ID: 1085087590

View in Genome Browser
Species Human (GRCh38)
Location 11:73681290-73681312
Sequence CTGAGAATACAGATGTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085087590 Original CRISPR CTGAGAATACAGATGTAACA AGG Intronic
902698164 1:18154331-18154353 CTGAAAAAAAAGATGTAAAATGG - Intronic
902953893 1:19911219-19911241 CTGAGTCTAAAGATTTAACATGG - Exonic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904017519 1:27434082-27434104 CTGAGAATATAAAAGTTACAGGG + Intronic
904026040 1:27504339-27504361 CTGAGAAGCCAGAGGTTACAGGG + Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905600574 1:39246776-39246798 CTGAGATTACAGGTGTGAGAGGG + Intronic
906317045 1:44793165-44793187 CAGAGATTAGAGAGGTAACATGG + Intergenic
908685171 1:66709625-66709647 GTGAGAATACAGAGGAAAAAGGG - Intronic
909966341 1:81915434-81915456 CTGAGAATACAGGTGTGAATTGG + Intronic
910774100 1:90857774-90857796 CAGAGAACACAGAAATAACAGGG + Intergenic
911053765 1:93694081-93694103 ATGAGAATACAGATCTGACCAGG + Intronic
912574026 1:110648105-110648127 CTGTGAATACAGAGATTACAAGG + Intergenic
914000048 1:143686121-143686143 CTGATAAGACACATGTAGCAGGG + Intergenic
914195183 1:145444634-145444656 CTGACAAGACACATGTAACAGGG + Intergenic
914476454 1:148027210-148027232 CTGACAAGACACATGTAACAGGG + Intergenic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
916980544 1:170131572-170131594 ATGAGACCACAGAAGTAACAGGG - Intergenic
921633915 1:217468800-217468822 GTGGGGATACAGATGAAACAGGG + Intronic
924424700 1:243940653-243940675 CTGAGAACACAGCTGACACATGG - Intergenic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
1062886045 10:1016776-1016798 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886049 10:1016816-1016838 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886054 10:1016856-1016878 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886059 10:1016896-1016918 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886063 10:1016936-1016958 AAGAGAAAAGAGATGTAACAGGG + Intronic
1063195688 10:3740629-3740651 CTGAGAAAACAGAGGTATTAAGG - Intergenic
1068067315 10:52148171-52148193 ATGAGAATACATAAGTGACAAGG - Intronic
1070239439 10:74663358-74663380 CTGGGAATACAGATGTGAATAGG - Intronic
1071380474 10:85054107-85054129 CTGAAATTACAGATTTAAAATGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1074624982 10:115173061-115173083 CTGAGAAAACAGAAGTAATCAGG + Intronic
1075172921 10:120132407-120132429 ATGAGATTACAAATGTAACCTGG - Intergenic
1075731684 10:124640191-124640213 CTGAGAATGCACCTGTAGCAAGG - Intronic
1078912677 11:15747607-15747629 TTGAGAGTAGAGAGGTAACAAGG + Intergenic
1081566487 11:44264067-44264089 CTGAGAACACAGATGCCACAAGG - Exonic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082613198 11:55327699-55327721 CTGAAAAGACAGAAGTAACTGGG - Intergenic
1082631556 11:55548361-55548383 TAGAGAAAACTGATGTAACATGG + Intergenic
1085050494 11:73377631-73377653 CTGAGAATACAGATTACACAGGG - Intronic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1090231263 11:125106561-125106583 ATGAGAATAAATATGTAAAAAGG + Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1092615091 12:10209876-10209898 CTGGGATTACAGATGTAATCCGG - Intergenic
1094548672 12:31429345-31429367 CAGAGAAGTCAAATGTAACAAGG + Intronic
1096270108 12:50158960-50158982 CCGAGAAGATAGATGTAAAAAGG + Intronic
1096931914 12:55220911-55220933 CTGAGAATAAAGATGTTTTATGG + Intergenic
1097042624 12:56164732-56164754 CTGAGAATAAAGATGAGAGATGG + Intronic
1097461086 12:59862710-59862732 TTGGGAATAGAGATTTAACAAGG - Intergenic
1100657029 12:96658269-96658291 CTGAGAATACAGAAGTTCAAGGG + Exonic
1102196012 12:111025643-111025665 CTGAGAATCCAGAAGTTCCAAGG + Intergenic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1105562457 13:21506811-21506833 CTGAAAATACAGGAGTGACAGGG - Intronic
1105810774 13:23993261-23993283 CTTGGACTACAGATGTAACTGGG - Intronic
1106972689 13:35162163-35162185 CTCTGAATACACATGTCACAGGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108985483 13:56581048-56581070 CTGAGGATAAACATGGAACAAGG - Intergenic
1109769228 13:66948584-66948606 CTGAGAATACTTTTGTATCATGG - Intronic
1110353929 13:74543738-74543760 CTGAGAATACAGTGATATCATGG - Intergenic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1111394594 13:87648668-87648690 CTAAGAAAACAGATGTAAGCTGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1113278591 13:108763165-108763187 TTGAGAGTACAGGAGTAACAAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1116409720 14:44607164-44607186 CACAGAGTACATATGTAACATGG - Intergenic
1117215900 14:53551341-53551363 CTGAGAATAGAGAGATAACAAGG - Intergenic
1117221077 14:53607007-53607029 CTGAGAATACAAACGTAAGCTGG + Intergenic
1117784974 14:59273877-59273899 CTCAGAAAACACATGTGACATGG + Intronic
1118669305 14:68104955-68104977 TTAAGAATACAGATGTAAATAGG + Intronic
1121078633 14:91089927-91089949 CTGGGACAACAGATGTAACCCGG + Intronic
1121371816 14:93365493-93365515 CTGAGAACTCAGAGTTAACATGG + Intronic
1121747533 14:96310260-96310282 GTGAGAATACAGCAGGAACAAGG + Intronic
1124428666 15:29586811-29586833 CTGACAATATAGATGTAATTTGG + Intergenic
1124883908 15:33666396-33666418 CTGAGAATAAAAATGAAAGAAGG + Intronic
1125256224 15:37766566-37766588 CTGAGACTACAGATAGACCAAGG + Intergenic
1126790224 15:52214254-52214276 CTGATCCTACATATGTAACAGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127266126 15:57363659-57363681 CTGAGAAGTCAGATGTTGCATGG - Intergenic
1128222545 15:65979420-65979442 CTGCGAATGCAGAGGTCACAGGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128839466 15:70838106-70838128 ATGACACTACAGATTTAACATGG - Intronic
1129454931 15:75671676-75671698 CTGAGAATAGAAATGTAACCAGG + Intergenic
1130395443 15:83497043-83497065 CAGAGAAGACAGATGTTAGAGGG - Intronic
1131727099 15:95238682-95238704 GTGAGAAAAAAGATGTGACAAGG + Intergenic
1131765638 15:95672908-95672930 CTGAGACTATAGGAGTAACAGGG + Intergenic
1132012341 15:98287106-98287128 CTGAGAATCCAGAGGGAACTGGG - Intergenic
1135533757 16:23276774-23276796 CTGGGATTACAGATGTAAGCTGG + Intergenic
1138425727 16:56931162-56931184 CTGAAAAAACAGATGTCCCAAGG + Intergenic
1138850771 16:60627111-60627133 CTGAGATTACAGAAATAACAGGG + Intergenic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1139452782 16:67044923-67044945 CTTAAAATCCAGATGTGACAAGG - Intronic
1139902581 16:70339942-70339964 CTGAGAAGGCAAATATAACAGGG - Intronic
1140192676 16:72831351-72831373 CTGGGAATACAGGTGAAATACGG + Intronic
1140388021 16:74559760-74559782 CTGAAAATACATATGTCAGAAGG - Intronic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1143085699 17:4414318-4414340 CTGAGATTACAGGTGTAGCTGGG - Intergenic
1144177069 17:12717777-12717799 TGGAGAATACAGAGGTAGCAAGG - Intronic
1145393882 17:22478575-22478597 TTGAGACTACAGAAGGAACAGGG + Intergenic
1146769229 17:35553335-35553357 CTGAGAACAAGGATGTATCAGGG + Exonic
1147748974 17:42715777-42715799 CTGGGATTACAGGTGTAATAAGG - Intronic
1148380858 17:47195916-47195938 TTGAGAATACACAGGGAACAAGG - Intergenic
1148572482 17:48681224-48681246 CTCAGAAAACAGAAGTAGCATGG - Intergenic
1151643267 17:75412050-75412072 CTGGGAATACAAATGTGAAAAGG - Intergenic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1153366494 18:4262871-4262893 CTAAGAACAGAGGTGTAACATGG + Intronic
1155439189 18:25843549-25843571 CAGATAGTACAGATATAACAAGG + Intergenic
1155541986 18:26878350-26878372 CTGATAATACAAAAGTCACATGG + Intergenic
1156930008 18:42630064-42630086 CTGATGATACAGATATACCAAGG - Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1159886728 18:73914674-73914696 CTGTGAATACAAATATTACAAGG + Intergenic
1160353199 18:78202825-78202847 TTAAGATTACAGATGAAACATGG + Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
926489771 2:13510788-13510810 CTGAGAGTACAGTTGAAGCAAGG + Intergenic
927067279 2:19486115-19486137 CTGAGAAATCAGAGGTACCATGG + Intergenic
927369231 2:22335537-22335559 CTGAGAATGCTGTTGTTACATGG - Intergenic
928465267 2:31517623-31517645 CTGAGAGTAGAGAAGAAACAAGG - Intergenic
931349897 2:61477606-61477628 ATGAGAACACAGATGTAACCTGG - Intergenic
932067186 2:68577293-68577315 ATGAGAATACACATGGCACAGGG - Intronic
933126506 2:78614661-78614683 CTTAGAATTTAGATGTAACCAGG - Intergenic
936391361 2:112077250-112077272 CGGAGAATACAGATGCAAGCTGG + Exonic
937115724 2:119403920-119403942 CTGAGAATGCAGATGAGCCATGG + Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
940299468 2:152161981-152162003 CTAAGAATACAGAATTAACCGGG - Intronic
940393202 2:153156874-153156896 CTGACAGTACAGATGAGACAAGG + Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
943504514 2:188737141-188737163 GTCAGAATAAAGAGGTAACATGG + Intronic
943854595 2:192773091-192773113 TTAAGAATACAGAGGAAACAGGG + Intergenic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
944651928 2:201838849-201838871 ATGAGAATACTGATGAAAAAAGG - Intronic
945136373 2:206632501-206632523 CTGAGAATAAAGAAGTTCCATGG + Intergenic
947680151 2:232023521-232023543 CTGAGACTACAGCTGGAACCTGG + Intronic
948642682 2:239385519-239385541 CTGAGACTTCAGAGGGAACAGGG - Intronic
1169537758 20:6564146-6564168 CATAGAACACAGTTGTAACAAGG - Intergenic
1170406145 20:16039584-16039606 CTTAGAACACAGAAGTAATAGGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1174730174 20:52908387-52908409 ATGAGAACACAGAGGTAATAAGG + Intergenic
1177675903 21:24297987-24298009 ATGGGAATACAGATGTCAGAGGG + Intergenic
1177761902 21:25411691-25411713 CTGAGGATGCAGGTGTTACAGGG + Intergenic
1178356725 21:31915594-31915616 ATGAGAAGTCAGATGTAAAATGG - Intronic
1178416412 21:32408733-32408755 AGGAAAATAGAGATGTAACATGG + Intergenic
1179021892 21:37648159-37648181 CTGAGCATGCAGGTGTAAAACGG + Intronic
1183193870 22:36339837-36339859 CTGAGAATATAAAGGCAACATGG + Intronic
1185238568 22:49728431-49728453 CAGAGGAAACAGATGTTACAGGG - Intergenic
950859113 3:16131896-16131918 GTGAGGATACAGGTGAAACAAGG + Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
957326181 3:78698127-78698149 CAGAGAATACAAATGAAATAAGG + Intronic
957531225 3:81442984-81443006 CTGAGAATACAGACTTAACCGGG + Intergenic
959563251 3:107806790-107806812 CTGAGGCTACAGATTTTACAGGG + Intronic
959921394 3:111872180-111872202 CTGTGGATACATATGTAATAAGG + Intronic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
963490642 3:145995753-145995775 CTGTGAATATATATGTTACATGG - Intergenic
964212976 3:154248511-154248533 CTTAGAATTTAGATTTAACAAGG - Intronic
965241392 3:166203663-166203685 CTGATGTTACAGATGTAAAAGGG + Intergenic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
968406452 4:343759-343781 CTGAAAATACAAATATATCAAGG - Intronic
972256293 4:37359271-37359293 CTGAGTTTAAACATGTAACAGGG - Intronic
972557968 4:40199460-40199482 GTGAGAATACATATGAAAGAAGG + Intronic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
974067388 4:57091682-57091704 CTGAGAATACATGTATAAAATGG - Intronic
974354626 4:60796457-60796479 CCTAGAATAGAGATGTAGCAAGG - Intergenic
975207071 4:71656945-71656967 ATGAGAATACAAATGTAAACTGG + Intergenic
975964133 4:79949201-79949223 ATGAGAACACAGAAATAACATGG + Intronic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976648776 4:87413045-87413067 CTGTGAAGACAGATGTTACATGG + Intergenic
977835879 4:101646029-101646051 CTGAGAATAAAGAAGTAAAAAGG + Intronic
978620442 4:110631352-110631374 GTAAGAATACAAATGTAATATGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981409065 4:144406210-144406232 CTGACAAAACAATTGTAACAAGG - Intergenic
981906690 4:149929328-149929350 CTGAGAATACAAATTTGAGAAGG + Intergenic
982637787 4:157918767-157918789 CTGAGGATTCAAATGTAATAAGG + Intergenic
982841441 4:160192791-160192813 CTGAGCATACTGAAGTAACTTGG + Intergenic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
983779659 4:171651635-171651657 CTGAGAATAAGGATGCCACATGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989987449 5:50717839-50717861 CTGAGAGTTCAGCTGTGACAGGG + Intronic
994988452 5:106967802-106967824 CTCAGAAAACAGATGGAATATGG + Intergenic
995099219 5:108278455-108278477 CTGAGAAGAAAAGTGTAACATGG + Intronic
995231849 5:109773699-109773721 CAGAGATTACAAATGTAAAAAGG + Intronic
995369581 5:111404122-111404144 CTAAGCATACATATTTAACATGG + Intronic
996264669 5:121523700-121523722 CTGATAGTACAGATGTATAAAGG + Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998029086 5:138848549-138848571 ATCAGAATACACATGTAAAAGGG - Intronic
1001856192 5:175012740-175012762 CCGAGTATAAGGATGTAACATGG - Intergenic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1004452748 6:15762180-15762202 CTGAAAATTCAAATGTAACTGGG - Intergenic
1005846956 6:29789264-29789286 CTGAGGATTCACATGAAACATGG - Intergenic
1005858650 6:29884481-29884503 CTGAGGATTCACATGAAACATGG - Intergenic
1005863792 6:29923007-29923029 CTGAGGATTCACATGAAACATGG - Intergenic
1006999444 6:38295742-38295764 CTCAGAATACAGATCTTAAATGG - Intronic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008134608 6:47759433-47759455 TTGAGAATGAAGAAGTAACAGGG + Intergenic
1008502601 6:52198897-52198919 CTGAGAATACAGGGGGAAGAGGG + Intergenic
1008957153 6:57228415-57228437 ATGAGAATTCAGCTGCAACAAGG - Intergenic
1009890969 6:69681642-69681664 TTGAGAACACTCATGTAACATGG + Intronic
1010486452 6:76420348-76420370 CTGAGGATATAGAAGTAAAAGGG + Intergenic
1010987770 6:82445166-82445188 ATGAGATTACTGATGTAACACGG - Intergenic
1011813979 6:91166723-91166745 ATGAGGAGACAGATGTAAAAAGG - Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1012784781 6:103610158-103610180 CTAAGGATACTGATGTAATATGG + Intergenic
1013392757 6:109703362-109703384 CTGACACTACAGAGGTATCAGGG + Intronic
1013435150 6:110097247-110097269 ATGAAAATACAGATGTGAGATGG + Intergenic
1014494690 6:122106800-122106822 ATGAGAATAAGGATTTAACATGG + Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1015674003 6:135724506-135724528 CTGAGAAAATAGATGTTAAAGGG - Intergenic
1017495587 6:154980374-154980396 CTGAGATTACAGGCGTGACAAGG - Intronic
1020891691 7:13886192-13886214 CTGAGAAAATAGATGTAAACAGG + Intergenic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1023412139 7:39898711-39898733 TGAAAAATACAGATGTAACAAGG + Intergenic
1023431318 7:40094343-40094365 CTGAGCAAGCAGCTGTAACAGGG - Exonic
1025817002 7:64922694-64922716 CTGGGATTACAGGTGTGACATGG - Intronic
1026709766 7:72727383-72727405 CAGAGCATACAGATTCAACAGGG + Intronic
1029957701 7:104656909-104656931 TTCAGAAAACAGATGTAACATGG - Intronic
1030532004 7:110722802-110722824 CAGAGAATACAGATGCTAGAAGG + Intronic
1031398238 7:121299730-121299752 ATAAGAATTCAGAAGTAACATGG + Intergenic
1032350139 7:131154448-131154470 AAGGGAATATAGATGTAACATGG + Intronic
1032605466 7:133346160-133346182 CTGAGGATACAGATTTGGCAAGG + Intronic
1032685203 7:134225539-134225561 GTGGAAATACAAATGTAACAAGG + Intronic
1035492686 7:159294078-159294100 CTGAGAATTCAGAAATACCAGGG + Intergenic
1035855981 8:2976904-2976926 CTGACAATAAAGCTGTAAGAGGG + Intronic
1036726067 8:11222253-11222275 CTGGGATTACAGGTGTAAAAGGG + Intergenic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038677963 8:29640589-29640611 CTAACAATACTGATGTAAAATGG + Intergenic
1040594470 8:48824133-48824155 CAGTGTATACAGTTGTAACAGGG + Intergenic
1042263140 8:66881079-66881101 CTAAGAATACAGTTGTAAACAGG + Intronic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1044137147 8:88600875-88600897 ATGACTATTCAGATGTAACATGG - Intergenic
1044234771 8:89818387-89818409 CTGAGAAAACAAATTTAGCATGG - Intergenic
1045756886 8:105554228-105554250 CTCAAAATGCAGATGAAACATGG + Intronic
1047828252 8:128602686-128602708 CTGAGAAGACAGGTTTAAAAAGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1052108455 9:24548908-24548930 CTGAGAAATCAGATCTACCATGG - Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1054900342 9:70362489-70362511 CTGAGAAGAAAGAAGCAACACGG + Intergenic
1055220361 9:73921964-73921986 CTCAGAAGTCAGATGTAAAAAGG + Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057279569 9:93700033-93700055 CTGAGTGTGCAGATGTGACAAGG - Intergenic
1057314937 9:93961840-93961862 CAGAAAGTACAGATGTGACATGG - Intergenic
1058175255 9:101728544-101728566 CTGAAAATGCAGATTTGACATGG - Intronic
1058398582 9:104586466-104586488 TTTAGGATACAGATGTTACACGG + Intergenic
1059280526 9:113129701-113129723 CAGAGAGTACAGATAGAACAGGG - Intergenic
1060676313 9:125518368-125518390 GTGGGATTACAGATGTAATATGG - Intronic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1187252535 X:17611797-17611819 CTGAGAACACAAATTTCACAAGG - Intronic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1192452060 X:71250846-71250868 CTTAAGATACTGATGTAACAAGG - Intronic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193428025 X:81364320-81364342 ATAAGAATTCAGATGTACCATGG - Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1194778989 X:97999690-97999712 TCGAGAATACAGATGTAAGAGGG - Intergenic
1195120231 X:101742297-101742319 CTGAGAATCTAGATGTCATATGG + Intergenic
1195729343 X:107949885-107949907 CTGAGTTTACAGATTTAACCAGG + Intergenic
1195921814 X:109991151-109991173 CTGAGGCTACAGAAGTAAAAGGG + Intergenic
1197050703 X:122055605-122055627 CTAAGAAAGCAGATGTAACTTGG + Intergenic
1199120049 X:144040763-144040785 ATGAGAATCCAGAGGTAAAAAGG + Intergenic
1199343755 X:146714014-146714036 CTGTGAAAATAAATGTAACACGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic