ID: 1085084330

View in Genome Browser
Species Human (GRCh38)
Location 11:73656649-73656671
Sequence CCTGGCATGGGGTGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3259
Summary {0: 1, 1: 1, 2: 97, 3: 731, 4: 2429}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085084320_1085084330 -4 Left 1085084320 11:73656630-73656652 CCCAGAACTCAGCACAGGGCCTG 0: 1
1: 5
2: 46
3: 280
4: 1182
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084319_1085084330 -3 Left 1085084319 11:73656629-73656651 CCCCAGAACTCAGCACAGGGCCT 0: 1
1: 4
2: 28
3: 222
4: 1016
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084316_1085084330 15 Left 1085084316 11:73656611-73656633 CCTGAATCTTTTCTCTGTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429
1085084321_1085084330 -5 Left 1085084321 11:73656631-73656653 CCAGAACTCAGCACAGGGCCTGG 0: 1
1: 4
2: 41
3: 274
4: 1113
Right 1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG 0: 1
1: 1
2: 97
3: 731
4: 2429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085084330 Original CRISPR CCTGGCATGGGGTGGGTGGC AGG Intronic
Too many off-targets to display for this crispr