903917197 1:26773256-26773278 CCAGGCCCTCTTCAGAGTTCAGG - Intronic
903995378 1:27302189-27302211 CCAGGCACTGTGCTGGGTCCTGG + Intronic
904133239 1:28290853-28290875 TCAGGCCCTGTGCTAGGCTCTGG - Intergenic
904272373 1:29358579-29358601 CCAGGCTCTGTGCTGGGTACTGG + Intergenic
904282697 1:29432542-29432564 CCAGGCACTGTGCTGGGAACTGG + Intergenic
904292937 1:29499311-29499333 CCAAGCCCTGTGCTCAGTTCTGG - Intergenic
904300220 1:29549364-29549386 CCAGGCCCTGTGCTTAGCCCTGG + Intergenic
904300646 1:29551274-29551296 CCAGGCCCTGTGCTGGGCACTGG - Intergenic
904440750 1:30527939-30527961 CCAGGCCATGTGCAGGGCTCTGG + Intergenic
904453643 1:30633153-30633175 CCAGGCCCTGTGCAAGGTGCAGG + Intergenic
904457558 1:30656769-30656791 CCAGGCCCTGTGCTGGGCACTGG + Intergenic
904458016 1:30658751-30658773 CCAGGCCCTGTGCTTAGCCCTGG - Intergenic
904562961 1:31411089-31411111 CCAGGCCCTGTACTGTGCTCTGG + Intronic
904585968 1:31580813-31580835 ACAGGCACTATGCTGAGCTCAGG + Intronic
904595134 1:31639420-31639442 CCAGGCACTGTGCTGGGCCCTGG - Intronic
904650571 1:32002848-32002870 CCAGACACTGTGCTCAGTCCTGG - Intergenic
904682505 1:32239407-32239429 GCAGCCCCTGTGCTCAGTGCTGG + Intergenic
904808747 1:33149892-33149914 CCAGGCCCTGGGCTGGGCTCTGG - Intronic
904890861 1:33778571-33778593 CCAGGGACTGTGCTAAGTGCCGG - Intronic
904902191 1:33866233-33866255 CCAGGCCATTTGCTGGGTACAGG + Intronic
904946143 1:34200101-34200123 CCAGGCCTTGACCTGAGTGCTGG - Intronic
905171512 1:36112585-36112607 CCAGGTGCTGGGCTGAGTTTTGG - Intronic
905222318 1:36456954-36456976 CCAGACACTGTGCTGAGATATGG + Intronic
905242142 1:36588257-36588279 CCAGGCCCTGAGCTGGGGCCTGG - Intergenic
905261705 1:36723591-36723613 GCAGGCACTGTGCTAGGTTCTGG + Intergenic
905336353 1:37247414-37247436 CCAGGCCCTCTGCTGGGATGAGG + Intergenic
905404238 1:37722555-37722577 CCAGGCCCTGTGAGGAGTGCTGG + Intronic
905447662 1:38037770-38037792 CCTGGCCCAGTCCTGAGTCCTGG + Intergenic
905485512 1:38293014-38293036 CCAGGCCCTGGGCTGGGGGCTGG - Intergenic
905645656 1:39623476-39623498 CCAGGCCCTGTGCTCAATGCTGG + Intergenic
905839051 1:41158219-41158241 CAAAGCACTGTGCTGAGTGCTGG + Intronic
905918778 1:41705041-41705063 CCAGGCACTGTGCGAGGTTCTGG + Intronic
905967522 1:42111793-42111815 CCAGGTCTTGTGCTAAATTCTGG + Intergenic
906033376 1:42736795-42736817 CCAGGCCCTGTGCTGGGTCCTGG - Intronic
906046914 1:42838283-42838305 CCAGTCCCTGTGCTAAGGGCCGG - Intronic
906199645 1:43951201-43951223 TTGGGCCCTGTGCTGAGCTCTGG + Intronic
906209420 1:44003865-44003887 CCCGGGCCTGTGCTAAGTGCTGG + Intronic
906211750 1:44016114-44016136 CCAGGCCCTGGGGTGAGTGATGG + Intronic
906216287 1:44042929-44042951 TGAGGCCCCGTGCTGTGTTCAGG + Intergenic
906255673 1:44348005-44348027 CCTGGTCCTGTGCTGGGTGCTGG - Intronic
906512443 1:46418164-46418186 CAAGGCACTGTGCTGGGTGCTGG + Intergenic
906513718 1:46425798-46425820 TCTTGCCCTGTGCTGAGCTCTGG + Intergenic
906609923 1:47194272-47194294 TCAGGCACTGTGCTCAGTACTGG - Intergenic
906642888 1:47452107-47452129 CCAGGCCTTGTGCTGTGTACTGG - Intergenic
906730844 1:48079842-48079864 CCAGGCCCTGTGCTAGGGGCTGG + Intergenic
906781377 1:48575880-48575902 CCAGGCCCTATGCTGGTTTCTGG - Intronic
906800922 1:48736110-48736132 CCAGACCCTGGGCTGAGCCCGGG - Intronic
906943135 1:50273255-50273277 CCAGGCTCTGAGCTAAGCTCTGG + Intergenic
907189230 1:52634373-52634395 CCAAGCCCTGTGGTGAGTGCTGG + Intronic
907221078 1:52907332-52907354 CCAAGCCCTGTGCTGGGTGCTGG + Intronic
907256396 1:53182395-53182417 CCATGCCGTGTGGTGAGTGCTGG + Intergenic
907333129 1:53684267-53684289 GCCAGCCCTGTGTTGAGTTCTGG - Intronic
907377271 1:54053921-54053943 TGAGACCCTCTGCTGAGTTCTGG + Intronic
907397169 1:54199253-54199275 CCAGGCACTGTTCTCAGTGCTGG + Intronic
907464716 1:54627503-54627525 CCAGGCACTGTGCTAGGCTCTGG + Intronic
907509938 1:54950486-54950508 CCAGGCTCTGTGCTGAGCACTGG - Intergenic
907667812 1:56448802-56448824 TCAGGCACAGAGCTGAGTTCTGG + Intergenic
907745507 1:57209068-57209090 CCAGGCCCTGTGCCAAGTGATGG - Intronic
907935663 1:59039954-59039976 CCAGGCTCTGTGCTAGGTCCTGG + Intergenic
907940506 1:59082899-59082921 CCAGACCCTGTGCTGGGTGTGGG - Intergenic
908368061 1:63447385-63447407 CCAGGCACTGTGCTAGGCTCTGG + Intronic
908403648 1:63793560-63793582 CCAGGCACAGTGCTGGGTGCTGG + Intronic
908406262 1:63816938-63816960 CCAGGCACTGTGCTGGGCACTGG + Intronic
908636536 1:66172935-66172957 CCAGGTACTGTGCTGGCTTCTGG + Intronic
908776814 1:67648650-67648672 CCACGCCCTGTGCTGGGGGCTGG + Intergenic
910563846 1:88621193-88621215 TTTGGCCCAGTGCTGAGTTCAGG - Intergenic
910698749 1:90049601-90049623 CCAGGCCCTGTGCTGTACACAGG - Intergenic
910700279 1:90066602-90066624 CCAGGTACTGTGTTGGGTTCTGG + Intergenic
910802945 1:91163585-91163607 CCAGGAACTGTGCCGAGTGCTGG + Intergenic
911445419 1:97985978-97986000 CCAGGCTCTGTGCTAGGTGCTGG + Intergenic
911676278 1:100661941-100661963 CCAGGCACTGTTCTGTGTACTGG - Intergenic
911696249 1:100893541-100893563 CCAGGCTCTGTGCTGGGTGCTGG - Intronic
912224681 1:107720046-107720068 CCAGGCCCTGTCGTGGGGTCGGG + Intronic
912366202 1:109135828-109135850 CCAGGCCCTGAGCTGGGTGGTGG + Intronic
912469651 1:109897662-109897684 CCAGGCCCTGTTCTGAGTGCTGG - Intergenic
912558371 1:110532354-110532376 CCTGGCACTGTGCTGGGTGCTGG + Intergenic
912580468 1:110716723-110716745 TCAGGCCCTGTGCTGGGTACAGG + Intergenic
912777052 1:112512281-112512303 CCAGGCACTGTTCTCAGTACTGG + Intronic
912866654 1:113263679-113263701 CTAGGCACTGTGCTGTGTACTGG - Intergenic
912869628 1:113292147-113292169 CCAGGCACTGTGCTAGGTACTGG - Intergenic
913082195 1:115399055-115399077 TCAGGCACTGTGCTAAGTGCTGG + Intergenic
913142410 1:115954691-115954713 CTAGGCCCTGTGCTAGATTCTGG + Intergenic
913441719 1:118905551-118905573 GCTGGCCCTGTGCTGGATTCTGG - Intronic
913697456 1:121341294-121341316 CCAGGCACTGTGCTGGGCACTGG + Intronic
914247719 1:145898135-145898157 CCAGGGCCTGTGCTGAATGAGGG - Exonic
914391418 1:147226322-147226344 CCATGCACTGAGCTGAGTGCTGG + Intronic
914858007 1:151366037-151366059 CTAGGCACTGTGCTATGTTCTGG - Intronic
915237554 1:154495704-154495726 CTAGGCCCTGTCCTGAGCTCTGG - Intronic
915291400 1:154886660-154886682 CCAGGCACTGTGCTGGGCTTGGG - Intergenic
915543442 1:156582862-156582884 CCTGGCCCCATCCTGAGTTCTGG - Intronic
915738703 1:158101562-158101584 GCTGGCCCTGTGCTGGGGTCTGG - Intergenic
915871139 1:159560722-159560744 CCAGGCCCTGTGCTAAGCACAGG + Intergenic
915997592 1:160579664-160579686 CCAGGCCCTCTTCTGGGTGCTGG + Intergenic
916181347 1:162086508-162086530 TCAGGCACTGTGCTAAGCTCTGG - Intronic
916259142 1:162822969-162822991 CCAGGCTCTGAGCCGAGTTGGGG - Intergenic
916624690 1:166542523-166542545 CCAGGGCCAATGGTGAGTTCTGG + Intergenic
916859012 1:168782519-168782541 CCAGGCACTGTAATAAGTTCTGG + Intergenic
918040895 1:180913181-180913203 CCAGGCCAGCTGCTGGGTTCGGG - Exonic
918363808 1:183785583-183785605 CCAGGTACTGTGCTGGGTGCTGG - Intronic
919106398 1:193156863-193156885 CCTGGCAGTGTGCTGAGTGCTGG + Intronic
919397382 1:197068459-197068481 TCACGCCCTTTCCTGAGTTCTGG - Intergenic
920051621 1:203167932-203167954 CCAGGCCCATTCCTGAGTTCTGG + Exonic
920086634 1:203422252-203422274 CCAGGCTCAGTTCTGACTTCTGG + Intergenic
920295974 1:204956663-204956685 CCAGGCACTGTGCTAGGTGCTGG - Intronic
920566615 1:206979208-206979230 CCAGGCACTTTGCTGGGTGCTGG + Intergenic
920611165 1:207439207-207439229 CTGGGCCCTGTGCTGAGTCTTGG - Intergenic
920673161 1:208020240-208020262 CCAGGGTCTGTGCTCTGTTCTGG + Intergenic
920849562 1:209619373-209619395 CCAGGCACTGTGCTGGGGTCTGG - Intronic
921129713 1:212209282-212209304 CCAGGAACTGTGCTAAGTGCTGG - Intergenic
921358879 1:214312342-214312364 CCAGGCACTGTTGTCAGTTCTGG + Intronic
921503926 1:215942863-215942885 CCAAGCACTGTGCTGAGTTGGGG + Intronic
921786695 1:219239327-219239349 CCAGGACCTGTGCTGGATTCTGG - Intergenic
922109248 1:222541483-222541505 CCAGGCACTGTCCTGAGTGCTGG + Intronic
922129402 1:222762125-222762147 CCAGGTTCTGTGCTGTGTGCTGG + Intergenic
922919902 1:229293594-229293616 CCAGGCCCTGTGCTAGGCACTGG + Intronic
923000823 1:230005100-230005122 CTGGGCCCTGTGCTGAGTGTTGG - Intergenic
923005748 1:230048322-230048344 CCAGGCCCTGGGATGATTTAAGG - Intergenic
923085944 1:230703730-230703752 CTGGGCCCTGTGCTCAGTGCTGG - Intronic
923201776 1:231719292-231719314 CCAAGCACTATGCTAAGTTCTGG - Intronic
923282233 1:232454973-232454995 CCAGGAACTGTGCTGAGCACTGG - Intronic
923322782 1:232852426-232852448 CCAGGCCTTATGCTAAGTGCTGG + Intergenic
923487916 1:234453850-234453872 CCAGGCACTGTGCTGAGTGTTGG - Intronic
923534881 1:234841438-234841460 CCAGGCAGTCTGCTGAGATCTGG - Intergenic
923603612 1:235424223-235424245 CCAGGCACTATGCTGATTGCTGG - Intronic
923726170 1:236507230-236507252 TCAGGCCCAGTGCTGAATTTTGG + Intergenic
923999501 1:239534976-239534998 CCAGGCACTGTGCTAGGTGCTGG + Intronic
924020210 1:239772966-239772988 CTAGGCTCTGTGCTGAGTGTGGG - Intronic
924077330 1:240353894-240353916 GCAGGCCCTGTGGGGAGGTCAGG + Intronic
924090542 1:240496675-240496697 CCAGGCACTGTTCTGAGAGCAGG - Intronic
924568263 1:245215612-245215634 CCAGGCCTTATGCTGGGCTCGGG + Intronic
1063672841 10:8113750-8113772 CCTGGCCCTGGGTTGAGTCCTGG - Intergenic
1064211115 10:13361242-13361264 CCAGGCACTGGGCTGGGTACTGG + Intergenic
1064247219 10:13678531-13678553 CCAGGCCCAGTGCAAAGTGCTGG - Intronic
1065278936 10:24115192-24115214 GCAGGTGCTGTGCTGAGTTTGGG - Intronic
1065414400 10:25468775-25468797 CCAAGCACTGTGCTAATTTCTGG + Intronic
1065555247 10:26908648-26908670 TCAGGCCTGGTGCTGAGATCAGG + Intergenic
1065595606 10:27308158-27308180 TCAGGCCTGGTGCTGAGATCAGG - Intergenic
1066202109 10:33151806-33151828 CCAGGCACTGTGTTCAGTTCTGG + Intergenic
1066648241 10:37632449-37632471 CCAGGCACTGTGCTAAGTACTGG - Intergenic
1066975655 10:42365942-42365964 CCCGGGCCTGTCCTGAGTTGGGG - Intergenic
1067751110 10:48971853-48971875 CCAGTCCCTTTGCTGAGATCAGG - Intronic
1067976104 10:51026601-51026623 CCAGGCTCTGTGCTGAGATGTGG + Intronic
1068009597 10:51431473-51431495 CCTGGCCCTGTGTTGATTTAGGG + Intronic
1068369026 10:56090087-56090109 CCAGGGCCTGTCCTGGGTTGGGG + Intergenic
1068548321 10:58377906-58377928 TCAGGACCTGTGCTTAGTTGAGG + Intergenic
1068744576 10:60515887-60515909 CCAGGCCCAGTGCTAAGTGCTGG + Intronic
1068847957 10:61702055-61702077 CCAGGACCTGTGCTGAGAGTTGG - Intronic
1069578465 10:69547374-69547396 CCAGGCCCTGTGCTCACTGCTGG + Intergenic
1069751683 10:70749062-70749084 CCAGGCCCTGTGCTGGGCTGAGG + Intronic
1069906810 10:71736726-71736748 CCAGGCACTAGGCTGGGTTCAGG + Intronic
1069954498 10:72041742-72041764 CCAGGCCCTGTGCTGGGTGTTGG - Intergenic
1070241676 10:74688389-74688411 CTAGGCACTGTGCTGGGTCCCGG - Intronic
1070517874 10:77225009-77225031 CCATGCTCTGTGCTGGGTGCTGG - Intronic
1070645079 10:78196204-78196226 CCAGGCACTGTGCCAGGTTCTGG - Intergenic
1070731539 10:78831867-78831889 CCAGGCACTGTGCTGGGAACAGG + Intergenic
1070778698 10:79125247-79125269 CCAAGCTCTGAGCTGAGGTCAGG - Intronic
1070948510 10:80412466-80412488 CCAGGATCTGTGTTGAGTGCTGG + Intronic
1070959652 10:80489668-80489690 CCAGGCCCTGTTTTAGGTTCTGG + Intronic
1071294785 10:84211726-84211748 CAAGGCCCTGTCCTGGATTCTGG - Intronic
1071438360 10:85667701-85667723 CTAGGGGCTGTGCTCAGTTCTGG - Intronic
1071453561 10:85823025-85823047 CCAGGGCCTGTCATGAGTTGCGG + Intronic
1071460405 10:85888361-85888383 ACAGGCTCTCTGCTCAGTTCTGG + Intronic
1071507599 10:86242085-86242107 CCAAGCCCCGTGCTAGGTTCTGG + Intronic
1071516091 10:86298818-86298840 GGAGGCCCGGTGCTGAGCTCTGG + Intronic
1071522330 10:86339110-86339132 CCAGGCACTGTGTTGGGTGCTGG - Intronic
1072234791 10:93444289-93444311 CCAGGCACTGTGCTAAGTGCTGG + Intronic
1072273559 10:93800812-93800834 CCAGGCATTGTGCTGAATTCAGG + Intergenic
1072553052 10:96493763-96493785 CCAGGCCCTGCGCTGGATGCTGG - Intronic
1072565531 10:96613838-96613860 CCAGGCACTGTGCTAAGCACTGG + Intronic
1072775275 10:98185257-98185279 CTAGGCCCTGTGCTCAGTGTTGG + Intronic
1072790826 10:98316514-98316536 CCAGGCACCGTGGTGAGTGCTGG + Intergenic
1072962803 10:99944611-99944633 CCAGGCACTGTGCTAAGGGCTGG - Intronic
1073513504 10:104057323-104057345 TCAGGCCCTGTGCTCAGTCCAGG - Intronic
1073962077 10:108943856-108943878 CCAGACCCTGTGCTAAGTGCTGG - Intergenic
1074197761 10:111204369-111204391 CCAGATGCTGTGCTCAGTTCTGG + Intergenic
1074443746 10:113500962-113500984 CCAAGCACTGTGCTGAGTTCTGG - Intergenic
1074462450 10:113650716-113650738 CCAGGCACTGTGCTGGGTATTGG - Intronic
1074844975 10:117389797-117389819 CGAGGCCCTGTGCTGAGTGCTGG - Intergenic
1074858294 10:117489788-117489810 CCAGGCCCTGAGCTCAGCTCTGG - Intergenic
1074878350 10:117632001-117632023 CCAGTCCCTCAGCTGGGTTCTGG + Intergenic
1075052858 10:119195702-119195724 CCAAGCACTGTGCTAAGTGCTGG - Intergenic
1075087602 10:119423942-119423964 CCTGGCACTGTGCTGGGTGCTGG + Intronic
1075090101 10:119439365-119439387 CCAGGCCCTGTTCTGCCTTCAGG + Intronic
1075103892 10:119524554-119524576 CCAGGCCCTGTCCTCGGTGCTGG + Intronic
1075250578 10:120867740-120867762 CAAGGTACTGTGCTGAGTGCTGG - Intronic
1075341725 10:121651612-121651634 CCAGGTTCTGTGCTGGGTCCTGG - Intergenic
1075352973 10:121742559-121742581 GCAGGCACTGTGCTGGGTACAGG - Exonic
1075652622 10:124139180-124139202 CCAAGCCCTCTGCTGGGTGCTGG + Intergenic
1075657302 10:124170471-124170493 CCAGGCACTGTGCTAGGCTCTGG - Intergenic
1075928470 10:126272764-126272786 CCAGGCCATGTGCTGCCTCCAGG + Intronic
1075960765 10:126566326-126566348 TCAGGCACTGTGCTAAGTCCTGG + Intronic
1076032677 10:127172814-127172836 CCAGGCACTGTGCCATGTTCTGG + Intronic
1076102087 10:127790690-127790712 CCACACACTGTGCTGAGCTCTGG - Intergenic
1076233127 10:128838470-128838492 CCAGGCCCTGTGCTAAATACTGG - Intergenic
1076336122 10:129707445-129707467 CATGGCCGTGTGCTGTGTTCAGG - Intronic
1076348359 10:129796378-129796400 CCAGGCACTGTTCTGGGGTCTGG + Intergenic
1076449507 10:130547029-130547051 CCAGGGCCTCTTCTGAGTGCTGG - Intergenic
1076568125 10:131412690-131412712 CCAGGCCCTCTCCTGGCTTCTGG - Intergenic
1076738925 10:132471578-132471600 CCAGGCCTTGTGCAGACCTCAGG + Intergenic
1076915696 10:133422263-133422285 CCAGGCCCTGTTCCGAGGCCTGG + Exonic
1077049274 11:559465-559487 CCAGGCCCCTAGGTGAGTTCTGG + Intronic
1077276757 11:1715079-1715101 CCTGGCTCTGTGCTTAGTCCAGG + Intergenic
1077330790 11:1983032-1983054 CCAGGCTCTGGGCTCTGTTCCGG - Intronic
1077594563 11:3520656-3520678 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
1077727161 11:4686104-4686126 GCAGGCACTGTGCTGAGTTTAGG + Intronic
1078093993 11:8285348-8285370 CCACGCCCTGTGCTGGGCACTGG + Intergenic
1078149730 11:8748362-8748384 CCAGGCTCTGTGCTGGGCACTGG - Intronic
1078570867 11:12456853-12456875 TCAGGCCCTGTGCTGTGTCCTGG - Intronic
1078731713 11:13981104-13981126 CCAGGCTCTGTGCTAGGTTCTGG + Intronic
1078759270 11:14238674-14238696 ACAGGCCATGGGCTGAGGTCAGG - Intronic
1078922070 11:15840108-15840130 CCAGGCGCTGTGCTCAGTGGTGG + Intergenic
1079041882 11:17066969-17066991 CCAGGCTCTGTGCTGGGCACTGG + Intergenic
1079369756 11:19840865-19840887 CCAGACACTGTGCTAAGCTCTGG + Intronic
1079626846 11:22626297-22626319 CCAGGCGCTATGCTGAATTCTGG + Exonic
1080298214 11:30754167-30754189 CAAGGCCCTGTGGTGAGTGTGGG - Intergenic
1080497279 11:32832190-32832212 CCAGGCCCCGTGCTGTGTGGTGG + Intronic
1080599252 11:33806663-33806685 CCAGGTGCTGTGCTGGGTGCTGG + Intergenic
1080639978 11:34152882-34152904 CCAGGCCTGGTGCTGAGCCCTGG - Intronic
1080827139 11:35857975-35857997 CCAGGAACTGTACTGAGTCCCGG - Intergenic
1080888717 11:36390008-36390030 CTAGGCCCTGTGCTAAGCCCTGG + Intronic
1081484564 11:43517549-43517571 CCAGGCACTATGCTGGGTGCTGG + Intergenic
1081535180 11:43991172-43991194 CCAGGCCCTGTTCTGAGCACTGG + Intergenic
1081547291 11:44080504-44080526 GCAGGCACTGTGCTAAGTGCTGG + Intronic
1081578136 11:44332448-44332470 GCTGGCTCTGTGCTGGGTTCCGG - Intergenic
1081582856 11:44364589-44364611 CCAGGCCCTATCCTGGGTGCTGG + Intergenic
1081685765 11:45041993-45042015 CCAGGCTCTGTGCTGGCTACAGG + Intergenic
1081736040 11:45404987-45405009 CCAGCCCTTGTGCTCAGTACTGG + Intergenic
1081846666 11:46245611-46245633 CCAGGCACTGGGCTGGGTACTGG - Intergenic
1082101676 11:48178012-48178034 CCAGGCCATGTGCTGGCCTCCGG - Intergenic
1082799789 11:57406174-57406196 TCAGGCCCTGTCCTGGGTGCTGG - Intronic
1082926550 11:58553598-58553620 TCAGGCCCTGTGCTGAGCATTGG + Intronic
1083140458 11:60717245-60717267 ACAAGCCCTGTGGTGATTTCAGG - Intergenic
1083188628 11:61033705-61033727 CCAGGCCCTCTTCTGCGTGCTGG - Intergenic
1083213590 11:61204505-61204527 TCAGGGCCTGTGCTGGGCTCAGG + Intronic
1083216473 11:61223341-61223363 TCAGGGCCTGTGCTGGGCTCAGG + Intronic
1083219355 11:61242167-61242189 TCAGGGCCTGTGCTGGGCTCAGG + Intronic
1083248029 11:61445079-61445101 CCAGGCCCTGTGCTGAGTAAGGG + Intronic
1083322748 11:61857363-61857385 CCAGGCCCAGCACTGAGTGCAGG - Intronic
1083614798 11:64021078-64021100 CCAGGCGCTGTGCTGAGAGCCGG - Intronic
1083615138 11:64022380-64022402 CCAGGCTCTGTGCTGATGGCGGG - Intronic
1083619063 11:64040081-64040103 CCAGGCACAGTGCTGGGCTCTGG + Intronic
1083782295 11:64924843-64924865 CCCGGCCCGGGGCTGAGTTGGGG + Exonic
1083998057 11:66281960-66281982 TCAGGCCCTGTGCTGAGCACTGG - Intronic
1084020425 11:66414013-66414035 CCAGGCCTTGTGCTGGATGCTGG + Intergenic
1084063229 11:66689054-66689076 CCAGGCCCTGTGGGGAGTGGGGG - Intronic
1084070654 11:66731818-66731840 CCAGGCACTGTGCTGGGATCTGG + Intergenic
1084192760 11:67506274-67506296 CCAGGCCCTGTGCTGCCCCCTGG + Intergenic
1084301166 11:68253632-68253654 CCAGGCCCTGGGCTGAGCTCTGG - Intergenic
1084475698 11:69387401-69387423 CCAGGCACTGTGCTAGGTGCTGG - Intergenic
1084479992 11:69414655-69414677 CCAGGCCCTGTTCTAGGCTCTGG - Intergenic
1084652709 11:70498555-70498577 CCAGACCCTGTGCTGGGCTCAGG - Intronic
1084855599 11:71983653-71983675 CCAGGCCCTGTGCTGAGTGCTGG + Intronic
1084934611 11:72580195-72580217 CCAAGCCCTGTGCCAAGTGCAGG + Intronic
1085084321 11:73656631-73656653 CCAGGCCCTGTGCTGAGTTCTGG - Intronic
1085280413 11:75326269-75326291 CCAGGCCCTGGGCTGCTTTCTGG - Intronic
1085287878 11:75375824-75375846 CCAGGCACTGCGCTGGGTGCTGG - Intergenic
1085316525 11:75548421-75548443 CCAGGCCCTGGGTTGGGTGCTGG + Intergenic
1085322980 11:75585908-75585930 CCAGGCTCAGTGCTGAGCACTGG - Intergenic
1085408297 11:76277042-76277064 GCAGGCCCTGTCCTGGGTTCCGG + Intergenic
1085482484 11:76834179-76834201 CCAGGCACTGTGGTGGCTTCAGG + Intergenic
1085515316 11:77108194-77108216 CCAGGCCCTGTGCTGGGTGCTGG + Intronic
1085521251 11:77140185-77140207 CCAGGCCCTGTGCTGGGTTGAGG + Intronic
1085525363 11:77160637-77160659 CCAGGCCCTGGGCTGGGTTCGGG + Intronic
1086344835 11:85885360-85885382 CCAGGCTCTGTGCTAAGTGCTGG + Intronic
1087043238 11:93821836-93821858 CCAGGCATTGTACTGGGTTCAGG - Intronic
1087179425 11:95127152-95127174 TCAGGCCTTGGGCTGGGTTCTGG + Intronic
1087855421 11:103086708-103086730 TCAGGCACTGTGCTGAGTGCTGG - Intronic
1088086080 11:105982031-105982053 CCAGGCACTGTGCTGGGTGCTGG - Exonic
1088118983 11:106345622-106345644 CCAGGCCCTATGCTAGGTTCTGG + Intergenic
1088352735 11:108908734-108908756 CCATGTACTTTGCTGAGTTCTGG + Intronic
1088384325 11:109236428-109236450 CCAGACCCTGTGCTTACATCTGG + Intergenic
1088458729 11:110060377-110060399 CCAGGCCCTTTACTGAGCACTGG + Intergenic
1088646974 11:111925365-111925387 CCAGGCTCTGTGCCATGTTCTGG - Intronic
1088668627 11:112119606-112119628 CCAGGCACTGTGCTGGGTCCTGG + Intronic
1088813355 11:113406130-113406152 CCAGGCTCTGTGCTGCGTCCAGG - Intergenic
1088847193 11:113678507-113678529 CCAGGCCCTTGGCAGAATTCTGG - Intergenic
1088851180 11:113704804-113704826 CCAGGCTCTGTGCTTAGCCCTGG - Intronic
1089052293 11:115556441-115556463 CCAGGCACTATGCTGAGTGCTGG - Intergenic
1089052434 11:115557367-115557389 GCAGGCCCTGTGCTAAAGTCTGG + Intergenic
1089077826 11:115752905-115752927 CCTGACCCTGTGTTAAGTTCTGG + Intergenic
1089104885 11:115994235-115994257 CCAGGCACTGTGCTAGGTCCTGG + Intergenic
1089108259 11:116033457-116033479 GCAGGCACTGTGCTTAGTGCTGG - Intergenic
1089163234 11:116455619-116455641 TCAGGCACTGTGCTGGGTGCTGG + Intergenic
1089321854 11:117631794-117631816 CCAGGCCCTGAGCTATGCTCTGG + Intronic
1089495096 11:118903814-118903836 CCCGGCCCTGGGTTCAGTTCTGG - Intronic
1089586405 11:119512513-119512535 CCAGGCTCTGAGCTGAGTGCTGG + Intergenic
1089591212 11:119541880-119541902 CCAGGCCCTATCCTGGGTCCTGG - Intergenic
1089600300 11:119610247-119610269 CCAGCCCAATTGCTGAGTTCTGG + Intergenic
1089659713 11:119977967-119977989 CCAGGCTCTGTGCTGGGCTGAGG + Intergenic
1089668390 11:120034704-120034726 CCAGGCCCAGTGCTGGGCTCTGG - Intergenic
1089948135 11:122498948-122498970 CCAGGCACTGTGCTGTGTACTGG + Intergenic
1089977507 11:122745307-122745329 CCAGGAACTGTGCTAAGTACTGG - Intronic
1090110963 11:123908524-123908546 CCAGGCACTGTTCTGAGTGTTGG + Intergenic
1090257705 11:125297341-125297363 CCAGGCCTTCTGCTAATTTCTGG + Intronic
1090627265 11:128618015-128618037 CCAGGCTCTGTGCTGTGTGTGGG + Intergenic
1090893132 11:130945255-130945277 TGAGGCCCTGGGCTGAGTTCTGG - Intergenic
1091100197 11:132864889-132864911 CCAGGCACTATGCTGAGAGCCGG + Intronic
1091255219 11:134178227-134178249 CCGGGCACTGCACTGAGTTCTGG - Intronic
1202813770 11_KI270721v1_random:38211-38233 CCAGGCTCTGGGCTCTGTTCCGG - Intergenic
1091648545 12:2292123-2292145 CCAGGCCTTGTGCTGGCTCCCGG + Intronic
1091750773 12:3020167-3020189 CCAGGCCCTGTTCTGGGAGCGGG + Intronic
1091828794 12:3534742-3534764 CCAGGCCCTGTGCTCAGAAAAGG - Intronic
1091831624 12:3554389-3554411 CCGAGCCCTGTGCTCAGTGCTGG + Intronic
1091887417 12:4026795-4026817 CCAGGCCCAGTGCTAAGTGATGG + Intergenic
1092252800 12:6910259-6910281 CCAGGCCTTGTGCTGTGTTTTGG + Intronic
1092326895 12:7542226-7542248 GCAGGCCCTGGCCTGATTTCAGG - Intergenic
1092420737 12:8329445-8329467 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
1092757265 12:11775385-11775407 GCAGGCCTTGTGATGAGTGCTGG + Intronic
1092801627 12:12173908-12173930 CCAGGTGCTCTGCTGAGTTGAGG + Intronic
1093060456 12:14597243-14597265 TCAGGTCCAGTGCTGAGTTCAGG + Intergenic
1093149165 12:15601598-15601620 CAAGACCCTTTGCAGAGTTCTGG + Intergenic
1093501903 12:19823010-19823032 CCAGACCCTGTGCTAGGTGCTGG + Intergenic
1094070982 12:26412525-26412547 CCAGGCCCAGAGCTGAGGCCTGG + Intronic
1094466923 12:30763177-30763199 CCTGGCCCTGTGATGATTTAGGG + Intergenic
1094834849 12:34317505-34317527 GCAGCCCCTGTGCAGAGTCCCGG - Intergenic
1095287947 12:40438710-40438732 CCAGGCCTTGTGCTGAGTGCTGG + Intronic
1096002457 12:48141088-48141110 CCAGGCACTGTGCTGAGCTTTGG - Intronic
1096072147 12:48781411-48781433 CCAGGCGCTGTGCTGATGGCGGG + Intronic
1096103086 12:48981041-48981063 CCTGGGCCTTTGCTGAGGTCCGG + Intronic
1096228243 12:49882809-49882831 CCAGGCCCTGTTCTGGGCACTGG + Intronic
1096523993 12:52199925-52199947 CCAGGCACCGTGCTCAGTGCTGG - Intergenic
1096607075 12:52774675-52774697 GCAGGCTCTGTGCTGGGCTCTGG - Intronic
1096762668 12:53855492-53855514 CCAGGTGCTGTGCTAGGTTCTGG + Intergenic
1097288154 12:57893450-57893472 CCAGGTCCTGGGCTGAGTGTGGG + Intergenic
1097338276 12:58409046-58409068 CCAGGCACTGTGTTAAGTTTTGG + Intergenic
1097413242 12:59282060-59282082 CCAGGCACAGTGCTGAATTTTGG + Intergenic
1097706101 12:62869989-62870011 CCAGGCCCTGTGTTGGGTACTGG - Intronic
1097941537 12:65312774-65312796 CCAGGCACTGTGTTAAGCTCTGG - Intronic
1098364453 12:69687939-69687961 CCAGGCACTGTGCTGGGCACTGG - Intronic
1098405213 12:70117867-70117889 CCAGGCACTAGGCTGGGTTCTGG - Intergenic
1098623405 12:72634074-72634096 CTAGGCCCTGTGCTAAGCACTGG + Intronic
1098829531 12:75343454-75343476 CCAGGCCATCTGCTAAGTACAGG + Intronic
1100467231 12:94857064-94857086 CCAGGCCCAATGCTAGGTTCTGG + Intergenic
1100817536 12:98400443-98400465 TCAGGCCCAGTGCAGTGTTCAGG - Intergenic
1101194931 12:102372062-102372084 CCAGGCACTGTGCTAGGTGCTGG + Intergenic
1101440810 12:104703151-104703173 CCAGGCACTGTGCTAGGTGCAGG - Intronic
1101652331 12:106688935-106688957 CCAGGCACTGTGCTAAGTGCTGG + Intronic
1101814925 12:108138859-108138881 CCAGGTCCTGTGCTGGGCCCTGG + Intronic
1101854648 12:108432069-108432091 CCAAGCCTTGTGCTTTGTTCTGG - Intergenic
1101887608 12:108680088-108680110 CCAGACATTGTGCTGAGTGCTGG + Intronic
1101953959 12:109197520-109197542 CCAGGCGCTGTGCTGGGTGTTGG + Intronic
1101968550 12:109296716-109296738 CCCGGCCCTGTGCTGGGCACTGG - Intronic
1102012860 12:109629488-109629510 CCAGGCCTTGGGCTGGGTTAGGG + Intergenic
1102030332 12:109736647-109736669 CCAGGCCCTGTGCTAGATGCTGG - Intronic
1102226650 12:111233521-111233543 GCAGGACCTCTGCTCAGTTCTGG - Intronic
1102229950 12:111255727-111255749 CCAGGCACTGTGCTATGTACTGG - Intronic
1102232112 12:111269829-111269851 CCAAGCCCAGTGCTGACTCCAGG + Intronic
1102365484 12:112330667-112330689 CCAGACACTGTGCTCAGCTCTGG - Intronic
1102434670 12:112911477-112911499 CCAGGCTCTGTTTTAAGTTCTGG - Intronic
1102470781 12:113158776-113158798 CCTGGCCCTGTGCTGGGCACTGG - Exonic
1102651302 12:114444374-114444396 TCAGGCTCGGTGCTGAGCTCTGG - Intergenic
1102887054 12:116530218-116530240 CCAGGGACTGTGCTAAGTGCTGG + Intergenic
1103039601 12:117684338-117684360 CCAGGCTTTGTGCTGGGTGCTGG - Intronic
1103092560 12:118107778-118107800 CCAGGCCCTCTGCTGAAAACTGG - Intronic
1103108955 12:118257867-118257889 CCATACCCTGTACTGAGTTTTGG + Intronic
1103222322 12:119256144-119256166 CTAGGCACTGTGCTGGGTGCTGG + Intergenic
1103235579 12:119369787-119369809 CCAGGCCCCGTGCTAGGTACTGG - Intronic
1103324062 12:120108734-120108756 CCAGGCCCTAGGCTGAGGGCTGG + Intronic
1103407795 12:120687673-120687695 CCAGGCCCTGAGCTCAGAGCGGG - Intronic
1103444422 12:120984886-120984908 CCAGGCACCGTGCTGAGGACTGG - Intronic
1103861012 12:124014000-124014022 CCAGGCACTGTGCTAGGTGCTGG + Exonic
1104555104 12:129792534-129792556 CCAGGCGCTGTGCTGAGCATGGG + Intronic
1104556000 12:129800421-129800443 CCAGGCCCTGGGCTAGATTCAGG + Intronic
1104634172 12:130427356-130427378 CCAGGCCCTGTGCTAGGCTAAGG - Intronic
1104901856 12:132193700-132193722 CCAGGGACTGTGCTGGGGTCAGG + Intergenic
1105939612 13:25135698-25135720 TCAGGCACAGTGCTGGGTTCAGG - Intergenic
1106054334 13:26223865-26223887 CCAAGTGCTGTGCTAAGTTCTGG - Intergenic
1106139544 13:27000789-27000811 CGAGGCCCTGTGCTAAGCACTGG + Intergenic
1106591549 13:31102796-31102818 CCAGGCACTGGGCTAAGTCCTGG - Intergenic
1106594815 13:31127044-31127066 TCAGGCTCTGTGCTAAGCTCTGG + Intergenic
1106814012 13:33387418-33387440 GCTGGCCCTGTGCTAAGTGCTGG + Intergenic
1107218167 13:37947080-37947102 CCAGGGCCTGTTGTGAGGTCAGG - Intergenic
1107347548 13:39478315-39478337 CCAGGCACTGTGCTAAATACTGG + Intronic
1107441892 13:40435190-40435212 GCAGGCTCTATGCTAAGTTCTGG - Intergenic
1107555396 13:41513249-41513271 CCAGGCCCTGTGCTAGGTGTTGG + Intergenic
1107579081 13:41762817-41762839 TCAGGCACTGTGCTGAGCTCTGG - Intronic
1107699061 13:43029191-43029213 CCAGGACTTATGCTAAGTTCTGG - Intronic
1108044709 13:46372555-46372577 GCTGGCCATGTGGTGAGTTCAGG - Exonic
1109270782 13:60252873-60252895 CCAGGCCTTGTGCTGAGTATTGG - Intergenic
1109481725 13:62964238-62964260 CAAGGCCCTGGGCCCAGTTCAGG - Intergenic
1110665987 13:78117910-78117932 CCAGGCACTGTGCTAAGTATAGG - Intergenic
1111801300 13:92984354-92984376 CCAGGCCCCATGCTCAGTGCTGG - Intergenic
1112044491 13:95582598-95582620 CCAGGCCCTGAGCTGAATGCTGG - Intronic
1112650766 13:101394858-101394880 CCAGCCCCTGTGCTGGGTTGTGG + Intronic
1113444109 13:110352498-110352520 CCATGCACTGTGCTGGGCTCTGG - Intronic
1113469401 13:110533849-110533871 CCAGGCCCTGTGCTGGCTCCAGG - Intronic
1113474198 13:110568499-110568521 CCAAGCCCTGTGCTCAGTGCCGG - Intergenic
1113586627 13:111470277-111470299 CCAGGCCCTGTCCTGACCTTGGG - Intergenic
1113720916 13:112555612-112555634 CCAGGCACTGTGCTGAGCACTGG + Intronic
1113939251 13:114010084-114010106 CCAGGCCCTGCGCTGTGGGCTGG - Intronic
1114392364 14:22323604-22323626 CCAGGCACTATGCTAAGTACTGG - Intergenic
1114627763 14:24140697-24140719 CCAGGCACTATGCTGGGTACTGG - Intronic
1116785590 14:49284756-49284778 CCAGGCACTGTGCTAAGTACTGG - Intergenic
1117017440 14:51532904-51532926 CCAGGCCATGTGCTGAGCACTGG - Intronic
1117206112 14:53445437-53445459 CCAGGTACTGTGCTGGGCTCTGG + Intergenic
1117477003 14:56105723-56105745 CCAGGCCTAGTGCTGGGCTCTGG - Intergenic
1117489735 14:56234588-56234610 CCAGGGCCTGTGGTGGGTTGTGG + Intronic
1117789808 14:59328525-59328547 TCAGGCACTGTGCTGAGCTCTGG + Intronic
1118056282 14:62082776-62082798 CTAGGCCCTATGCTGTGTGCTGG + Intronic
1118221105 14:63855034-63855056 CCAGCCACTGTGCTGGCTTCTGG + Intronic
1118514825 14:66515777-66515799 CAAGGCCCTGTGCTAAGTGAAGG + Intronic
1118911759 14:70067501-70067523 CCAGGCACTGTGCTGGGCACTGG - Intronic
1119416484 14:74473706-74473728 CCAGGCACTGTGCTGGGCACTGG - Intergenic
1119482532 14:74967312-74967334 CCAGGCCCTGTGCTGGGTACTGG + Intergenic
1119695253 14:76708394-76708416 CCAGGCCCTGTGCTGGGTGCTGG - Intergenic
1119883779 14:78123150-78123172 CCAGGCGCTGTGCTTATTTCTGG - Intergenic
1120468069 14:84886182-84886204 CCTAGCACTGTGCTGACTTCAGG + Intergenic
1120825445 14:88950753-88950775 CCAGGCTCTGTGCTATGTCCTGG - Intergenic
1121029963 14:90649839-90649861 CCAGGCCCTATGCTAACTTCTGG + Intronic
1121331234 14:93051027-93051049 CCGGGCCCTGTGCTGAGCACTGG - Intronic
1121384000 14:93500372-93500394 CCAGGCACTGTCCTAAGTACTGG + Intronic
1121568899 14:94931664-94931686 CCAGGCCCTGTGCTGAGGACTGG - Intergenic
1121632476 14:95431428-95431450 CCAGGAACTGTGCTAAGTTGTGG - Intronic
1121718638 14:96094149-96094171 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
1121795845 14:96734722-96734744 CAAGGCTCTGTGCTAGGTTCTGG + Intergenic
1121835799 14:97091039-97091061 CCAGGCACTGTTCTCAGTTTGGG + Intergenic
1121838827 14:97116052-97116074 CCAGGCCCTGTGCTGAAAGCTGG + Intergenic
1122201903 14:100127941-100127963 CCAGGCACTGTGCTAGGTGCTGG - Intronic
1122248667 14:100422811-100422833 CCAGGCCCTGTGCTCCATCCTGG + Intronic
1122408154 14:101512497-101512519 CCAGGCCCTGCGATGGGTGCAGG + Intergenic
1122436973 14:101706953-101706975 CCAGGCACTGTGCTGGGTGCTGG - Intergenic
1122509323 14:102253620-102253642 CCAGCCCAGGTGCTGAGTACAGG - Intronic
1122555178 14:102575057-102575079 CCCGCCCCCGTGCTGTGTTCTGG + Intergenic
1122783279 14:104152741-104152763 CCAAGCCCTGTGCTGGGCACTGG - Intronic
1122814960 14:104307727-104307749 CCAGGGGCGGTGCTGAGGTCAGG - Intergenic
1122903972 14:104793507-104793529 CCAGGCCCAGTGCTGGGCGCTGG + Exonic
1122943626 14:104994885-104994907 ACAGGACCTGTCCTGTGTTCTGG + Exonic
1123062009 14:105598646-105598668 CCAGGCCCAGAGCTGGGTGCAGG + Intergenic
1123066238 14:105620891-105620913 CCAGCCTCTGTGATGAGTTCTGG + Intergenic
1123070380 14:105639943-105639965 CCAGCCTCTGTGATGAGTTCTGG + Intergenic
1123074971 14:105663603-105663625 CCAGCCTCTGTGATGAGTTCTGG + Intergenic
1123086752 14:105720377-105720399 CCAGGCCCAGAGCTGGGTGCAGG + Intergenic
1123089616 14:105736731-105736753 CCAGCCTCTGTGATGAGTTCTGG + Intergenic
1123095409 14:105764891-105764913 CCAGCCTCTGTGATGAGTTCTGG + Intergenic
1202899521 14_GL000194v1_random:27327-27349 TCAGCCCCTGTGCTGGGTACCGG - Intergenic
1124035664 15:26051701-26051723 CCAGGGCCAGTGCTATGTTCCGG + Intergenic
1124156709 15:27232585-27232607 CCAGACCATGTTCTGAGTGCTGG + Intronic
1124392767 15:29274584-29274606 CCAGGCACTGTGCTAGGTACTGG - Intronic
1124469955 15:29975508-29975530 CCAGGCACTGTTCTGGGTGCAGG - Intergenic
1124500012 15:30219951-30219973 CCAGGCCCTGAGCCCGGTTCTGG + Intergenic
1124743565 15:32318715-32318737 CCAGGCCCTGAGCCCGGTTCTGG - Intergenic
1125350455 15:38761727-38761749 TCAGGCACTGTGCTCAGTTCTGG + Intergenic
1125677088 15:41507949-41507971 CCAGGCCCTGTGGTGGGTGCTGG - Intronic
1125972834 15:43926032-43926054 TCAGGCCCTGTGCTAAGTTCTGG - Intronic
1126068758 15:44847311-44847333 CCAGGCCCTCTGTTAAGCTCTGG - Intergenic
1126090068 15:45043486-45043508 CCAGGCCCTCTGTTAAGCTCTGG + Intronic
1126142777 15:45451334-45451356 CCAAGCCCTGTGCTGGGCTCAGG + Intergenic
1126342241 15:47653941-47653963 CCTGGCACTGTGCTGGGCTCTGG + Intronic
1126417822 15:48436773-48436795 CCAGGCACTGTGCTAGGCTCTGG - Intronic
1126682895 15:51220435-51220457 CCAGGCACTGTTCTAGGTTCTGG - Intronic
1126847726 15:52776779-52776801 CCAGGCACTAGGCTGAGTACAGG - Intronic
1127134854 15:55909585-55909607 CCAGGCGATGTGTTGAGGTCAGG - Intronic
1127283967 15:57516652-57516674 CCAGGCCCTGTGCTGAGCCAGGG - Intronic
1128110259 15:65071684-65071706 CCAGGCCCTCTCCTGAGAGCAGG - Intronic
1128131368 15:65229300-65229322 CCAGGCCCTGAGCTAGGTGCTGG + Intergenic
1128237139 15:66075994-66076016 CCAGACACTGTGCTAGGTTCCGG - Intronic
1128272416 15:66322490-66322512 CCAGGTACTGTGCTGGGCTCTGG - Intronic
1128380256 15:67107093-67107115 CCAGGTACTGTGCTGAGCCCTGG - Intronic
1128569328 15:68722132-68722154 CAAGGGCCTGAGCTCAGTTCTGG + Intronic
1128748706 15:70133215-70133237 CCAGGGCCTGTGCAGAGTGAGGG + Intergenic
1128770572 15:70278662-70278684 CCAGGCCCTGTGCTGGGCACTGG + Intergenic
1128847281 15:70910776-70910798 CCAGGCACTGTTATGAGTGCTGG + Intronic
1128891882 15:71338855-71338877 CCAGACCCTGACCTCAGTTCTGG - Intronic
1129024376 15:72555766-72555788 CCAGGCACTTTGCTAGGTTCTGG - Intronic
1129238377 15:74237242-74237264 CCAGGCACTGTTCTGAGTGCTGG - Intronic
1129251991 15:74314302-74314324 CCAGGCCCTGTGGTGGGCACTGG - Intronic
1129546221 15:76398443-76398465 CCAGGCCCTGTGCTAGGATTGGG - Intronic
1129695777 15:77739980-77740002 CCAGGCACTGAGCTGAGAGCTGG + Intronic
1129711956 15:77824964-77824986 CAAGGCCCTGTGCTGACCTGGGG - Intergenic
1129766884 15:78175363-78175385 ACAGGTCCTGTGCTGACATCAGG + Intronic
1129802711 15:78428264-78428286 CCAGGCCCTGTGGTAAGGGCTGG - Intergenic
1129941344 15:79499702-79499724 CCAAGCTCTATGCTGAGTTTTGG - Intergenic
1130101016 15:80894111-80894133 CCAGGCCCTGGGCTGAATGCTGG + Intronic
1130529551 15:84735742-84735764 CAAGGCACTGAGCTGAGTGCTGG - Intergenic
1130537978 15:84800444-84800466 CCATGCCCTATTCTGATTTCTGG + Intronic
1130649303 15:85752917-85752939 CCAAGCTCTGTGCTGGCTTCTGG + Intergenic
1130851330 15:87796963-87796985 CCAAAGCCTGTGCTGAGCTCAGG - Intergenic
1130979976 15:88805587-88805609 CCAGGCTCTGTGCTCAATGCTGG + Intronic
1131050126 15:89342193-89342215 GCAGGCCCTGTGCTAGGTGCTGG - Intergenic
1131118427 15:89808445-89808467 CCAGGCACTGTGCTAAGTGCTGG - Intronic
1131264325 15:90906689-90906711 CCAGCCCCTGAGGTGTGTTCAGG + Intronic
1131434154 15:92409881-92409903 ACAAGCCCTGTGCTGAGTGCTGG + Intronic
1131630171 15:94167802-94167824 CCAGGCCCTGTGCTAGGCTTTGG + Intergenic
1131862513 15:96669040-96669062 CCAGGCCATGAGCTCAATTCTGG - Intergenic
1132047202 15:98574179-98574201 CCAAGCACTGTGCTGAGCACTGG - Intergenic
1132091083 15:98948415-98948437 CCAGGCCCTGGGCTAAGTGCGGG - Intronic
1132141819 15:99403258-99403280 GCAGGCGCTGTGCTGGGCTCTGG + Intergenic
1132347407 15:101116553-101116575 TCAGGCCCTGTGATGTGTGCTGG - Intergenic
1133187331 16:4109418-4109440 CCAGGCACGGTTCTGGGTTCTGG - Intronic
1133345945 16:5070569-5070591 CCAAGCCCTGAGCTGAGCCCAGG + Intronic
1133359455 16:5162491-5162513 CCAGGCACTGTGCTGGGTGCTGG - Intergenic
1133423321 16:5665716-5665738 CCAGGATCTGTGCTAAGATCAGG - Intergenic
1133556800 16:6913525-6913547 CCAGGCACTGGGCTCAGTGCTGG - Intronic
1133631281 16:7624533-7624555 CCAGGCACTGTGCTGGGCTTTGG - Intronic
1133759014 16:8783236-8783258 CCAGGCCCTGTGCGGAGCATCGG + Exonic
1133797043 16:9054388-9054410 CCAGGCCCTGAGCTGGGAACAGG - Intergenic
1133854052 16:9533036-9533058 CCAGGCACTGTGCTAAGTCTGGG + Intergenic
1133970862 16:10567221-10567243 CCAGGCACTGTGCTGGGCACGGG - Intronic
1134013406 16:10871723-10871745 CCAGCCCCTGTTCTGATTTTGGG + Intergenic
1134071565 16:11263368-11263390 CCAGGCACTGTGCTAAGTCCCGG + Intronic
1134188090 16:12099938-12099960 GCAGGCACTGTGCTCAGTACTGG + Intronic
1134219647 16:12343756-12343778 CCAGGCACTGATCTGAGCTCTGG - Intronic
1134619666 16:15678019-15678041 CTGGGCCCTGTGCTGAGTATAGG + Intronic
1134745396 16:16584162-16584184 CCAGACACTGTGCCGAGTTCAGG - Intergenic
1135000076 16:18769601-18769623 CCAGACACTGTGCCGAGTTCAGG + Intergenic
1135080000 16:19426039-19426061 CCAGGCACTGTTCTAAGATCTGG - Intronic
1135267326 16:21038704-21038726 CCCAGCCCTGTGCTGGGTGCTGG - Intronic
1135399923 16:22159590-22159612 CCAGGCTCTGTGCTGGGCCCAGG + Intergenic
1135404512 16:22188846-22188868 CCAGGCACTGTGCTGAGCAACGG + Intronic
1135470686 16:22727429-22727451 CCAGGCATTGTGCTGAGTGCTGG - Intergenic
1135597245 16:23754250-23754272 CCAGGCCCAGAGCTGTCTTCTGG - Intergenic
1135823314 16:25704038-25704060 CCAGGCACTGTTCTGGGCTCTGG - Intronic
1135829863 16:25763513-25763535 CCAGGCACTGTGATGGGTGCTGG + Intronic
1135876081 16:26201238-26201260 TCAGGCACTGTGCTGGGTCCTGG - Intergenic
1135935594 16:26777215-26777237 CCAGGATCTGTGCTGGGTTTTGG - Intergenic
1135936409 16:26784201-26784223 CCAAGCACTGTGCTGAATGCTGG + Intergenic
1135945709 16:26863211-26863233 CAAAGCCCTGTGCTGAGTGAGGG + Intergenic
1136009607 16:27354890-27354912 CCTGGTTCTGTGCTGGGTTCTGG - Intronic
1136075166 16:27812191-27812213 CCAGGCCTTGTGCTGGGCTTGGG + Intronic
1136247736 16:28985147-28985169 CCAGGGCCTGGGCTGAAGTCGGG - Intronic
1136298047 16:29314742-29314764 CCAGGCTCTGAGCTGGGCTCTGG + Intergenic
1136604932 16:31327083-31327105 CTGGGCCTTGTGCTGAGTGCTGG + Intronic
1137512423 16:49113387-49113409 CCAGGCACTGTTCTAAGTGCTGG + Intergenic
1137589724 16:49686194-49686216 CCAGGCTGTGTGCTGAGTGCTGG - Intronic
1137630051 16:49936842-49936864 CCAGGCACTGTGCTGGGTGTTGG + Intergenic
1137748819 16:50842923-50842945 CCAGGGACTGTGCTCAGTGCTGG - Intergenic
1137749560 16:50849444-50849466 CCAGGCCCTGAGCTGGGTCCTGG - Intergenic
1137906985 16:52333256-52333278 GCAGGCCATGTGCTGGGTGCTGG - Intergenic
1137934262 16:52618901-52618923 CCAGGCTCTCTGCTAAGTGCTGG + Intergenic
1138121769 16:54405957-54405979 CCAGGACCTGAGGTGATTTCAGG - Intergenic
1138142576 16:54581511-54581533 CCAGGCACTGTGCTAAGCCCTGG + Intergenic
1138197373 16:55061437-55061459 CTGGACCCTGTGCTGAGTGCTGG + Intergenic
1138245511 16:55464111-55464133 TTAAGCCCTGTGCTGAGTGCTGG - Intronic
1138341240 16:56290358-56290380 CCAGGCACTGTGCTGGGTGCTGG - Intronic
1138375800 16:56563254-56563276 CCAGGCACTGTGCTGGGCACTGG - Intergenic
1138451533 16:57096014-57096036 CCAGGCACTGTTCTAAGTGCTGG - Intronic
1138527765 16:57618987-57619009 CCAGGCCCTGTGCTGGTTCTTGG + Intronic
1138531486 16:57636760-57636782 CCAGGCACTGTGCTAGGTACTGG + Intronic
1138650630 16:58458980-58459002 CCAGGCCCTGTGCTGAGCTCAGG - Intergenic
1139314877 16:66059605-66059627 CCAGGCACTGTGCTGGGCACTGG - Intergenic
1139363164 16:66416071-66416093 CCAGGCACTGTGCTGGGCACAGG - Intergenic
1139471921 16:67182967-67182989 CCAGGCACTGTTCTGGGTTCTGG - Intronic
1139776831 16:69321669-69321691 CCCGGCCCTGTCCTAAGTGCTGG + Intronic
1140063532 16:71591122-71591144 CCAGGCTCTGTTCTGAATGCAGG + Intergenic
1140246636 16:73255854-73255876 CCAGGCCATGTTCAGAGCTCTGG - Intergenic
1140934297 16:79656454-79656476 CCAGGCCCTGTCCTGAATGAAGG + Intergenic
1140962334 16:79928347-79928369 CCAGGCTCTGTGTTGGGCTCTGG - Intergenic
1141146400 16:81533255-81533277 CCAGGCCCTGTTCTAAATGCTGG - Intronic
1141147254 16:81539943-81539965 CCAGGCCCAGTGCTCAGGGCTGG - Intronic
1141203563 16:81915287-81915309 CCAGGCACTGTTCTGGGCTCTGG + Intronic
1141588448 16:85050820-85050842 GCAGGCTCTGTGCTAAGTGCTGG - Intronic
1141709496 16:85689530-85689552 CCGGGCCCGGTGCTGAGTTTGGG - Intronic
1141756419 16:85994217-85994239 CCAGCCCCTGGGCTGAGAACTGG + Intergenic
1141882038 16:86866677-86866699 GCAGGTACTGTGCTCAGTTCTGG + Intergenic
1142059693 16:88021247-88021269 CCAGGCTCTGAGCTGGGCTCTGG + Intronic
1142355406 16:89599322-89599344 CCGGGCCCTGTGCTGATTGGGGG + Intergenic
1142668681 17:1477376-1477398 CCAGGGACGGTGCTGAGTTAAGG - Intronic
1142670658 17:1486044-1486066 CCAGGCCCGGAAGTGAGTTCCGG - Intronic
1142885058 17:2907369-2907391 CCAGGCCCAGTGCTCGGTTCTGG + Intronic
1143269858 17:5667510-5667532 CCAGGCCCTGTGCTGAGCAATGG - Intergenic
1143374109 17:6457416-6457438 CCAGGGCCTGTGTTGGGTGCAGG - Intronic
1143837021 17:9700857-9700879 CCAGGCCCTGTGCTAGGATGAGG + Intronic
1144074115 17:11701542-11701564 CCAAGCTCTGTGCTGAGCACAGG + Intronic
1144125443 17:12198480-12198502 CCAGGCCCTTGGCTAAGTACTGG + Intergenic
1144333731 17:14249737-14249759 CCAGGCACTGTGCTGGGTCCTGG - Intergenic
1144573075 17:16412548-16412570 CCAGGCACTGTGCTGGTTGCTGG + Intergenic
1144654373 17:17025849-17025871 CCAGACCCTGGGCTGGGCTCTGG - Intergenic
1144930145 17:18852384-18852406 CCAGGCCCAGTGCTGAGGGTTGG - Intronic
1144949421 17:18985892-18985914 CCAGGCCCTGGGCTGGGGTAGGG - Intronic
1145076877 17:19862877-19862899 CCAGGCATTGTTCTGAGTGCTGG - Intronic
1145260845 17:21353626-21353648 CCAGGCACTGTGCTGGGCACTGG + Intergenic
1145765038 17:27453113-27453135 GCAGGCCCTGTTCTGGGCTCTGG - Intergenic
1145825541 17:27874643-27874665 CCAGACACTGTGCTGGGTGCTGG + Intronic
1146024700 17:29309493-29309515 CCAGGCACTGTGCTAGGCTCTGG - Intergenic
1146054868 17:29575998-29576020 CTGGGCTCTGTGCTGAATTCGGG - Intronic
1146374222 17:32283741-32283763 CCAGGCTCTGTGCTAAGTACCGG + Intronic
1146448081 17:32949159-32949181 CCAGGCTCTGTGCTGGGCTCTGG + Intergenic
1146673057 17:34755226-34755248 CCAGGCATTGTTCTGGGTTCTGG + Intergenic
1146817861 17:35958456-35958478 CCAGGCATTGTGCTAGGTTCTGG + Intergenic
1147250063 17:39147820-39147842 GCAGGCACTGTGCTGGGTGCTGG + Intronic
1147252716 17:39162995-39163017 CCAGGCCCCGTGCTGGGCCCTGG + Intronic
1147331805 17:39703745-39703767 CCAGGCCCTGGTCTGATGTCAGG + Intronic
1147572050 17:41577349-41577371 CCAGGCATTGGGCTGAGTGCTGG + Intergenic
1147951071 17:44108372-44108394 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1148083693 17:44981444-44981466 CCAGGTCCTGAGCTGCGTCCTGG + Intergenic
1148162124 17:45456320-45456342 CCAGGCACTGTTCTAAGTGCTGG - Intronic
1148285957 17:46391808-46391830 CCAGGCACTGTGCTAGGTGCAGG - Intergenic
1148308121 17:46609429-46609451 CCAGGCACTGTGCTAGGTGCAGG - Intronic
1148743735 17:49907287-49907309 GCAGGCTCTCTGCTGAGATCAGG - Intergenic
1148798220 17:50207627-50207649 CCAGGCACTTTGCTGGGTACTGG + Intergenic
1148864804 17:50622934-50622956 CCAGGCCCTGTGCTGGGACCTGG + Intronic
1149229941 17:54521038-54521060 TCAAGCACTGTGCTGAGTCCCGG - Intergenic
1149432059 17:56602294-56602316 CCAGGCCCTGTGCTAGGCTCTGG - Intergenic
1149951757 17:60995778-60995800 CCAGGCACTGTTCTGAGTTTAGG + Intronic
1150393360 17:64802968-64802990 CCAGGCACTGTTCTAAGTGCTGG - Intergenic
1150646916 17:66984528-66984550 CCTAGCCCTGTGCTATGTTCTGG + Intronic
1151171185 17:72247624-72247646 CCAGGTCCTGTGCTATGTGCTGG - Intergenic
1151407198 17:73896268-73896290 AGAAGCCCTGTGCTGACTTCTGG - Intergenic
1151432973 17:74077157-74077179 CCAGGCACTGTGCTGAGCCTTGG - Intergenic
1151559689 17:74863627-74863649 TTAGGCCCTGTGCTTAGTGCTGG - Intronic
1151973083 17:77469079-77469101 CCAGGCCCTCTGCTGGGTCCTGG - Intronic
1152259908 17:79261263-79261285 CCAGGCCCTGTCCTGGGCTCTGG - Intronic
1152609128 17:81307076-81307098 CCTGGCCCTCTGCCGTGTTCAGG + Intergenic
1152637841 17:81437464-81437486 GCAGCCCCTGGGCTGGGTTCTGG + Intronic
1152998378 18:429995-430017 CCAGGCCCTGTCCTGGGAGCTGG - Intronic
1153687918 18:7565439-7565461 TCAGGCACTGTGCTAAGTACTGG - Intergenic
1154131063 18:11737729-11737751 CCAAGCCCTGTGCTGGGCACAGG + Intronic
1154462699 18:14610670-14610692 CCAGGCACTGTGCTGTGCACTGG - Intergenic
1155052213 18:22158345-22158367 CCAGGCTCTGTTCTGGGCTCTGG + Intergenic
1155074427 18:22342272-22342294 CCAGGCCCTGTGCTCGATGCTGG - Intergenic
1155832510 18:30535497-30535519 CCAGGCACTGTTCTGAGTGCTGG + Intergenic
1156316605 18:35974338-35974360 CCAGGCACTGTTCTAAGTGCTGG - Intronic
1157114993 18:44854154-44854176 CCAGGCCTTGTGATGCATTCTGG - Intronic
1157285722 18:46375861-46375883 CCAGGCCCTGGGCTAAGGGCTGG + Intronic
1157402315 18:47398797-47398819 CCATGCACTGTGCTGTGTGCTGG - Intergenic
1157502975 18:48203784-48203806 CCAGGCTCTGGGCTGGGTGCTGG - Intronic
1157521714 18:48349895-48349917 CCAGGCACTGTGCTAGGTGCAGG - Intronic
1158333096 18:56384430-56384452 CCAGGCTCTGTGCTGGGTGCTGG - Intergenic
1158682739 18:59583167-59583189 CCCATCCCTGTGCTGAGTTCAGG - Intronic
1159092035 18:63860613-63860635 CCTGGGCCTGTGCTGGCTTCAGG - Intergenic
1159987420 18:74859800-74859822 CCAGGTCCTATCCTGTGTTCTGG - Intronic
1160963937 19:1737369-1737391 CCAGGCTCTGTGCTGGATGCTGG + Intergenic
1161029832 19:2052362-2052384 CCAGGTGCTGGGCTGGGTTCTGG - Intergenic
1161096665 19:2396164-2396186 CCAGGATCTGAGCTGACTTCAGG - Intronic
1161314395 19:3611133-3611155 CCAGGCCCTGTGCTCAGAGGTGG + Exonic
1161442293 19:4298913-4298935 CCAGGCCCTATGCTGGGTGTGGG + Intronic
1161516728 19:4700553-4700575 CCACACCCTGTGCTGAGAGCTGG + Intronic
1161673179 19:5625668-5625690 CCAGGCACTGTGCTGAGGATGGG + Intronic
1161796027 19:6387298-6387320 CCAGGCCCTGTGCTGGGAGCTGG - Intronic
1161858102 19:6777304-6777326 CCAGGCCCTGTTCTTGGTGCTGG + Intronic
1161933523 19:7356924-7356946 CCAGGCACTGTGCCGGGGTCAGG + Intronic
1161961447 19:7525645-7525667 CCAGACCCTGTGCTGGGCTCTGG + Intronic
1161962832 19:7532165-7532187 CCAAGATCTGTGCTGGGTTCTGG + Intronic
1162379741 19:10324325-10324347 CCACGCCCTGTGCCAAGGTCTGG + Intronic
1162873253 19:13601509-13601531 CCTGGCCCTGTGCTAGGTCCTGG + Intronic
1162900892 19:13795169-13795191 CCAGGCCTTATGCGGAGTTTCGG - Intergenic
1163095828 19:15056263-15056285 CCATGCCTTGTGCTAAGTTTTGG - Exonic
1163144324 19:15370335-15370357 ACAGGCCCTGTCCTGAGCCCCGG - Intronic
1163434389 19:17286537-17286559 CCAGGCCCGGGGCTGAGTGCTGG + Exonic
1164145716 19:22511304-22511326 CCAGGCTCTGTGCTGGGCACTGG - Intronic
1164432275 19:28198737-28198759 GCAGGCACTGTGCTGAGCCCTGG + Intergenic
1164581324 19:29437142-29437164 CCAGGCCCTGGGCTGGTTGCTGG - Intergenic
1164714448 19:30381271-30381293 CCAGGCACTGTGCTGGGGACTGG + Intronic
1165088004 19:33364659-33364681 CCAGGCCCTGTCCCAAGTTCTGG - Intergenic
1165324823 19:35108473-35108495 CCAGACCCTGGGCTCAGTGCTGG + Intergenic
1165846251 19:38819550-38819572 CCAGGCCCTGTGCTAGGCCCAGG - Intronic
1165858741 19:38895397-38895419 CCAGACCCTGTTCTCAGTGCTGG - Intronic
1165890752 19:39110847-39110869 CCAGGCTCTGTTCTCAGTGCTGG + Exonic
1166007421 19:39917031-39917053 CCAGGCCCTGTCCTTGGTGCTGG - Intronic
1166228061 19:41409438-41409460 CCAAGCCCTGTGCTGGGTTCTGG - Intronic
1166453021 19:42917748-42917770 CCAGGTGATGTGCTGAGTGCAGG + Exonic
1166549009 19:43652581-43652603 CCAGGCACCGTGCTGGGTGCTGG + Intronic
1166653958 19:44596577-44596599 CCAGGCACTGTGCTGGGTGCTGG + Intergenic
1166959577 19:46489506-46489528 CCAGGCCCTGTTCTTGGTGCAGG - Intronic
1167062536 19:47158704-47158726 CAAGGCACTGTGTTGAGTGCAGG + Intronic
1167264180 19:48475199-48475221 CCAGGCCCTGAGCTGGGCTGAGG + Intronic
1167451559 19:49573229-49573251 TCAGGCACTGTGCTGAACTCTGG + Intronic
1167487080 19:49768914-49768936 CCAGGCCCTGTTCTAGGTACTGG + Intronic
1167489446 19:49783081-49783103 CCAGGCACTGTGCTGATTGCTGG + Intronic
1167533729 19:50035592-50035614 CCAGCCCCTGTGCTAGGTACAGG - Intronic
1167588032 19:50385946-50385968 ACAGGCCCTCTGCTGAGCACTGG + Intronic
1167607130 19:50487480-50487502 CCAGGCAGTGTCCAGAGTTCCGG + Exonic
1167695477 19:51013256-51013278 CCAGGCCCAGTGCTGGGTGCTGG - Exonic
1168098734 19:54129597-54129619 CCAGGCCCACAGCTGTGTTCAGG + Intronic
1168133958 19:54338184-54338206 CCAAGCCCTGTGGTGACCTCAGG - Exonic
1168166605 19:54553002-54553024 CCTGGCCCTGTGCAGAGAGCGGG - Intergenic
1168340063 19:55617578-55617600 CCAGGCCCTGAGCTGGGCACTGG + Exonic
1168514314 19:56998268-56998290 GCAGGCCCTGCACTGAGTCCGGG - Intergenic
1168706412 19:58472792-58472814 CCAGCTCCTGTCCTGAGTACTGG + Exonic
925173481 2:1766984-1767006 CCAGTCCCCCTGCTGAGCTCTGG + Intergenic
925379927 2:3417595-3417617 CCAGGCACTGTGCTAGGCTCGGG - Intronic
925431853 2:3801658-3801680 TCAGGCTCTGTGCTGGGCTCCGG - Intronic
925630577 2:5888826-5888848 CCAGGCCCTTTTCTGTTTTCTGG + Intergenic
925874997 2:8303891-8303913 CCAGGCCCTGTGCTAGGCCCTGG - Intergenic
926363661 2:12113585-12113607 CCAGGCCCTGAGCTGGGCTAAGG + Intergenic
926749618 2:16188274-16188296 CCAGACCCTGTGCTCAGTACTGG + Intergenic
926802160 2:16668106-16668128 CCAGGCACTGTGCTAAGTAATGG + Intergenic
926812818 2:16771549-16771571 CCAGGTCCTGTGCTACGTTCAGG - Intergenic
926973932 2:18494706-18494728 CCAGGGTCTGTGCTGGCTTCAGG + Intergenic
927157554 2:20230010-20230032 CCAGGCCCAGGGCTGAGTGCCGG + Intergenic
927199355 2:20568732-20568754 CCAGGCCCTGTGTTGGGGACAGG + Intronic
927213070 2:20650642-20650664 CCAGGCCCGGTGCTGGGCACTGG - Intronic
927224391 2:20749084-20749106 CCAGGTGCTGTGCTGAGTGCTGG + Intronic
927271627 2:21216350-21216372 CCAGGCACTGTGCTAAGGTCTGG + Intergenic
927683807 2:25157354-25157376 CCAGGGCCTGTGCTGGGGTGAGG - Exonic
927694170 2:25229262-25229284 CCAGGCCCTGTGCTGGGGTCAGG - Exonic
928108091 2:28485689-28485711 CCAGGCTCTGTGCTAAGTGCTGG + Intronic
928255616 2:29719797-29719819 CCAGGCCCTGTGGAGAGCTGAGG - Intronic
928420633 2:31135831-31135853 CCAGGCTCTGTGCTGGGTTTGGG - Intronic
928727531 2:34192002-34192024 TCAGGCTCTGATCTGAGTTCTGG + Intergenic
929041381 2:37747983-37748005 CCAGGCACTGTGCTAAGTGTTGG + Intergenic
929212798 2:39376569-39376591 CCAGGCCCTAAGCTCAGTGCTGG + Intronic
929443850 2:41987845-41987867 CCAGTCCCTGTGCCAGGTTCTGG + Intergenic
929584093 2:43102506-43102528 CCAGGCCCTGTGGTGCGGTCTGG - Intergenic
929598760 2:43192031-43192053 CCAGGCACTGTGCTGAGCCCTGG + Intergenic
929713352 2:44287085-44287107 CCAGGCCCTGTTCTAAGCACTGG + Intronic
929825040 2:45303454-45303476 GCAGGCACTGTGCTGGGTGCTGG - Intergenic
929962815 2:46509170-46509192 CCAGGCACTGTGCTGGGTGCTGG - Intronic
930895516 2:56441151-56441173 CCTGGTACTGTGCTGAGCTCGGG - Intergenic
931265868 2:60660049-60660071 CCAGGCACTGTGCTAGGTGCAGG + Intergenic
931274225 2:60730066-60730088 ACAGTCACTGTGCTGAGTTGAGG + Intergenic
932120232 2:69091997-69092019 CCAGGCACTGTGCTAGGTGCTGG + Intronic
932591155 2:73068664-73068686 CCAGGCACTGTGCTGAGCCTTGG + Intronic
932836298 2:75041127-75041149 CCAGGCCCAGTGCTGGCATCAGG - Intergenic
933647646 2:84825541-84825563 CCAGGCATTGCGCTGAGCTCAGG - Intronic
934087957 2:88525909-88525931 CCAGGCCCTGTCCTGGGCTTTGG + Intronic
934608806 2:95719637-95719659 CCTGGCCCTATGCAGAGGTCAGG + Intergenic
934769226 2:96897257-96897279 CCAGGCACGGTGCTAGGTTCTGG - Intronic
934991581 2:98925251-98925273 CCAGGCCCTGTGCACACTTGGGG + Intronic
935060868 2:99606457-99606479 CCAGGCACTGTGCTGAGCTTTGG - Intronic
935350009 2:102144585-102144607 CCAGGCACTGTGGTGAGTGGTGG + Intronic
936377506 2:111954491-111954513 CCAGGCACTGTGCTGGGTGATGG - Intronic
936542101 2:113361104-113361126 CCTGGCCCTATGCAGAGGTCAGG + Intergenic
936864868 2:117065880-117065902 CCAGGTCCTGTGCTGGGTGTTGG + Intergenic
936896696 2:117435676-117435698 CCAGGCACTGTGGTGGGTGCTGG + Intergenic
937069539 2:119052821-119052843 CCAGGCACTGTGCTGGGTAGTGG - Intergenic
937081378 2:119142422-119142444 CCAGGCCCTGTAGTAAGTTCTGG - Intergenic
937456367 2:122044999-122045021 CCAGGCACTGTGCTTGGCTCTGG - Intergenic
937623126 2:124012835-124012857 CAAGCCCCTGTGCTGAGGTATGG + Intergenic
937661232 2:124432003-124432025 TCAGGCTCTGTGCTCAGTGCTGG + Intronic
937768070 2:125685149-125685171 CCATACCCTGTGGTGATTTCTGG - Intergenic
937857383 2:126682403-126682425 CCATGCCTGGTGCTGGGTTCAGG - Intronic
938079524 2:128362340-128362362 CTAGGCCCTGTGCAGAGTGTGGG + Intergenic
938581693 2:132652241-132652263 CCAGGCACTGTTCTGATTGCTGG - Intronic
938902093 2:135807055-135807077 CCAGGCTCTGGGCTCAGTGCTGG - Intronic
938972102 2:136442171-136442193 CCATTCACTGTGCTGAGCTCAGG + Intergenic
939996071 2:148921102-148921124 CCAGGCACAGTGCTGAGTGCTGG - Intronic
939996121 2:148921541-148921563 CCAGGCCCTTTGCTGTCTGCTGG + Intronic
940074557 2:149726685-149726707 CCAGGTCCTGTGCTAAGTGCTGG - Intergenic
940293137 2:152097718-152097740 CCAGACCCGGAGCTGAGTGCTGG + Intronic
940425491 2:153526251-153526273 CCCGGTGCTGTGCTGGGTTCAGG + Intergenic
940683092 2:156810594-156810616 CCAGGCTCTGTACTAAGTGCTGG - Intergenic
940718016 2:157249754-157249776 CTAGGCCCTGTGCTAAGCTTTGG - Intergenic
941047856 2:160696509-160696531 CCAGGCACTATGCTGGATTCAGG - Intergenic
941175506 2:162193074-162193096 CCAGGCACTGTGCTAGGTCCTGG - Intronic
941751703 2:169141457-169141479 CCAGGCACTGTTCTAAGTGCTGG - Intronic
941964764 2:171290116-171290138 CCAGACACTGTGCTGAGATTTGG - Intergenic
942089738 2:172478440-172478462 CCAGGCCCCATTCTGAGTTCTGG + Intronic
942117054 2:172738291-172738313 CCAGGCACTGTGCTGGGCACTGG + Intronic
942131112 2:172880449-172880471 CCAGGCACTGTATTGAGCTCTGG - Intronic
942189721 2:173457655-173457677 CCAGGCCTGGTGCTGAGCACAGG - Intergenic
942425477 2:175855963-175855985 CCAGCTCCTGTTCTGAGCTCTGG + Intergenic
942721936 2:178963060-178963082 CCAGTCACTGTGCTAAGTGCTGG - Intronic
942781630 2:179650022-179650044 CCAGGCTCTGTGCTGAGCACTGG - Intronic
942974891 2:182004350-182004372 CCAGGTAATGTGCTGAGTTGAGG + Intronic
943328533 2:186530975-186530997 CCAAGCACTGTGCTGGGTACTGG + Intergenic
943762079 2:191621092-191621114 CCAGGCTCTGTGCTGAGTTTGGG + Intergenic
944301005 2:198124670-198124692 CCGGGCCCTGTGCTAACTCCTGG + Intronic
945009715 2:205448027-205448049 CCAGGCTCTGTGCTTAGCACTGG + Intronic
945094560 2:206206706-206206728 CCAGGCACTGTGCTAGGCTCTGG - Intronic
945098936 2:206246200-206246222 CCAGGCACTGTGCTAGGCTCTGG + Intergenic
945185619 2:207136698-207136720 CCAGGTACTGTGCTGGGTGCTGG - Intronic
945766383 2:213984542-213984564 CCATGCCTTGTGCTGGGTTTTGG - Intronic
946491464 2:220152975-220152997 CCAGGCCGTGTGCTAAATGCTGG - Intergenic
947679593 2:232017970-232017992 CCAGGCACTGAGCTAACTTCTGG - Intronic
947990605 2:234484703-234484725 TCAGGCCCTGTGCTAGGCTCTGG + Intergenic
948262774 2:236616361-236616383 CCAGGCACTGTGCTAGGTACAGG + Intergenic
1168837035 20:884408-884430 GCAGGCCCAGTGCTGGGTGCTGG - Intronic
1168896424 20:1326807-1326829 CCAGGCACTGTGCTCAGCACTGG - Intronic
1168948272 20:1779157-1779179 CCAGACCCTGTGCTCAGTGCTGG - Intergenic
1169122856 20:3107730-3107752 GCAGGCCCTGTCCTGGGTACAGG - Exonic
1169205211 20:3735863-3735885 CCAGGCTCTGTGCTAAGCACTGG - Intronic
1169710718 20:8559978-8560000 ACAAGCCCTGTGCTAAGTTCTGG + Intronic
1170079975 20:12464066-12464088 TCAGGTCCTGGGCTGATTTCAGG - Intergenic
1170624611 20:18021734-18021756 CCAGGCCTTGTGCCAAGATCTGG - Intronic
1170845464 20:19958484-19958506 GCAGGCCCTGTGCAGGGATCAGG - Intronic
1170859645 20:20090748-20090770 CCAGACCCTGTTCTAAGTGCCGG - Intronic
1171411537 20:24951423-24951445 CCAGGCGCTGTGATCATTTCTGG + Intronic
1172007027 20:31824650-31824672 CCAGGCCCTGTGCTGGGCACTGG + Intronic
1172010233 20:31842254-31842276 CCAAGGCATGTGCTGAGTCCAGG + Intergenic
1172029709 20:31973335-31973357 CCAGGCACTGTTCTAAGTGCTGG + Intronic
1172038537 20:32027801-32027823 CCAGGCACTCTGCTGTGTGCTGG + Intronic
1172093962 20:32451739-32451761 GCAGGCCCTGAGCTGAGGCCTGG + Intronic
1172098103 20:32470431-32470453 CCAGGCCCTGTGCTGGGTGCTGG + Intronic
1172206179 20:33164410-33164432 CCAGACCCTGTGCTGGGTACTGG + Intronic
1172276826 20:33684728-33684750 CCATGCCCAGTGCTGCCTTCCGG - Intronic
1172516448 20:35537548-35537570 CCCTGCCCTGTGTTGAGTCCTGG - Intergenic
1172536128 20:35674761-35674783 CCAGGCACTATGCTCAGTACTGG - Intronic
1172571714 20:35975767-35975789 CCAAGCCTAGTGCTGAGTTGGGG + Intronic
1172602366 20:36192665-36192687 CCAGGCCTTGTGTTGGGTCCTGG + Intronic
1172678334 20:36691879-36691901 CCAGACCCTGGTCTGAGTTGTGG + Intronic
1172783113 20:37448969-37448991 CCTTGCCCTCTGCTGGGTTCTGG + Intergenic
1173164663 20:40678875-40678897 TCAGGCCCTGTGCTAGGTGCTGG - Intergenic
1173288607 20:41694650-41694672 CCAGGCAGTGTGTTGAGTGCTGG + Intergenic
1173385446 20:42583022-42583044 CCAGCCCCTGTGCTGAGCCCTGG - Intronic
1173404765 20:42754917-42754939 CCAGGCACTGCGCTGAGTGCAGG + Intronic
1173562624 20:44017083-44017105 CCAGGCCCTTTGCTAGATTCTGG - Intronic
1173564765 20:44030706-44030728 CCAGGCCCTGTGCTGAGCACTGG - Intronic
1173605385 20:44327386-44327408 CCTTGCCCTGTGCTGGGTCCTGG - Intergenic
1173747408 20:45448478-45448500 CCAGGCACTGTCCTAAGTGCTGG - Intergenic
1173805474 20:45922107-45922129 CCAGACCCTGTGCTGGGCACTGG - Intergenic
1173837719 20:46136613-46136635 CCAGGCCCTGTGCTAAAGACCGG + Intergenic
1173911221 20:46672432-46672454 CCAGGCACTGTGCTGAACACTGG + Intronic
1173965035 20:47106273-47106295 CCAGGCCCTGTGCTAGGTCCGGG - Intronic
1174062827 20:47844630-47844652 CCAGGCACTGTGCTAGGTGCAGG - Intergenic
1174133232 20:48360232-48360254 CCAGGCACTGCTCTGAGTGCCGG - Intergenic
1174151180 20:48487626-48487648 CCAGGCACTGTGCTAGGTGCAGG - Intergenic
1174159731 20:48542260-48542282 CCAGGCACTCTGCTAAGTTCTGG + Intergenic
1174169879 20:48609609-48609631 CCAGGCCCTGGCCTGGGGTCTGG + Intergenic
1174174373 20:48635775-48635797 CCAGGCCCTGAGCTGGGAGCTGG - Intronic
1174202926 20:48819796-48819818 CCAGGCACTGTGCTAGGTGCTGG - Intronic
1174264860 20:49323990-49324012 CCAGGCCCTGTGCTTGGTGATGG + Intergenic
1174276690 20:49409297-49409319 CCAGGCACTGTGCTGGGCTCTGG + Intronic
1174298102 20:49562918-49562940 CCAGCCACTGTTCTGAGTGCTGG - Intronic
1174305168 20:49609852-49609874 CCAGACACAGTGCTGAGTGCTGG + Intergenic
1174404610 20:50295188-50295210 CCAGGTCCTGGGCTGGGTGCTGG + Intergenic
1174405221 20:50298585-50298607 CCCAGCCCTGTGCTGAGTGCTGG - Intergenic
1174407612 20:50312398-50312420 CCTGACACTGTGCTGAGCTCTGG - Intergenic
1174416423 20:50370131-50370153 CCAGGCCCTGGGCTAGGCTCTGG - Intergenic
1174421925 20:50404830-50404852 TCAGGCACTGGGCTGAGTGCAGG - Intergenic
1174572560 20:51512457-51512479 CCAGGCACTGTGCTGGTTGCAGG - Intronic
1174600992 20:51724685-51724707 CCAGGCCCTGTGCTGGGTTCTGG - Intronic
1174768113 20:53272796-53272818 CCAGGCTCTGTTCTGAGTCCTGG + Intronic
1174774600 20:53332141-53332163 CCAGGCACTGTGCTGAGCCTGGG + Intronic
1174823006 20:53743809-53743831 CCAGGCACTGCCCTGTGTTCTGG + Intergenic
1174856330 20:54048864-54048886 TCAGGCCTTGTGCTGAGCTCTGG + Intronic
1175055544 20:56194225-56194247 CCAGGGGCAGTGCTGAGTTGGGG - Intergenic
1175143416 20:56877854-56877876 CCAGGCACTGTGCTGGGTCCTGG + Intergenic
1175462191 20:59159991-59160013 CCAGGCCCTGTGCTGGATGCTGG + Intergenic
1175538507 20:59732821-59732843 CCAGGCACTGTGCTAGGTGCCGG + Intronic
1175773755 20:61640447-61640469 CCCAGCCCTGTGCTGGCTTCCGG + Intronic
1175805549 20:61826528-61826550 CCAGCCCCTGTGCTAAGCTAGGG + Intronic
1175905418 20:62377113-62377135 CCAAGCCCCGTGCTGGGTACAGG - Intergenic
1175913767 20:62416335-62416357 CCAGGCCCTGGGCTACGTGCTGG - Intronic
1175922086 20:62454955-62454977 CCAGGCTCTCTGCGGAGTCCGGG + Intergenic
1175985247 20:62761206-62761228 CCAGGCCCAGAGCTGGCTTCAGG + Exonic
1176041884 20:63070005-63070027 CCAGGCACAGAGCTGAGTCCTGG - Intergenic
1176082833 20:63282507-63282529 CCCGGCCCTGTCCTGAAGTCTGG + Intronic
1176249761 20:64114931-64114953 CCAGGCCCTGGGCTCAGTGCTGG + Intergenic
1176372241 21:6069044-6069066 CCAGGCCCTTTGCTGTCTTGGGG - Intergenic
1176618897 21:9042099-9042121 TCAGCCCCTGTGCTGGGTACCGG - Intergenic
1176877495 21:14147436-14147458 CCAGGCACTGTGTTAAGTGCTGG - Intronic
1177699919 21:24624959-24624981 CCAGGCCCTGGTCTAAGATCTGG + Intergenic
1178461585 21:32807212-32807234 CCAGGCCCTGTGCTAAGGACTGG - Intronic
1179751278 21:43469495-43469517 CCAGGCCCTTTGCTGTCTTGGGG + Intergenic
1179828489 21:43981672-43981694 CCTGTCCCTGTGGTGAGCTCCGG + Intronic
1180023588 21:45145453-45145475 CCAGGCCCTGGGGTGATTTCGGG + Intronic
1180219266 21:46347780-46347802 CCTGCCCCTGAGCTGTGTTCTGG + Intronic
1180871227 22:19148493-19148515 CCAGGCCCTGGGCTGGGTCTTGG - Intergenic
1180879892 22:19196203-19196225 CCAGGCCCTATTCTGGGTGCAGG - Intronic
1181455392 22:23057454-23057476 CCAGCCTCTCTCCTGAGTTCTGG - Intergenic
1181544204 22:23591907-23591929 CCCAGCCCTGTGCTGTATTCTGG - Intergenic
1181661099 22:24349383-24349405 AAAGGCCCTGTGTTGAGCTCTGG - Intronic
1181729636 22:24835370-24835392 CCAGGCCCTCTGCTGGGTCTTGG + Intronic
1181779203 22:25180694-25180716 CCAGGCTCTGAGCTGAGTGAGGG + Intronic
1181790893 22:25265472-25265494 CCAGGCTCTGGGCTGAGTCCTGG + Intergenic
1181859342 22:25806070-25806092 CCAGGCCCTGTGCTAGGCCCTGG - Intronic
1181980554 22:26762978-26763000 CCAGGCTCTGTACTGGGTGCTGG + Intergenic
1182061460 22:27401217-27401239 CCAGTCCCTGTGCTGGGCACTGG - Intergenic
1182255187 22:29032758-29032780 CCAGGCCTTTTGCCGGGTTCTGG + Intronic
1182309058 22:29391848-29391870 CCAGGCCCTGGGCTGGGTGCTGG + Intronic
1182823551 22:33241443-33241465 CCAGGCTCTGTGATGAATGCTGG - Intronic
1182897115 22:33868164-33868186 ACAGGCCCTGTGCTCATTACAGG + Intronic
1183038395 22:35157778-35157800 CCAGGCCCTGTGCTGGGCTCTGG - Intergenic
1183079256 22:35446096-35446118 CCAGGCTCTGTACTGAGTGCTGG + Intergenic
1183107485 22:35625056-35625078 CCAGGCTCCGTGCTGGGCTCTGG + Intronic
1183238940 22:36641298-36641320 CCAGGCACTGTGCTAGGTACTGG - Intronic
1183365584 22:37405008-37405030 TCAGGCCCTGGGCTGAATCCTGG + Intronic
1183404457 22:37623640-37623662 CCAGGGCAGGTGCTGAGGTCAGG + Intronic
1183407668 22:37638467-37638489 CCAGGCCCTGGGCTAGGTGCTGG + Intronic
1183462276 22:37959042-37959064 CCAGGCCCTCTGCTCTCTTCTGG + Intronic
1183470149 22:38000889-38000911 CCAAGCGCTGTGCTGAGAACTGG - Intronic
1183505122 22:38204454-38204476 CCAGGCTCTGTGCTGGGCCCTGG - Intronic
1183517570 22:38275979-38276001 CCAGACCCTGTACTAAGTACTGG - Intergenic
1183563979 22:38599658-38599680 CCAGGCGCTGTGCTAAGGCCTGG + Intronic
1183730068 22:39613507-39613529 TGAGGCCCTGTTCTGAGTACTGG + Intronic
1183752000 22:39726417-39726439 CCAGGCACTGCGCTAGGTTCTGG + Intergenic
1183924993 22:41199440-41199462 CCAGGCCCGGTGCTGGACTCTGG + Intergenic
1184094646 22:42309975-42309997 CCAGGCCCTGTGCAGGGCACTGG - Intronic
1184193035 22:42907782-42907804 CCGGGCCCTGGGCTAAGTCCTGG - Intronic
1184225692 22:43127858-43127880 CCCAGCCCTGTGCTGTGTTCAGG - Intronic
1184349869 22:43936477-43936499 CCAGGCCCTGTCCTGGGTGCTGG - Intronic
1185150824 22:49163081-49163103 CCAGGCCCTGAGATGAGGTTCGG + Intergenic
949484520 3:4525012-4525034 CCAGGCTCTGTACTAAGTACTGG - Intronic
949774137 3:7612375-7612397 CCAGGCCCTGGGCTAAGATGTGG + Intronic
949924352 3:9029117-9029139 CCAGGCTGTTTGCTCAGTTCTGG - Intronic
949982320 3:9509474-9509496 CCAGGCACTGTGCAGTGTGCCGG + Intronic
950344826 3:12283887-12283909 CCAGGCCCTCTGCTAAGTGCGGG - Intergenic
950450315 3:13061594-13061616 CCAGGCCCTGTGCTGATGCCAGG + Intronic
950625516 3:14243868-14243890 CCAGGTCCTATGCTGAGTGCAGG + Intergenic
951114168 3:18840214-18840236 CCAGGCCTTATGCTAAGTGCTGG + Intergenic
952494348 3:33902802-33902824 CCAGGCCCTGTGCTGGGCTCTGG + Intergenic
952500311 3:33955698-33955720 CCAGGCACTGTGCTGAGTACCGG - Intergenic
952630663 3:35461975-35461997 CCAGTTCCTGTGCTGGGTGCTGG - Intergenic
952987236 3:38796911-38796933 CCAGGCACTGTACTAGGTTCTGG - Intergenic
953182101 3:40605490-40605512 CCAGGTCTTGTGCTGGGTACTGG - Intergenic
953384897 3:42500984-42501006 CCAGGCCCTGTGCTGTGCACTGG - Intronic
953449400 3:42993768-42993790 CCAGGCACTGTGCTGGGTGTTGG + Intronic
953499910 3:43423395-43423417 CCAGGCCCTATGCTGGGTGAGGG + Intronic
953646181 3:44757547-44757569 CCAGGCACTGTGCTAGGTGCTGG + Intronic
954143872 3:48624485-48624507 CCAGGCTCTGTGCAGGGGTCTGG - Intergenic
954367692 3:50155125-50155147 CCAGGTCCTGCGCTGCGCTCGGG - Exonic
954369259 3:50161688-50161710 ACAGGCCCCGTGCTGAGTGCTGG + Intronic
954376457 3:50196403-50196425 CCAGGGCCTGTGCTGCAGTCGGG + Exonic
954608995 3:51934337-51934359 CCAGGCCCTGTGCTAGGAGCTGG + Intronic
954710135 3:52501504-52501526 CTAGGCCCTGTGCTCAGCTCTGG + Intronic
954744602 3:52780014-52780036 CCAGGCCCTGTGATCAGGGCTGG + Intronic
954786017 3:53092964-53092986 ACAGGCCCTGTGAGGAGTGCTGG + Intronic
954795452 3:53159422-53159444 CCAGGCTGTGTGCTGGGTGCTGG - Intronic
954813406 3:53261930-53261952 GCAAGCCCTGTGCTGATTTGGGG - Intergenic
954880350 3:53831458-53831480 CCCAGTCCTGTGCTGACTTCAGG + Intronic
954895088 3:53968283-53968305 CCAGGCACTCTGCTGAGGCCAGG - Intergenic
954908804 3:54086130-54086152 CCAGGCCCTGTGCTAGGCACTGG - Intergenic
954931141 3:54282639-54282661 CCAGGCTATGTGCTGGGCTCTGG + Intronic
955183665 3:56694242-56694264 CCAGGCACTGTGGTGAGCCCTGG - Intergenic
955244526 3:57212016-57212038 ACAGGCACTGTGCTGGGTGCAGG - Intronic
955429425 3:58827334-58827356 CCATGCCCTGTGTTCAGATCAGG - Intronic
955522537 3:59788670-59788692 CCAGGCCCTGGGCTGGGTGCAGG - Intronic
956402542 3:68895725-68895747 CCAGAGCCTGTGCTGAGTACTGG + Intronic
956531175 3:70220904-70220926 CCAAGCCCTGTGCTAAGCTCAGG - Intergenic
957064703 3:75512008-75512030 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
957405588 3:79772968-79772990 CCAGGCCCAGGGCTCAGTGCTGG - Intergenic
958013746 3:87914348-87914370 TCATGCCCTCTGCCGAGTTCTGG - Intergenic
959256462 3:104021175-104021197 TCAGGACCTGAACTGAGTTCTGG + Intergenic
959354429 3:105307819-105307841 CCTGGTCCAGAGCTGAGTTCAGG + Intergenic
959440882 3:106374087-106374109 CCAGGCACTATGCTGAGTCCTGG + Intergenic
960705199 3:120474931-120474953 CCAGACTCTGTGCTAAGTACAGG + Intergenic
960961225 3:123071814-123071836 CCAGGCCCTGGGCTAGGTGCTGG - Intronic
961021787 3:123513705-123513727 CCAGGTCTTGTGCTGAGCACTGG - Intronic
961203150 3:125060236-125060258 CCCAGCACTGTGCTGAGTGCTGG + Intergenic
961264033 3:125625886-125625908 CCAGGCACTGTGCTAAGAGCTGG - Intergenic
961288650 3:125827385-125827407 CCAGGCACTGTGCTGGGTGGTGG + Intergenic
961315230 3:126030558-126030580 CCAGGCTCTGTGCTCAGAACAGG - Intronic
961584075 3:127907960-127907982 CCAAGCACTGTGCTGGGCTCTGG + Intergenic
961732212 3:128974141-128974163 CCAGGCTCTCTGCTGGGTGCTGG - Intronic
961898413 3:130188645-130188667 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
962056616 3:131878876-131878898 CCAGGCCTTGTTCTAGGTTCTGG + Intronic
962160132 3:132990101-132990123 CCAGGCACTGTGCTGTATACTGG + Intergenic
962358310 3:134713906-134713928 CCAGGCACAGTTCTGAGCTCTGG - Intronic
962613675 3:137103364-137103386 CCAGGCCCTGTGCTGGGTGGGGG + Intergenic
962883934 3:139605566-139605588 CCAGGCTCTGTGCTGTTTACAGG + Intronic
963383684 3:144563420-144563442 CCAGGGTCTGTGCTCTGTTCTGG + Intergenic
963774752 3:149427204-149427226 CCAGGCACTGTTCTAAGTGCTGG - Intergenic
963867037 3:150372777-150372799 CCTGGCAGTGTGCTGAGTGCTGG + Intergenic
964128138 3:153258173-153258195 CTAGGCCCTGTGCTAAATACAGG - Intergenic
964191824 3:154011835-154011857 CCAGGCTCTGTGCTGGGTGCTGG + Intergenic
964473971 3:157082332-157082354 CCAGGCCCTGTGCTGGGCGCTGG + Intergenic
964733754 3:159894652-159894674 GCAGGCCCTGTGCTAGGCTCTGG - Intronic
964914547 3:161824077-161824099 TCAGGCCCTGTGCTAAGAGCTGG - Intergenic
965530746 3:169768087-169768109 ACTGGCCTTGTGCTGAATTCAGG - Exonic
965605142 3:170491063-170491085 CCAGGCACTGTGCTTAGTGATGG + Intronic
965629096 3:170712312-170712334 CCAGGCTCTGTGCTGGGCACTGG + Intronic
965664254 3:171075643-171075665 CCTGGCTCTGTGCTAAGTGCCGG + Intronic
965816566 3:172642846-172642868 CCAAGCCTTGTACTGGGTTCTGG + Intronic
966916297 3:184585906-184585928 CCAGGCACTGTGCTGGGCACTGG + Intronic
967093897 3:186160985-186161007 CCAGGCACTGTTCTACGTTCTGG + Intronic
967144152 3:186591981-186592003 CCAGGCACTGTGCTAGGTGCTGG + Intronic
967303601 3:188040110-188040132 CCAGGCCCTGTGCTAAGTGCCGG + Intergenic
967876025 3:194268974-194268996 CCAGCCACTGAGCTAAGTTCTGG + Intergenic
968123293 3:196141328-196141350 CCAGGCACTGTGGTGGGTTCTGG - Intergenic
968334591 3:197901923-197901945 CCAGGTGCTGTGCTGGCTTCAGG + Intronic
968549466 4:1214728-1214750 CCAAGCCCTGAGCTGAGGACTGG + Intronic
968731446 4:2271149-2271171 CCGGGCCCTGTTCTGACTCCAGG - Intronic
968732293 4:2275043-2275065 CCGGGCCCTGTTCTGACTCCAGG - Intronic
968841750 4:3012075-3012097 CCAGGCACTGTGCTGAGAGCTGG - Intronic
968979532 4:3839269-3839291 CCACGCTCTGGGTTGAGTTCAGG + Intergenic
969009401 4:4049153-4049175 CCAGGCACTGTGCTGTGTTGCGG - Intergenic
969045011 4:4330333-4330355 CCAGGCCCTCTCCTGGCTTCAGG - Intergenic
969291256 4:6241518-6241540 CCAGGCCCTGAGCTGGGCACTGG + Intergenic
969365228 4:6690257-6690279 CCAGTCCCTGTGCTGGGCTGGGG - Intergenic
969414085 4:7047592-7047614 CCAGCCCCTGTGGTGAGAACAGG + Intronic
969482272 4:7453095-7453117 TCAGGCACTGTGTTGGGTTCAGG + Intronic
969482325 4:7453339-7453361 TCAGGCACTGTGCTGGGGTCAGG + Intronic
969482426 4:7453827-7453849 CCAGGCACTGTGTTGGGGTCAGG + Intronic
969482470 4:7454039-7454061 CCAGGCACTGTGTTGGGGTCAGG + Intronic
969524005 4:7695067-7695089 CACAGCCCTGTGCTGAGCTCTGG - Intronic
969533837 4:7743944-7743966 CCAGGCCCTGGGCTGGGCTCTGG + Intergenic
969689485 4:8696366-8696388 CCAGGCTCTGTGCTGGTCTCTGG + Intergenic
969696322 4:8737174-8737196 GCAGGCACTGGGCTGAATTCTGG + Intergenic
969724058 4:8908669-8908691 CCAGGCCCTGTGCTGGGCGGGGG + Intergenic
969744955 4:9063171-9063193 CCAGGCACTGTGCTGTGTTGCGG + Intergenic
969804371 4:9595279-9595301 CCAGGCACTGTGCTGGGTGCTGG + Intergenic
970545216 4:17122375-17122397 ACAGGCCCGATGCTGTGTTCAGG - Intergenic
970553431 4:17207586-17207608 CCAGATACTGTGCTGGGTTCTGG - Intergenic
970782581 4:19756367-19756389 CCAGGGACTGTGCTGAGACCTGG - Intergenic
970784467 4:19780003-19780025 CCAGGGCCTGTCGGGAGTTCGGG - Intergenic
970855203 4:20643519-20643541 CCAAGCACTGTGCTTTGTTCTGG + Intergenic
972170402 4:36338712-36338734 CCAGGTTCTGTGCTGTGTTGAGG + Intronic
972277112 4:37567732-37567754 CCAGGCACTGTGCTAGGTTCTGG - Intronic
972435714 4:39033032-39033054 CCAGGTGCTGTGCTGAATTCTGG + Intergenic
972598865 4:40554086-40554108 CCAGGCACCGTGCTGGGTCCTGG - Intronic
972670035 4:41206390-41206412 CCTGGCACTGTGCTAAGTTCAGG - Intronic
972717712 4:41664321-41664343 CCTGGCCCTGTGCTAGGTACTGG + Intronic
973637371 4:52872536-52872558 CCAGGCACTGTGCTAGGTTCTGG - Intergenic
973745830 4:53962633-53962655 CCTGGCCCTGGGCAGGGTTCAGG - Intronic
973778334 4:54264466-54264488 CCAGGCACTGTGCTAGGTTCTGG + Intronic
973809678 4:54557701-54557723 CCAGGCCCTGTTCTAGGTGCTGG + Intergenic
974010772 4:56605276-56605298 CCAGGCCCTGTGCTTGGCACTGG + Intergenic
974026012 4:56733735-56733757 CCAGGCACTCTGCTAAGTGCTGG + Intergenic
974043610 4:56878815-56878837 CCAGGCACTGTGCTAGGTGCTGG + Intergenic
974089388 4:57295567-57295589 CCAGGGCCTGTGGTGAGGTGGGG - Intergenic
975633695 4:76424769-76424791 CTAGACCCTGTGCTGGGTACTGG + Intergenic
975821095 4:78271468-78271490 CCAGGCCCTGTTGTGGGTTGGGG - Intronic
976528156 4:86117417-86117439 CAAGGACCAGTGTTGAGTTCAGG + Intronic
976838632 4:89405455-89405477 CCAGGCACTTTGCTTGGTTCTGG + Intergenic
977171829 4:93771909-93771931 CCAGGCACTGTGCTAAGTTCTGG - Intronic
977190898 4:93999868-93999890 CCAGGCAATGTCCTGAGTGCTGG - Intergenic
977388970 4:96383544-96383566 CCAGGCACTGTGCTGAGTGTTGG + Intergenic
977656159 4:99523161-99523183 CCAGGCACTGTGCTGGGACCTGG - Intronic
978093860 4:104751310-104751332 CCAGGCACTAAGCTAAGTTCTGG + Intergenic
978264403 4:106805149-106805171 CCAGGCCCAGTGCGCAGTGCTGG - Intergenic
979100843 4:116611897-116611919 CCAGGAATTATGCTGAGTTCTGG - Intergenic
979448978 4:120846839-120846861 CCAGGCCCAATGCTGAGCACTGG - Intronic
979507077 4:121510528-121510550 CCAGGCCCCATGCTGAGCACTGG - Intergenic
980263282 4:130481845-130481867 TCAGGCCCTCCCCTGAGTTCTGG - Intergenic
980879046 4:138690847-138690869 CCAGGCCCTGTGCTAGATTCGGG - Intergenic
981095630 4:140776693-140776715 GCAGGCCTTGTGCTGGGTGCAGG + Intergenic
982114752 4:152088869-152088891 CCAGGCACTGTGCTAGGTGCTGG + Intergenic
982227637 4:153180910-153180932 CCAGGCATTGTCCTGAGTGCTGG + Intronic
982809786 4:159810875-159810897 CCAGGCACCGTGCTAAGCTCTGG - Intergenic
983639909 4:169935576-169935598 CCAGGCCCTGTACTCATTGCTGG + Intergenic
984552287 4:181174980-181175002 CCAGGCCCAGTTCTGGGTACTGG + Intergenic
984713196 4:182903182-182903204 ACAGGTCCTGTTCTGAGTACTGG - Intronic
984954752 4:185034216-185034238 CCAGACTCTGTGCTAAGTTCTGG - Intergenic
985170841 4:187148346-187148368 CCAAGCACTGTGCTAAGTACTGG + Intergenic
985631767 5:1017695-1017717 CCAGGGCCTGAGCTGCTTTCTGG + Intronic
985679423 5:1248198-1248220 GCAGGCCCTATGGTGAGTTGGGG - Intergenic
985778275 5:1856789-1856811 CCTGGCCCTGTGCTCAGCCCGGG - Intergenic
986209398 5:5656434-5656456 CCAGGCACTGTTCTGGGTACTGG - Intergenic
986728495 5:10617802-10617824 CCAGGCACAGTCCTGAGTTGGGG + Intronic
987031623 5:13981352-13981374 CCAGGCACGGTGCTGGGTGCTGG - Intergenic
987079672 5:14415353-14415375 CCAAGCTCTGCGATGAGTTCTGG - Intronic
987084774 5:14458298-14458320 CCAGGCACTGTGCAGAGCCCTGG + Intronic
988514997 5:31896530-31896552 CCAAGCCCTGTGCTAAGGGCTGG + Intronic
989159754 5:38379024-38379046 CCAGGCTCTGAGCTCTGTTCTGG + Intronic
989196497 5:38721772-38721794 CCAGGCACAATGCTGAATTCTGG + Intergenic
990360081 5:55009621-55009643 CCTGACCCAGAGCTGAGTTCAGG - Intronic
990988303 5:61661207-61661229 CCAGGCACTGTGCTGGGTGCTGG + Intronic
991184444 5:63790872-63790894 CCAGGCACTGTGCTAGGCTCTGG - Intergenic
991369104 5:65899794-65899816 CCAGGGCCTGTGCTAAGTTCTGG + Intergenic
991463178 5:66880872-66880894 CCAGGCACTGTGCTAAGTGCTGG + Intronic
992181717 5:74204081-74204103 CCAAGCACTGTGCTGTGTTCTGG + Intergenic
992349925 5:75918081-75918103 CCAGGCTCTGTGCTGAAAACTGG - Intergenic
992494962 5:77282909-77282931 CTAAGCCCTGTGCTGACCTCGGG + Intronic
992626998 5:78645317-78645339 CCAGGCTCTGTTCTGGGCTCTGG - Intronic
992763462 5:79972356-79972378 CCAAGCACTGTGCTCAGTGCTGG + Intergenic
993373513 5:87120457-87120479 TCAGGCACTGTTCTGAGCTCTGG - Intergenic
993436672 5:87904216-87904238 CCAGGCACTGTGCAGGGCTCTGG + Intergenic
993510733 5:88768589-88768611 CCAGGCCTTGTGCTAAGTTCTGG - Intronic
993751090 5:91668989-91669011 CCAGGCACTGTGTTAAGTCCTGG + Intergenic
994313840 5:98308902-98308924 CTGGGCACTGTTCTGAGTTCTGG + Intergenic
994384536 5:99114221-99114243 GTAGGCACTGTTCTGAGTTCTGG - Intergenic
994568438 5:101483246-101483268 TCAGGCCCTCCCCTGAGTTCTGG + Intergenic
995796267 5:115944856-115944878 CCAGGCACTGTGTTAAGTGCTGG - Intergenic
996105853 5:119501715-119501737 CCAGGCACTGTTATAAGTTCTGG + Intronic
996347545 5:122503032-122503054 CCAGGCCAGGTTCTGAGTTTGGG - Intergenic
996382210 5:122873667-122873689 CCAGGCACTGTACTGAGCCCTGG + Intronic
996624598 5:125555139-125555161 TCAGGCACTGTGCTGAGCACTGG - Intergenic
997409481 5:133680252-133680274 TGAGGCCCTGTGCTGAATTCTGG + Intergenic
997423642 5:133788119-133788141 CCAGGCCCTGGGCTGGGCGCTGG - Intergenic
997446958 5:133947313-133947335 CCAGGCCCTGTGCTGAGTTTTGG - Intergenic
997447332 5:133951303-133951325 TCAGGCCCTGTGCTGCGTGCTGG - Intergenic
997447610 5:133952863-133952885 TCAGGCCCTGTGCTGCGTGCTGG + Intergenic
997602499 5:135150109-135150131 CCAGGCCGTGGGCTGGGTTTGGG + Intronic
997796559 5:136816750-136816772 CCAGGTCGTGGGCAGAGTTCTGG + Intergenic
997826422 5:137110799-137110821 CCAGGCACTGTGCTAGGTGCTGG - Intronic
998006854 5:138662781-138662803 CCAGGCGCTGTCCTGGGTGCTGG - Intronic
998165154 5:139838540-139838562 CCAGGCCCAGTGCTGGGTACGGG + Intronic
998366287 5:141634624-141634646 GCAGGCCCTGTGCTAAGTGCTGG - Intronic
998387651 5:141767042-141767064 CCAGGCCCTGTGCTATGGGCTGG - Intergenic
998448600 5:142217337-142217359 CCAGGCGCTGTGCTCAGAACTGG - Intergenic
998805866 5:145917511-145917533 CCAGGTCCTGTGCTCAGTGCTGG + Intergenic
998850327 5:146345325-146345347 CGAGGCCCTGCGTTGAGTTCAGG - Intergenic
998885745 5:146692128-146692150 CCAGGCACTGTTCTGGGTGCTGG - Intronic
999080695 5:148840760-148840782 CCAGAACCTGTGCTAACTTCTGG + Intergenic
999095841 5:148977510-148977532 CCAGGCGCTGTGCTAAGAACAGG + Intronic
999216659 5:149941193-149941215 CCAGACACTGTGCTGGGTCCTGG + Intronic
999492841 5:152068537-152068559 CCAGGTACTGTGCTGGGTGCTGG - Intergenic
999519068 5:152331859-152331881 CCAAGCACTGTGCTGAATGCTGG + Intergenic
999677043 5:154014803-154014825 TCATGCCCTCTCCTGAGTTCTGG - Intronic
999825692 5:155271611-155271633 CCAGGCTCTGTGCTCAGGGCTGG + Intergenic
999827324 5:155286278-155286300 CCAGGCACTGTGCTGGATCCTGG + Intergenic
1000278806 5:159764259-159764281 CCAGGCACTGGGCTGGGTGCTGG - Intergenic
1000334913 5:160235022-160235044 CCAGGCTCTATGCTGAGTGCTGG + Intronic
1000379916 5:160619840-160619862 CCAAGCCCAGTGCAGAATTCTGG + Intronic
1000703237 5:164478916-164478938 CCAGGCTCTGTGCTAAGTACTGG - Intergenic
1000843023 5:166245259-166245281 CAAGACACTGTGCTGAGTGCTGG - Intergenic
1001054469 5:168437583-168437605 CCAGGCACTGTTCTGGGTGCTGG - Intronic
1001149352 5:169213776-169213798 CCAGGCACTGTTCTTAGTTCTGG - Intronic
1001164945 5:169356027-169356049 CCAGGCTCTCTGCTAGGTTCTGG + Intergenic
1001333401 5:170778192-170778214 CCAGGCACTGTGCTAAGTGCTGG - Intronic
1001414043 5:171530766-171530788 CCAAGCACTGTGCTGGGTGCTGG - Intergenic
1001431555 5:171666542-171666564 CCAGGCACTGTGCCAGGTTCTGG - Intergenic
1001561996 5:172675942-172675964 CCAGGCCCTGTGCTTTTTTGAGG + Intronic
1001626450 5:173139801-173139823 CCAGGACCTGTGCTAGGTACTGG + Intergenic
1001711613 5:173783430-173783452 CCAGGCACTGTTCTCAGTCCTGG - Intergenic
1001732075 5:173968186-173968208 CCAGTCCCAGTGCTGAGTTGAGG + Intergenic
1001840468 5:174872066-174872088 CCAGGCACTGTTCTGAGTTCTGG - Intergenic
1001949801 5:175808346-175808368 CCCGGCCCCGTGCAGAGCTCTGG + Intronic
1002026471 5:176399223-176399245 CCAGGCACTGTGCTGGGCTCTGG - Intronic
1002082553 5:176746102-176746124 CCAGGCCATGTGGGGTGTTCTGG + Intergenic
1002139568 5:177130836-177130858 CCAGGCAGTGTGCTGAGTGCTGG - Intergenic
1002160940 5:177313728-177313750 CCAGGCGCTGTGCTGGGGGCTGG + Intergenic
1002317094 5:178350341-178350363 CCAGGCACTGTGCTGGCTGCTGG - Intronic
1002453502 5:179332626-179332648 ACTGGCCCTGAGCTGAGGTCTGG - Intronic
1002700718 5:181122523-181122545 CCAGGGCCTCTGCTGAGCTCGGG + Intergenic
1002706244 5:181162359-181162381 CCAGGCCCTGGGCACAGTTTGGG - Intergenic
1002968922 6:1994505-1994527 CCAGGCACTGTGCTGAGTTTGGG + Intronic
1003110288 6:3247483-3247505 CCAGGCACTGTCCTGAGTGCTGG - Intronic
1003173929 6:3740943-3740965 CCAGGCACTGTGCTGGTTGCTGG - Intronic
1003200880 6:3959303-3959325 CCAGGCTTTGTGCTAAGTACCGG + Intergenic
1003259055 6:4500125-4500147 CCAGGCAGTGTGCTGGGTGCAGG - Intergenic
1003362658 6:5443627-5443649 CCAGGCCCTGAGGTTGGTTCGGG - Intronic
1003478086 6:6503618-6503640 CCAGGCATTGTGCTGAATGCTGG + Intergenic
1003510006 6:6771669-6771691 CCAGGGCCTGTGCTGATGTCTGG + Intergenic
1003616128 6:7656945-7656967 CCAGGCTCTTTCCTGAGTTTTGG + Intergenic
1003622599 6:7714323-7714345 CCAGGCACTGTGCTATGTGCTGG + Intergenic
1003626420 6:7745660-7745682 CAAGGCACTGTGGTGAGTACTGG + Intronic
1003641485 6:7878968-7878990 CCAGGCTCTGTGCTAGGCTCAGG - Intronic
1003885962 6:10521566-10521588 CCCGGCACTGTGCTAGGTTCTGG - Intronic
1003947904 6:11092206-11092228 CCAGGCACTGTTCTAAGTGCTGG - Intergenic
1004315491 6:14583600-14583622 GTAGGCCCTGTGCTAAGTGCTGG - Intergenic
1004347567 6:14862836-14862858 CCAGGCTCTGTGCTAGGATCTGG + Intergenic
1005198414 6:23315429-23315451 CCAGGCATTGTTCTGAGCTCTGG + Intergenic
1005513073 6:26529477-26529499 CCAGGCCCTGTGCTGGTCTCTGG + Intergenic
1005525206 6:26640704-26640726 CCAGGCACTTTTCTGAGTGCTGG - Intronic
1005531973 6:26716898-26716920 CCAGACACTGTGGTAAGTTCAGG - Intergenic
1005538822 6:26784767-26784789 CCAGACACTGTGGTAAGTTCAGG + Intergenic
1006500327 6:34454709-34454731 CCAGGCACTGTTCTAAGTGCTGG - Intergenic
1006735264 6:36268800-36268822 CCAAGCCCTGTGCTGTGTCGGGG - Intronic
1006925445 6:37651832-37651854 CCAGGCACTGTGCTAGGTCCTGG - Intronic
1006928074 6:37669800-37669822 CCAGGCACTGTGCTGGGCACTGG + Intronic
1006940633 6:37749794-37749816 CCAGGCACTGTGCTGGACTCAGG - Intergenic
1007013985 6:38444289-38444311 CCAGGCACTGTGCTGACTCCAGG - Intronic
1007413556 6:41678997-41679019 GCTGGCCCTGTGCTGGGTGCTGG - Intergenic
1007428549 6:41762913-41762935 CCAGGCACTGTGCTGAGTGCTGG - Intergenic
1007681297 6:43635539-43635561 CCAGGCCCTGTCCTAGGTGCTGG - Intronic
1007958401 6:45937617-45937639 CCAGGTACTGTGCTAGGTTCTGG - Intronic
1007995867 6:46307164-46307186 CCAGGCACTGTGCTGGGTGCTGG + Intronic
1008047848 6:46869617-46869639 CTAGACCCAGTGCTGAGTACTGG - Intronic
1008500740 6:52179865-52179887 CCAGGCACTGTGCTGGACTCAGG - Intergenic
1008544000 6:52569779-52569801 TCTGGGCCTGTGCTGAGCTCTGG - Intronic
1010164655 6:72901137-72901159 CCAGGCCCTGTTGTGGGGTCGGG - Intronic
1010490895 6:76475512-76475534 CCATGGCCTGTGCAGAGTCCTGG + Intergenic
1011271187 6:85581037-85581059 CCAGCGCCTGTGCTGGCTTCAGG + Intronic
1011745388 6:90403109-90403131 CCAGGCACTGTGCTATGTCCCGG + Intergenic
1011789806 6:90885807-90885829 TCATGCCCTGCCCTGAGTTCTGG + Intergenic
1012037583 6:94162678-94162700 CCAGGCACTGTCCTGATTACTGG + Intergenic
1012762253 6:103317339-103317361 CAAGGCCCTGGGATGAGTCCAGG - Intergenic
1012943829 6:105445183-105445205 CAAAGCCCTGTGCTGAGTGTTGG - Intergenic
1013006295 6:106077282-106077304 CCAGGCACTGTGCTAAGGGCTGG + Intergenic
1013611136 6:111796668-111796690 CCAGGCCCTGTTCTGAGAGCTGG + Intronic
1013639383 6:112058439-112058461 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1014337798 6:120159756-120159778 CCAGGGCCTGTGCAGAGGTGGGG - Intergenic
1015446516 6:133311810-133311832 ACCGGCACTGTGCTGAGTACTGG + Intronic
1015954588 6:138586758-138586780 CCAAGCCCTGTGCTTGGCTCTGG - Intronic
1016279484 6:142398954-142398976 CCAGGGAATGTGCTGGGTTCTGG - Intronic
1016372871 6:143392742-143392764 CCAGGCACTGTGCCAAGCTCCGG + Intergenic
1017035817 6:150266280-150266302 GCAGGCACTGTGCTGGGTGCTGG - Intergenic
1017137118 6:151157701-151157723 CCAGGCGCTGTGCTAAGCACTGG - Intergenic
1017307687 6:152938304-152938326 CCAAGCACTGTGCTGTGTTCAGG - Intergenic
1017699975 6:157059618-157059640 CCAGGCCCTGTGGAAAGCTCTGG + Intronic
1017707931 6:157140984-157141006 CCAGGCTCTGTGCTAAATGCTGG - Intronic
1017924722 6:158901162-158901184 CCCGGTGCTGTGCTGACTTCAGG - Intronic
1017942318 6:159063751-159063773 CCAGGCTCTGGGCTGATTGCAGG + Intergenic
1018074887 6:160203227-160203249 CCAGGGCCTGGGGTGTGTTCAGG - Intronic
1018486585 6:164246589-164246611 CCAGGCCCTGTTCTAAGCACTGG - Intergenic
1018903168 6:168061212-168061234 CCAGGCCTTGTGCTCAGGTGAGG + Intronic
1018903213 6:168061416-168061438 CCAGGCCTTGTGCTCAGGTGAGG + Intronic
1018915496 6:168130208-168130230 GCAGTCCCCGTGCTGAGCTCTGG + Intergenic
1018931069 6:168240740-168240762 CCAGGCACTGAGCTGGGTGCTGG + Intergenic
1019034555 6:169043380-169043402 CCAGGCTCAGTGCTGGGCTCTGG + Intergenic
1019323620 7:426557-426579 CCAGGACTTGTGCTGGGTGCAGG + Intergenic
1019344855 7:524525-524547 CCAGGCACTGTACTAAGTGCTGG + Intergenic
1019359069 7:595467-595489 CCAGGCCCTGTTCTGGGTGCAGG - Intronic
1019372854 7:672078-672100 CCAGGCTCCGTGCAGGGTTCTGG - Intronic
1019424001 7:964645-964667 ACAGGTCCAGTGCTGAGCTCCGG + Intronic
1019533353 7:1514670-1514692 CCAGGCCCATGGCGGAGTTCAGG + Intergenic
1019603629 7:1897754-1897776 CCTTGCCCTGTGCTGGCTTCTGG + Intronic
1019634611 7:2068924-2068946 CCTGGCCTGGTGCTGAGCTCTGG - Intronic
1019758447 7:2790497-2790519 CCAGGCCCTGTGCTGAAGTCAGG - Intronic
1020373641 7:7461387-7461409 TCACGCCCTTTCCTGAGTTCTGG - Intronic
1020431597 7:8121327-8121349 CCAGGCACTGAGCTGTGTTCTGG + Intronic
1020505397 7:8980703-8980725 CCAGGCACTGTGCTAAGTGTTGG - Intergenic
1021404599 7:20250431-20250453 CCAGGCACAGTGTTGAGTACTGG + Intergenic
1021411791 7:20337417-20337439 ACAGGCACTATACTGAGTTCTGG + Intronic
1022785094 7:33630874-33630896 CCAGGCACTGTGCTTAGTGTTGG + Intergenic
1022845602 7:34206720-34206742 CCAGGCACTGTGCTGGGTTCTGG - Intergenic
1023934000 7:44726147-44726169 CTTGGCCCTGTGTTGATTTCGGG - Intergenic
1024280462 7:47714844-47714866 CCATGCTCTGAGCAGAGTTCCGG + Intronic
1024332824 7:48173359-48173381 CCAGGCACTGTTCTGGGTGCTGG - Intronic
1024868011 7:53925972-53925994 CCAGGTCCTGTTCTGGGCTCTGG - Intergenic
1024894533 7:54242696-54242718 TCAGGCACTGTGCTAAGTTCAGG + Intergenic
1025231570 7:57206281-57206303 CCAGGCACTGTGCTAGGTGCAGG + Intergenic
1025247341 7:57327248-57327270 CCAGGCCCTGTCCTTGGTGCTGG - Intergenic
1025927341 7:65970454-65970476 CCTGGCCCCGTGTTGTGTTCTGG - Intronic
1026640549 7:72120848-72120870 CCAGGCCCTGTGCTGCATGTGGG - Intronic
1027140542 7:75653928-75653950 CCAGGCCCTATTTTGAGTGCTGG + Intronic
1027413905 7:77953285-77953307 CCAAGCCCTGTGCTAGGCTCTGG - Intronic
1028000344 7:85488885-85488907 CCAGGTGCTGTGCTCAGTCCAGG + Intergenic
1028416581 7:90587054-90587076 CCAGGTACTGTGCTAAGATCTGG - Intronic
1029068358 7:97874676-97874698 CCAGGCACTGTGCTGTGTTGCGG - Intergenic
1029870233 7:103683275-103683297 CCAGGCACTGTGCTAAGACCTGG - Intronic
1030082417 7:105789291-105789313 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1030099611 7:105933900-105933922 CCAGGCCCTCTGCTAAGCACTGG + Intronic
1030565740 7:111152870-111152892 CCTGGCACTGTCCTAAGTTCTGG - Intronic
1030673116 7:112358845-112358867 CCAGGCCCTGTACTCAATACTGG + Intergenic
1030687506 7:112502457-112502479 CCAGGCCCTGTGCAGAGTGCTGG + Intergenic
1031864697 7:127025583-127025605 CCAGGCCCTGTGCTAGGTGCAGG + Intronic
1032740978 7:134739004-134739026 CCAGGACATGTGCTAAGTTGTGG - Intergenic
1034075883 7:148230839-148230861 CCAGGTACTGTGCTGGGCTCTGG - Intronic
1034120746 7:148625361-148625383 CCAGGCACTGTGCTGAAAGCTGG + Intergenic
1034166271 7:149027713-149027735 CCAGTCCCTGTACTGGGTTCTGG - Intronic
1034311996 7:150096813-150096835 CCAGGGCCTGTTCTGAGCTTAGG + Intergenic
1034657666 7:152742154-152742176 CCAGGCTCTGTGCTGGGTGCAGG + Intergenic
1034745488 7:153520108-153520130 CCAGGCACTGTGCTGAGTGATGG + Intergenic
1034819403 7:154202834-154202856 CCAGGTTCTGTGCTTAGCTCTGG - Intronic
1035208326 7:157309453-157309475 CCAGCCCCTGTGACGAGTGCTGG - Intergenic
1035705355 8:1670536-1670558 CCAGGCACAGTGCTGGGTGCAGG - Intronic
1036250683 8:7159828-7159850 CCAGGCACTGTGCTGTGTTGCGG - Intergenic
1036366806 8:8127626-8127648 CCAGGCACTGTGCTGTGTTGCGG + Intergenic
1036588873 8:10149476-10149498 CCAGGGCCTGTGCTGATTGAAGG + Intronic
1036759517 8:11497573-11497595 CCAGGCACTGCGCTGGGTGCTGG - Intronic
1036884074 8:12538035-12538057 CCAGGCACTGTGCTGTGTTGCGG - Intergenic
1037296899 8:17411457-17411479 CCAGGCTCTGTGTTAAGTGCTGG - Intronic
1037407754 8:18562148-18562170 GCAGGCACTGTGCTGGGTGCTGG + Intronic
1037734281 8:21554523-21554545 CCAGGCCCTGTGCTAGGTTTTGG - Intergenic
1037879130 8:22564658-22564680 CCAGCCACTGTCCTGAGTGCTGG - Intronic
1038062709 8:23930276-23930298 CCTGGCCCTGGGCTGGGGTCAGG - Intergenic
1038412541 8:27369294-27369316 CCAGGCCCTGTGCTGGGCCTGGG + Intronic
1038532777 8:28331859-28331881 CCACACACTGTGCTGAGTGCTGG - Intronic
1039425047 8:37478626-37478648 CCAGGCACTGTGCTAGGTACTGG + Intergenic
1039949947 8:42162544-42162566 CCAGGCACTGTGCTGGGTACTGG + Intronic
1040575398 8:48647233-48647255 CCAGGCGCTATGTTGAGTGCTGG - Intergenic
1041081885 8:54222056-54222078 CCAGGCCATGGGCTGCGCTCGGG + Intergenic
1041261333 8:56022820-56022842 TCAAGCCCTGTGCTGGGTGCTGG + Intergenic
1041522140 8:58768477-58768499 CCAGGCACTGTGCTGGGCCCAGG + Intergenic
1042673301 8:71287773-71287795 CCAGGCACTGTGCTTGGTGCTGG - Intronic
1043047999 8:75352093-75352115 TCACGCCCTGCCCTGAGTTCTGG - Intergenic
1044448524 8:92306383-92306405 CTAGGCACTGTGCTGGGTGCTGG + Intergenic
1044488389 8:92781687-92781709 CCAGGCAATGTGCTGGGTGCAGG + Intergenic
1044929127 8:97234904-97234926 CCAGGCCCTGTGCTATGCTCTGG - Intergenic
1045182399 8:99798565-99798587 CCAGTCCCAGGGCTGATTTCTGG + Intronic
1045406005 8:101867382-101867404 CCAGGCACTGTGCTAGGTCCTGG - Intronic
1045554432 8:103201774-103201796 CCAGGCTCTATGCTGGGTGCTGG - Intronic
1046054954 8:109068254-109068276 CAAGGCCCTGTAGTAAGTTCTGG - Intergenic
1046109463 8:109704590-109704612 CCATGCACTGTGCTTAGTACAGG - Intergenic
1046249524 8:111611870-111611892 CCAGGGCCTGTGCTGGCTCCTGG - Intergenic
1046752751 8:117942376-117942398 CCAGCCTCTGTGCTAGGTTCTGG - Intronic
1046860616 8:119087205-119087227 CCAGGCACTGTGCTAAATTCTGG + Intronic
1047523269 8:125612030-125612052 CCAGGCCCTGTTCTGGGCTCTGG + Intergenic
1047720959 8:127638668-127638690 CTAGGCACTGAGCTGGGTTCAGG - Intergenic
1047730767 8:127726221-127726243 CCAGGCATTGTGCTGGGCTCTGG + Intergenic
1047786714 8:128160541-128160563 CCACTCCCTGTGCTGAGACCTGG + Intergenic
1047909178 8:129508708-129508730 ACAGGCTCTGTGCTGAGTACTGG - Intergenic
1047928897 8:129706940-129706962 CCAGGCACTGTGCTAGGTTCTGG + Intergenic
1048285049 8:133135033-133135055 CCAGGCCCTGTGCTGGGTGCTGG + Intergenic
1048419989 8:134268647-134268669 CCAGTTCCTGTGCTCAGTGCTGG + Intergenic
1048565983 8:135597671-135597693 TCAGGCACTGTGCTGAGCACCGG - Intronic
1048791694 8:138110131-138110153 CCAGACACTGTGCTGGGTTCTGG + Intergenic
1048851623 8:138650845-138650867 TCAGGCACTGTGCTAAGTTTGGG + Intronic
1049009305 8:139876614-139876636 CCAGGCACTGTCCTCAGTGCTGG - Intronic
1049031964 8:140044584-140044606 CCAGGCTCTGTGCTGTGCCCTGG - Intronic
1049126619 8:140794984-140795006 CAAGGCCCTGTGATGACTGCTGG - Intronic
1049152256 8:141042617-141042639 TCAGGCCCTGGGCTCAGCTCAGG - Intergenic
1049245561 8:141560448-141560470 CCAGGCTCTGTGCTGAGGGCAGG + Intergenic
1049389347 8:142360107-142360129 CAAAGCACTCTGCTGAGTTCAGG + Intronic
1049417768 8:142503360-142503382 CCAGGCCCTGTACTGGGCACTGG - Intronic
1049424308 8:142531320-142531342 ACAGGCCCTGTGCCAAGTGCAGG + Intronic
1049555749 8:143280964-143280986 TCAGGCCCTGTGCTAGGTGCTGG - Intergenic
1049700209 8:144007555-144007577 CCGGGGCCTGTGCTGAGCTCTGG + Intronic
1050064355 9:1743258-1743280 TCAGTGCCTGTGCTGAGTTTGGG + Intergenic
1050072987 9:1835815-1835837 CCAGGCCCTGTTCTAGGTACTGG - Intergenic
1051048910 9:12908420-12908442 CTAGGCCCTGTATTAAGTTCAGG - Intergenic
1051217199 9:14811066-14811088 CCCAGCCCTGGGCTGAGATCAGG - Intronic
1051852388 9:21524690-21524712 TCTGGTCCAGTGCTGAGTTCAGG + Intergenic
1052275013 9:26665522-26665544 CCAGGCACTGTGCTAAGCACTGG - Intergenic
1052338099 9:27339542-27339564 CCAGGCACTGTGCTCAATGCTGG + Intronic
1052833278 9:33232623-33232645 CCAGGCCCTGGGCAGAGCACTGG + Intronic
1052868338 9:33480146-33480168 ACAGGCCCTGTGCTAATATCAGG - Intergenic
1052977597 9:34422843-34422865 CTAGGCACTGTGCTGGGTTCTGG + Intronic
1053174094 9:35909913-35909935 CCTGGCCCTGTGCTGGGGGCAGG - Intergenic
1053422047 9:37985870-37985892 CCAGGCACTGTCCTGTGTCCTGG + Intronic
1054872204 9:70058165-70058187 CCAAACACTGTGCTGAGTGCAGG + Intronic
1055261814 9:74445719-74445741 CCAGGCCTTGTGGTCAGTTTTGG + Intergenic
1055640606 9:78316212-78316234 CCAGGCCCTGTGCTAAGCGTTGG + Intronic
1055651247 9:78409418-78409440 CCAGGCACTGGGCTGAGTGCAGG + Intergenic
1055964201 9:81849643-81849665 CCAGGCACTGTGCTGGGCTCTGG + Intergenic
1055989820 9:82093586-82093608 CAAGGCACTGTGCTAACTTCTGG + Intergenic
1055994584 9:82143678-82143700 CCAGCCCTTGTGCTGAGCTCTGG + Intergenic
1056271882 9:84954957-84954979 TCTGGCACTGTGCTGGGTTCAGG - Intronic
1056315753 9:85388269-85388291 CTAGGCTCTGTACTGGGTTCTGG + Intergenic
1057488149 9:95502184-95502206 CCAGCCCCTGTGCCTAGCTCAGG + Intronic
1057570182 9:96198417-96198439 CCAGGCCTTGTCCTAAGTGCTGG + Intergenic
1057845078 9:98516715-98516737 CCAAGCCTTGTGCTGGGTCCTGG - Intronic
1057900253 9:98943146-98943168 CCAGGCCCTGTGATGAGATGTGG - Intergenic
1058003532 9:99891715-99891737 TCAGCCACTGTGCTGAGTCCTGG - Intergenic
1058145199 9:101402744-101402766 CCTGGCTCTGTGCTAAGTGCTGG - Intronic
1058217624 9:102254687-102254709 CCAGCCCCTGTGCTAAGTCCAGG + Intergenic
1058241702 9:102569947-102569969 CCCAGCACTGTGCTGGGTTCAGG + Intergenic
1058704324 9:107626226-107626248 CCACGCCTTGTGCTGGGCTCTGG + Intergenic
1058822662 9:108746927-108746949 CCAAGCCCTGTGCTGGGCACTGG + Intergenic
1058878266 9:109262951-109262973 CCAGGCCCAGTGCTTAGCTTTGG - Intronic
1058910638 9:109517251-109517273 CCAAGCCCTGTGGAGAGTTCTGG - Intergenic
1058910916 9:109519106-109519128 TTAGGCCCAGTGCTGGGTTCTGG - Intergenic
1059325131 9:113499638-113499660 CTGGGCCCTGTGCTGGGTGCTGG + Intronic
1059353779 9:113684473-113684495 CCAGGCCCTGTGCGAAGCACTGG + Intergenic
1059385850 9:113963790-113963812 CCAGGCCCTGAGCTGGGTGCTGG + Intronic
1059534861 9:115071122-115071144 CCATGCTCTGTGCTAAGTTCTGG - Intronic
1060039412 9:120286843-120286865 CCAGGCACTATGCTGGGTGCTGG - Intergenic
1060059115 9:120443346-120443368 CCAGGCAGTGGGCTGGGTTCTGG - Intronic
1060153756 9:121304819-121304841 CCAGGCCCTGTGATGGGTGCTGG + Intronic
1060190553 9:121589651-121589673 CCAGGCTCTGGGCTGGGTGCTGG - Intronic
1060281403 9:122218206-122218228 TCAGGCCCTGGGCTGACTTCTGG - Intronic
1060300987 9:122374487-122374509 CCTGGCCCTGTGCTGAGTATGGG + Intronic
1060393951 9:123302630-123302652 CCAGGCCTTGAGCTGTGTTGTGG - Intergenic
1060400207 9:123344234-123344256 CCAGGCCCTGTGCTAGATGCTGG - Intergenic
1060517601 9:124275728-124275750 CCAGGCCCTGGGCTGAGCACTGG - Intronic
1060527873 9:124330685-124330707 CCTGGCCCTGGGCTGTGTGCTGG + Intronic
1060663648 9:125419667-125419689 CCAGGCTCTGAGCTCAGTTAGGG - Intergenic
1060774640 9:126364014-126364036 CCAGGCCCTGTGCTGGGTACTGG - Intronic
1061026299 9:128051944-128051966 CCAGGCCCTGTGCAGGGCTCTGG + Intergenic
1061054711 9:128216178-128216200 CCGGGCCCTGTGCCGGGCTCTGG - Intronic
1061091118 9:128427066-128427088 CCAGGCTCTGTGCTCAATGCTGG + Intronic
1061191025 9:129082788-129082810 CCAGGCCCTGTGCTGGGCTTGGG + Intronic
1061211536 9:129196325-129196347 CCAGGCACTGTGCTGGGCACAGG - Intergenic
1061294540 9:129669756-129669778 TCAGGCCCTGAGCTGAGCCCTGG - Intronic
1061571141 9:131478067-131478089 CCAGGCCCTGGGCTGGGTTCTGG + Intronic
1061614417 9:131770476-131770498 CCAGACCCTGTGCTAGGTACTGG + Intergenic
1061618027 9:131792888-131792910 CCAGGCCCTGTGCTAGGCTCTGG - Intergenic
1061621137 9:131812040-131812062 CCAAGCCTTGTGCTGGGCTCAGG - Intergenic
1061627636 9:131850728-131850750 TAAGGCCCTGTGCTGAGGACAGG + Intergenic
1061922576 9:133790114-133790136 CCAGGCCCTGTACCCAGTCCTGG - Intronic
1062000935 9:134215334-134215356 TCAGGCCCTGTGCTGGGGTTGGG + Intergenic
1062175525 9:135160044-135160066 CCAGGCCCTGTGCAAAGCGCTGG + Intergenic
1062382016 9:136291098-136291120 CCAGGCCCTCTGCGGACTGCAGG + Exonic
1186508320 X:10111426-10111448 CCAGCCCAGGTGCTGAGTCCTGG + Intronic
1186959853 X:14723986-14724008 CCAGGCACTGTGCTATGTGCCGG - Intronic
1187304380 X:18082033-18082055 TCAGGCGCTGTGCTAAGTACGGG - Intergenic
1187564854 X:20438988-20439010 CCAGGCATTGTGCTAAGTGCTGG + Intergenic
1187679386 X:21751661-21751683 CCAGGCACTGTGCTAAGTGTAGG - Intronic
1187731343 X:22258212-22258234 TCAGACCCTGTTCTGAGTGCTGG - Intergenic
1187804603 X:23105269-23105291 GCAGGCACTGTGCTGAGTCCTGG - Intergenic
1188358197 X:29219342-29219364 CCAGGCCCTGTGCTAGGACCTGG + Intronic
1188468400 X:30508975-30508997 CCAGGCACTGTGCTAGGTCCTGG + Intergenic
1188742885 X:33808492-33808514 CCAAGCACTGTGCTGGCTTCAGG - Intergenic
1189358241 X:40327735-40327757 CCAGGCCTTCTGCTGACTGCTGG - Intergenic
1190242467 X:48668138-48668160 CCAGGCCCCATGCTGAGCCCGGG - Intergenic
1190407930 X:50106019-50106041 CTAGGCACTGTGCTGAGTGCTGG + Intergenic
1190449591 X:50565283-50565305 CCAGACCCTGTGCTAGGTGCTGG - Intergenic
1190736659 X:53259922-53259944 CCAGGCACAGTGCTGGGTGCTGG + Intronic
1190752426 X:53373763-53373785 TCAGGCCCTGTGCTAGGTTCTGG - Intergenic
1190931033 X:54949965-54949987 CGTGGCCCTGTGCTGGGTGCTGG + Intronic
1191039827 X:56067611-56067633 CCTGGCTCTCTGCTGAGTCCAGG - Intergenic
1192295218 X:69840417-69840439 CCAGGCACTGTTCTGTATTCTGG - Intronic
1192322906 X:70106480-70106502 CCAGGCACTGTGCTAACTGCTGG - Intergenic
1192478090 X:71460919-71460941 CCAGGCACTGTGCTAGGCTCTGG + Intronic
1192534707 X:71917515-71917537 CCCTGCCCTGTGCTGATTTCTGG + Intergenic
1192544065 X:71998172-71998194 CCAGGCCCTGAGCTGAGAGCTGG + Intergenic
1192588394 X:72339289-72339311 CTAGGCCCTGTGCTGGGTGCTGG + Intronic
1192656832 X:73002366-73002388 CCAGGCCCTGTTCCCAGTCCTGG + Intergenic
1192665288 X:73080635-73080657 CCAGGCCCTGTTCCCAGTCCTGG - Intergenic
1192773782 X:74221095-74221117 CCAGGCACTGTGCTGGGTAGTGG - Intergenic
1195019530 X:100812750-100812772 TCACGCCCTCCGCTGAGTTCTGG + Intergenic
1195151019 X:102070366-102070388 CAAGGTCCTGTGCTCAGTTAAGG + Intergenic
1195244322 X:102981866-102981888 CCAAGCACTGTGCTTAGTGCTGG + Intergenic
1195461083 X:105125244-105125266 CCAGGCACTGTGCTAAGTTCTGG - Intronic
1195653822 X:107315178-107315200 CCAGGCACTATGCTAAGCTCTGG + Intergenic
1195928299 X:110048432-110048454 CCAGGCACTATGCTAAGTGCTGG - Intronic
1195928776 X:110052574-110052596 CCAGGCACTGTGTTAAGTTCTGG + Intronic
1195996986 X:110741480-110741502 GCTTGCACTGTGCTGAGTTCAGG - Intronic
1196947509 X:120842394-120842416 CCAGGCCCTGTGCTAGATGCTGG - Intergenic
1197384989 X:125791439-125791461 CCAGGCCCTGTTGTGGGGTCGGG + Intergenic
1197543512 X:127794729-127794751 CCAGGGCCTGTTCTGGGTTTGGG + Intergenic
1197626958 X:128813015-128813037 CCAGACACTGTGCTGGGTGCTGG - Intergenic
1197648515 X:129041650-129041672 CCAGGCCCTGCGCTCAGTGTGGG + Intergenic
1197715581 X:129703942-129703964 CCAGGCTCTCTGCTGGGGTCTGG - Intergenic
1197717055 X:129717151-129717173 CCAGGCACTGTGCTAGGTGCTGG - Intergenic
1197777530 X:130128977-130128999 GCAGACCCTGTGCTAAGCTCTGG + Intergenic
1198529134 X:137532499-137532521 CTAGGCACTATGCTGTGTTCTGG + Intergenic
1198587975 X:138143890-138143912 CCAGGCTCTGTGCTAGGTCCTGG + Intergenic
1198666869 X:139034146-139034168 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1198675512 X:139126518-139126540 CCAGGCCATGCCCTGTGTTCTGG - Intronic
1198738899 X:139819853-139819875 CCAGGCACTGTGTTGAGTGTTGG - Intronic
1198788288 X:140314431-140314453 CCAAGTACTGTGCTGACTTCAGG + Intergenic
1198863852 X:141099322-141099344 ACAAGCACTGTGCTGGGTTCTGG + Intergenic
1198898836 X:141488093-141488115 ACAAGCACTGTGCTGGGTTCTGG - Intergenic
1199258646 X:145745322-145745344 CCCAGCACTGTGCTGACTTCAGG + Intergenic
1199267701 X:145847616-145847638 CCAGGCACTGTGCAAAGTCCTGG - Intergenic
1199767620 X:150952583-150952605 CCAGGCACTGAGCTGAGCCCTGG - Intergenic
1199783451 X:151083419-151083441 CCAGGCACATTGCTGGGTTCTGG + Intergenic
1199872826 X:151913567-151913589 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199873005 X:151914255-151914277 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199873185 X:151914937-151914959 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199873358 X:151915616-151915638 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199873532 X:151916299-151916321 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199873712 X:151916981-151917003 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199873885 X:151917660-151917682 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199874063 X:151918335-151918357 CCAGGCCCTGTGAGGAGTCAAGG + Exonic
1199874237 X:151919016-151919038 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1199874413 X:151919701-151919723 CCAGGCCCTGTGAGGAGTCAAGG + Intronic
1200296125 X:154922415-154922437 CCAGGCACTGTTCAAAGTTCTGG + Intronic
1200361781 X:155614156-155614178 CCAGGCACTGTACTAAGATCTGG + Intronic
1200688738 Y:6283272-6283294 ACAAGCACTGTGCTGGGTTCTGG + Intergenic
1201012925 Y:9566917-9566939 ACAAGCACTGTGCTGGGTTCTGG + Intergenic
1201046534 Y:9891449-9891471 ACAAGCACTGTGCTGGGTTCTGG - Intergenic
1202128148 Y:21586653-21586675 CCAGGCCTGATGGTGAGTTCTGG + Intergenic