ID: 1085100451

View in Genome Browser
Species Human (GRCh38)
Location 11:73796117-73796139
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 3, 1: 3, 2: 35, 3: 102, 4: 276}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085100451_1085100461 5 Left 1085100451 11:73796117-73796139 CCTGCCCCTTCCGAGTTGGGGCG 0: 3
1: 3
2: 35
3: 102
4: 276
Right 1085100461 11:73796145-73796167 CAAGTCATGGCTGTGGATCTAGG 0: 1
1: 6
2: 14
3: 51
4: 252
1085100451_1085100464 30 Left 1085100451 11:73796117-73796139 CCTGCCCCTTCCGAGTTGGGGCG 0: 3
1: 3
2: 35
3: 102
4: 276
Right 1085100464 11:73796170-73796192 TCTTGCTCCACGGAGCAAGCAGG 0: 1
1: 0
2: 9
3: 86
4: 320
1085100451_1085100458 -2 Left 1085100451 11:73796117-73796139 CCTGCCCCTTCCGAGTTGGGGCG 0: 3
1: 3
2: 35
3: 102
4: 276
Right 1085100458 11:73796138-73796160 CGGTGCCCAAGTCATGGCTGTGG 0: 1
1: 0
2: 3
3: 23
4: 140
1085100451_1085100457 -8 Left 1085100451 11:73796117-73796139 CCTGCCCCTTCCGAGTTGGGGCG 0: 3
1: 3
2: 35
3: 102
4: 276
Right 1085100457 11:73796132-73796154 TTGGGGCGGTGCCCAAGTCATGG 0: 1
1: 0
2: 0
3: 3
4: 85
1085100451_1085100462 20 Left 1085100451 11:73796117-73796139 CCTGCCCCTTCCGAGTTGGGGCG 0: 3
1: 3
2: 35
3: 102
4: 276
Right 1085100462 11:73796160-73796182 GATCTAGGCCTCTTGCTCCACGG 0: 1
1: 0
2: 6
3: 31
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085100451 Original CRISPR CGCCCCAACTCGGAAGGGGC AGG (reversed) Intronic
901691042 1:10973671-10973693 CGTCCCAACTCAGAAGGGGCGGG - Intronic
902644892 1:17791193-17791215 TGCCCCAACTCGGAAGGGGCAGG + Intronic
903082215 1:20820028-20820050 CATCCCAACTCAGAAGGGGCAGG - Intronic
903082276 1:20820287-20820309 CCCACCAACTCAGAAGAGGCAGG - Intronic
903672263 1:25043384-25043406 CGCCCCAACTCAGAAGGGGGTGG + Intergenic
904369941 1:30042090-30042112 CCCACCAACTCTGAAGGGGCAGG - Intergenic
905038115 1:34930184-34930206 CGCCCCATCCTGGCAGGGGCTGG - Intergenic
906448389 1:45922744-45922766 CCCACCAACTCGGAAGGGGTGGG + Intronic
907152837 1:52305607-52305629 CCCACCAACTCGGAAGGGGTGGG - Intronic
907341063 1:53736823-53736845 CCTCACAACTCGGAAGGGGTAGG - Intergenic
907369776 1:53993151-53993173 CCCACCAACTTGGAAGGGACAGG + Intergenic
908259416 1:62327785-62327807 CCGGCCAACTCGTAAGGGGCGGG + Intergenic
909197649 1:72648345-72648367 CCCACCAACTTGGAAGGGGGTGG - Intergenic
911024892 1:93426364-93426386 CCCACCAACTCAGAAGGGGAGGG - Intergenic
911275406 1:95853179-95853201 CCCACCAACTTGGAAGGGGTGGG - Intergenic
911539934 1:99146342-99146364 CACTCCAACTTGGATGGGGCGGG - Intergenic
912132382 1:106619273-106619295 CCGCCCAACTTGGAAGGGGTCGG - Intergenic
913161824 1:116152167-116152189 CGCCGCGGCTCGGAAGCGGCAGG + Intergenic
914813838 1:151048536-151048558 CGCCCCAACTCGAAGGCGCCCGG - Exonic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
916648923 1:166816906-166816928 CCTGCCAACTAGGAAGGGGCAGG + Intergenic
916648988 1:166817200-166817222 TGCCCCAACTCAGAAAAGGCAGG + Intergenic
917209478 1:172616719-172616741 AGCCCCAACTGGGAAGGGAGGGG - Intergenic
917780472 1:178390460-178390482 CGCCTAAACTCGGGAGGGGGAGG - Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
919165387 1:193885355-193885377 CCTGCCATCTCGGAAGGGGCTGG + Intergenic
919165447 1:193885644-193885666 TATCCCAACTCAGAAGGGGCAGG + Intergenic
919191914 1:194230967-194230989 CACCCCAACTCAGAAGGGGCGGG + Intergenic
919250830 1:195054400-195054422 GGCCCGCACTCGGAAGCGGCTGG + Intergenic
920269405 1:204752048-204752070 CGTCCCAACTCAGAAGGGGCGGG - Intergenic
921902167 1:220462899-220462921 CATCCCAACTCAGAAGGGGCGGG - Intergenic
921902226 1:220463181-220463203 CCCACCAACTTGGAAGGGACAGG - Intergenic
921923099 1:220690312-220690334 CGCCCCAGCCCGGACGGGGCGGG - Exonic
922132594 1:222794839-222794861 TGCCCCAACTCAGAATGGGTGGG - Intergenic
923391235 1:233515675-233515697 CCCACCAACTAGAAAGGGGCAGG - Intergenic
923755159 1:236785389-236785411 CTCACCAACTCAGAAGGGGCAGG - Intergenic
1062771649 10:105535-105557 TGCCCCAACTTGGAAGGGGTAGG + Intergenic
1068060789 10:52064733-52064755 CATCCCAACTCAGAAGGGGTGGG + Intronic
1068484526 10:57640496-57640518 CGCCTGAACTCGGAAGGTGGAGG - Intergenic
1068967166 10:62924424-62924446 CCCGCCAACTCAGAAGGGGTGGG + Intergenic
1068967242 10:62924718-62924740 CGCCCCAACTCAGAAGGGGCGGG + Intergenic
1069561902 10:69436364-69436386 CCCGCCAACTCGGAAGGAGGTGG + Intergenic
1069576069 10:69529242-69529264 CACCGCAACTCAGAAGGAGCAGG + Intergenic
1069724479 10:70568521-70568543 CACCCTTACTCTGAAGGGGCAGG - Intergenic
1070037171 10:72737767-72737789 CGCCCCAACTCCCAAAGTGCTGG + Intronic
1071166829 10:82816740-82816762 AGCCCCAACTCAGAAGGAGGTGG + Intronic
1071669930 10:87598831-87598853 AGCCCCGAGTCTGAAGGGGCAGG - Intergenic
1071886183 10:89952434-89952456 TGCCTCAATTTGGAAGGGGCAGG + Intergenic
1072052352 10:91718181-91718203 AGCCAGAACTCGGAAGGTGCTGG - Intergenic
1072335697 10:94395959-94395981 CACCCCAGCTCAGAAGGGGTGGG + Intergenic
1072470371 10:95707378-95707400 CACCCCAATTCAGAAAGGGCAGG + Intergenic
1072971438 10:100020983-100021005 TGCCCCAACTCGGAAGGAATGGG + Intergenic
1074365579 10:112855058-112855080 TGCACCAACTGGGAAGGAGCTGG + Intergenic
1075007601 10:118842110-118842132 CACCCCAACTTGGAAGGGGCTGG - Intergenic
1077668742 11:4137956-4137978 CGCCCCATCTGGGAAGGAGGTGG - Intronic
1078042899 11:7884569-7884591 AACCCCAACTCGGAACAGGCAGG + Intergenic
1078836565 11:15035546-15035568 CGCTCCCACTCAGAAGGGGTGGG + Intronic
1079472451 11:20790783-20790805 TACCCCAACTTGGAAGGGGCGGG + Intronic
1079733147 11:23961795-23961817 CGTCCCAATTCAGAAGGGGTGGG - Intergenic
1080584151 11:33666248-33666270 TGCTCCAACTCAGAAGGGGCAGG + Intronic
1080706594 11:34701320-34701342 CCCACCAACTCGGACGGGGGTGG - Intergenic
1081862020 11:46338746-46338768 TTACCCAACTAGGAAGGGGCAGG - Intronic
1082750196 11:57006454-57006476 CACCCTAATTCGAAAGGGGCAGG + Intergenic
1084128655 11:67118093-67118115 CGCCCCGACTCGCCGGGGGCGGG + Intergenic
1084991014 11:72925807-72925829 CGTCCCAACTCAGAAGGGGCAGG - Intronic
1085100451 11:73796117-73796139 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1087036102 11:93758232-93758254 AGCGCCAACTCGGAAGGGGCAGG - Intronic
1087844366 11:102955627-102955649 CACCACCACTGGGAAGGGGCAGG + Exonic
1088513092 11:110598777-110598799 CACCCCAACTCAGAAGGGGCAGG - Intronic
1089172842 11:116527448-116527470 TGTTCCAACTCAGAAGGGGCAGG - Intergenic
1089505887 11:118961593-118961615 CCTGCCAACTCAGAAGGGGCAGG + Intergenic
1089505949 11:118961855-118961877 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1089529988 11:119121471-119121493 CACCAAAACACGGAAGGGGCGGG - Intergenic
1089823017 11:121246084-121246106 CGCCTCAACTCAGAAGGGGCGGG - Intergenic
1094427153 12:30327832-30327854 TGCCCCAGCTCAGAAGGGACGGG - Intergenic
1095042174 12:37455432-37455454 CATTCCAACTCAGAAGGGGCAGG - Intergenic
1096172093 12:49479612-49479634 TGCCCCAACTCAGAAGGGGTAGG + Intronic
1096602714 12:52741941-52741963 CGCCCCAACTCAGAAGAGGTGGG - Intergenic
1096602775 12:52742233-52742255 CCCACCAACTTGGAAGGGGCGGG - Intergenic
1096944846 12:55392647-55392669 TGCCCCAACTCGGAATGGACTGG + Intergenic
1097008121 12:55933324-55933346 CGCCCCAATTGGGTAGGGGCGGG + Intronic
1097076389 12:56397679-56397701 TGTCCCAATTCAGAAGGGGCAGG + Intergenic
1097078299 12:56410987-56411009 CATCCCAACTCAGAAGGGACAGG + Intergenic
1098465808 12:70784276-70784298 CCTGCCAACTTGGAAGGGGCAGG + Intronic
1098597996 12:72295256-72295278 CACCCCAGCTCAGAAGGGGCAGG + Intronic
1099911936 12:88844651-88844673 CACCCCAACTCAAAAGGGGTGGG + Intergenic
1100847740 12:98678407-98678429 TGCCCCAATTCAGAAGGGGTAGG - Intronic
1101764074 12:107682521-107682543 CCCGCCAACTTGGGAGGGGCAGG + Intergenic
1101764135 12:107682790-107682812 TGCCCCAACTCAGAAGGGGCAGG + Intergenic
1102328654 12:112011202-112011224 TGCCTCAACTCAGAAGGGGCGGG + Intronic
1103173550 12:118843235-118843257 CCTGCCAACTCGGAAGGGGATGG - Intergenic
1104896777 12:132168670-132168692 GGCCCCAACTCCGATGGTGCCGG + Intergenic
1105640034 13:22252704-22252726 CCCACCAACTCTGAAGGGGCGGG - Intergenic
1106037998 13:26062690-26062712 AGCCCCAAATCAGAAGGAGCAGG - Intergenic
1106379416 13:29222649-29222671 CCCTCCAACTTGGAAGGGGTGGG - Intronic
1106576408 13:30979335-30979357 CCCACCAACTCAGAAGAGGCAGG + Intergenic
1106576469 13:30979624-30979646 TGTCCCAACTCAGAATGGGCAGG + Intergenic
1106620134 13:31364777-31364799 CCTCCAAACTCAGAAGGGGCAGG - Intergenic
1107513431 13:41107268-41107290 CATCCCAACTTAGAAGGGGCCGG - Intergenic
1107875933 13:44790256-44790278 CCTGCCAACTCTGAAGGGGCAGG + Intergenic
1108088158 13:46817977-46817999 CGTTCCAACTCAGAAGGGGCAGG - Intergenic
1108088190 13:46818115-46818137 CCTCCCAACTCAGAAGGGACAGG - Intergenic
1108240471 13:48458083-48458105 TGTCCCAACTCGGAAGGGGCGGG + Intronic
1108844460 13:54660459-54660481 CCTACCAACTCGGAAGGGGGCGG + Intergenic
1110999987 13:82165767-82165789 CCTGCCAACTCGGAAGGGGCGGG + Intergenic
1111512814 13:89287908-89287930 CACCCCTACTCAGAAGTGGCAGG + Intergenic
1111800621 13:92975374-92975396 TGCTCCAACTCAGAAGGGGCAGG + Intergenic
1113339035 13:109404362-109404384 CGCCCCAACTCAGAAGGGGCAGG - Intergenic
1113560009 13:111271251-111271273 TGCCCCAGCTGAGAAGGGGCGGG + Intronic
1113994234 14:16053444-16053466 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1114280907 14:21192042-21192064 TGCCCCAGTTCAGAAGGGGCAGG - Intergenic
1114349739 14:21836403-21836425 TGCTCCAACTCAGAAGGGGCAGG + Intergenic
1116257109 14:42570921-42570943 CACTCCAACTCAGAAGGGGCAGG - Intergenic
1117377408 14:55129180-55129202 CGCCCCGCCTCGGGAGAGGCGGG + Exonic
1117974223 14:61281411-61281433 CTGCTCACCTCGGAAGGGGCGGG - Exonic
1119036046 14:71231287-71231309 CCCACCAACTCGGAAGGGTTGGG - Intergenic
1119618081 14:76111891-76111913 CCCACCAACTTGGAAGGGGCAGG - Intergenic
1121054183 14:90839435-90839457 AGCCCAGACTTGGAAGGGGCAGG - Intergenic
1122278486 14:100607752-100607774 ACCCTCAACTCAGAAGGGGCGGG + Intergenic
1122465924 14:101933477-101933499 GGCCCCACCTCTGGAGGGGCTGG - Intergenic
1124650338 15:31469363-31469385 CCCACCAACTTGGAAGGGGCGGG + Intergenic
1124937413 15:34186285-34186307 TGTCCCAACTCAGAAGGGGCGGG - Intronic
1125238996 15:37550879-37550901 CGCTCCAACTCAGAAAAGGCGGG + Intergenic
1125381748 15:39093076-39093098 CACCCCAACTTAGAAGGGGCAGG + Intergenic
1125435952 15:39645628-39645650 CTGGCCAACTCGGAAGAGGCAGG - Intronic
1126185836 15:45829712-45829734 CTGGCCAGCTCGGAAGGGGCAGG + Intergenic
1126185887 15:45829973-45829995 GGTCCCAACTCAGAAGGGGCGGG + Intergenic
1126292771 15:47100090-47100112 CATTCCAACTCGGAAGGGGCAGG + Intergenic
1128847732 15:70916726-70916748 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1129183428 15:73891496-73891518 CCCTCCAACTTGGAAGGGGGCGG - Intergenic
1129784911 15:78303816-78303838 CTCCCCAACTCAGAAGGGGGAGG - Intergenic
1130029079 15:80295505-80295527 CCCTGCAACTCAGAAGGGGCAGG + Intergenic
1130183029 15:81651182-81651204 CACCCCAAGTCAGAAAGGGCAGG - Intergenic
1132559280 16:585806-585828 GGCCCCAACTCTGAAAGGGAAGG - Intergenic
1132650878 16:1021005-1021027 CGGCCCAGCTGGGTAGGGGCAGG + Intergenic
1132978896 16:2724872-2724894 CCTGCCAACTCAGAAGGGGCAGG - Intergenic
1135207016 16:20492531-20492553 CCCACCAACTCAGAAGGGACAGG - Intergenic
1135211869 16:20531101-20531123 CCCACCAACTCAGAAGGGACAGG + Intergenic
1136912782 16:34158817-34158839 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1137291611 16:47055495-47055517 CCCACCAACCTGGAAGGGGCAGG + Intergenic
1137334509 16:47534076-47534098 CACCCAAGCTCGGAAGGGGTGGG + Intronic
1137698587 16:50479045-50479067 CTTCCCAACTCAGAAGGGGCGGG + Intergenic
1137825393 16:51490043-51490065 TGCCCCAACTCAGAAGGGATGGG + Intergenic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1138651691 16:58464494-58464516 CGCTCCAACTCGGAAAGTGGCGG - Intronic
1139663943 16:68442924-68442946 AGCCCCAGCTTGGAAGGGGAAGG + Intronic
1140419653 16:74807775-74807797 TGCCCCAACTCAGAAGGAGCGGG + Intergenic
1140498293 16:75409353-75409375 GGCCCACACTTGGAAGGGGCAGG + Intronic
1142687495 17:1586112-1586134 GGCACCAGCTGGGAAGGGGCTGG + Intronic
1144386200 17:14751262-14751284 CTCGCCAACCTGGAAGGGGCAGG - Intergenic
1144495621 17:15743090-15743112 CCCCCCAACCCGGATGGAGCAGG - Intronic
1144695358 17:17300822-17300844 CCCGCCAACTCAGAAGGGGCGGG - Intergenic
1144714364 17:17424022-17424044 CCCACCAACTCAGAAGGGGCGGG - Intergenic
1146459353 17:33033440-33033462 CCTGCCAACTTGGAAGGGGCAGG - Intronic
1146761412 17:35482425-35482447 CGTCCCAACTTGGAAGAGGCAGG - Intronic
1146912611 17:36658196-36658218 CCCCCCAAATAGGAAGGGGTCGG - Intergenic
1147428451 17:40357228-40357250 AGCCCCCACTGTGAAGGGGCTGG + Intronic
1147722086 17:42545637-42545659 CGCCCCACCCCGCAAGTGGCTGG + Intergenic
1147998647 17:44375185-44375207 GGACCCAACGCAGAAGGGGCCGG + Intronic
1148386415 17:47237971-47237993 CCCACCAACTTGGAAGGGGTGGG + Intergenic
1148640577 17:49184200-49184222 CGTCCCAACTCAGAAAGGGCAGG + Intergenic
1149085306 17:52709688-52709710 TGCCCCAATTCAGAAGGGGCGGG - Intergenic
1149085370 17:52709978-52710000 CCCACCAACTCAGAAGGGGTGGG - Intergenic
1149088615 17:52751185-52751207 CCTGCCAACTCAGAAGGGGCCGG - Intergenic
1149160521 17:53687266-53687288 CCCACCAACTCAGAAGGGGCAGG + Intergenic
1150168347 17:62966171-62966193 CACCCCAGCCCGGAGGGGGCGGG + Intergenic
1150255623 17:63741914-63741936 CGCGGCCACTCGGAAAGGGCGGG - Intronic
1150950776 17:69800963-69800985 CGCCCCAACTTGGAAGGGGTGGG - Intergenic
1150952650 17:69821109-69821131 TGCCCTAACACAGAAGGGGCGGG - Intergenic
1151395482 17:73820017-73820039 CCCACCAACTTGGAAGGGGCAGG + Intergenic
1152988874 18:344203-344225 TGCCCCAGCTCTGGAGGGGCTGG - Intronic
1153605359 18:6827375-6827397 CGCCCCATCTCGGAGGGAGGTGG - Intronic
1154507852 18:15060545-15060567 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1156244582 18:35284991-35285013 CCCGCCAACTTGGAAGGAGCTGG + Intronic
1158773686 18:60552631-60552653 TGTCCCAACTCAGAAGGGGCAGG - Intergenic
1159186567 18:64983570-64983592 CACCCCAACTTGGAAGAGGTAGG - Intergenic
1159519241 18:69496344-69496366 CCCACCAACTCGGAAGGGGCGGG + Intronic
1159774392 18:72586097-72586119 CCCTCCAACTCAGAAGGGGTGGG + Intronic
1160474259 18:79168029-79168051 CCTGCCAACTCGGAAGGGGATGG + Intronic
1160753767 19:747468-747490 TGCCCCCACCCGGGAGGGGCCGG + Exonic
1160992342 19:1864855-1864877 CGCCGGAGCTGGGAAGGGGCGGG - Intergenic
1161056225 19:2191771-2191793 AGCCCCAACCTGGGAGGGGCAGG - Intronic
1161780035 19:6285922-6285944 CACCCCAATGCAGAAGGGGCGGG - Intergenic
1161781677 19:6297337-6297359 CATCCCAACTCAGGAGGGGCGGG - Intergenic
1163785079 19:19270822-19270844 AGCCCCAGCTCTGAAGGGGGAGG + Intronic
1163865562 19:19770260-19770282 CGCCCCATCTGGGAAGTGGGGGG + Intergenic
1164754159 19:30677812-30677834 CCCCCCAAATCAGAGGGGGCAGG - Intronic
1165022498 19:32935988-32936010 CCCACCAACTCAGAAGGGGCAGG - Intronic
1165027047 19:32969691-32969713 CCCGCCAACTTGGAAGAGGCAGG + Intronic
1166897293 19:46032184-46032206 CCCACCAACTTGGAAGGGGCAGG - Intergenic
1167013022 19:46821543-46821565 CACCACAGCTCAGAAGGGGCAGG - Intergenic
1167013072 19:46821750-46821772 CCTGCCAACTCGGAAGGGGTGGG - Intergenic
1167234925 19:48308658-48308680 CATCCCAACTCAGAAGGGTCAGG - Intronic
1167234992 19:48308951-48308973 CCCACCAACTCGGAAGGGGCAGG - Intronic
1168084410 19:54034816-54034838 CGCCCCAACTCGGAAGGGGCAGG - Intergenic
1168303275 19:55419293-55419315 TGCCCCAACTCAGAAGGGGCGGG - Intergenic
1168303329 19:55419514-55419536 CCCACCAATTCAGAAGGGGCAGG - Intergenic
925328759 2:3042475-3042497 CGCACCAGCTGGAAAGGGGCAGG - Intergenic
926859416 2:17292370-17292392 CACCCCAACTCAGAAGGGGCAGG + Intergenic
927737224 2:25534837-25534859 CGCCCCATCTGGGAAGTGGAGGG - Intronic
928131839 2:28657457-28657479 CGCCCCATCTGGGAAGGCTCTGG - Intergenic
930971292 2:57398099-57398121 CCCTCCAACTTGGCAGGGGCGGG + Intergenic
931499903 2:62854867-62854889 AGCCCCAACTCAGAAGGGGCGGG - Intronic
931739400 2:65228164-65228186 CGCCCCCACCCGGAAGGGTGAGG - Intronic
932054879 2:68433456-68433478 CCTGCCAACTCGGAAAGGGCGGG + Intergenic
933042470 2:77487177-77487199 CCCACCAACTCAGAAGGGGGCGG - Intronic
933801301 2:85962039-85962061 TGCCCCAACTCAGAAGGAGTGGG + Intergenic
933910314 2:86934919-86934941 CGCCCGAACTCGGGAGGCGGAGG - Intronic
934022413 2:87968490-87968512 CGCCCGAACTCGGGAGGCGGAGG + Intergenic
936413876 2:112286519-112286541 CGCCCGAACTCGGGAGGCGGAGG - Intronic
938096560 2:128467682-128467704 CCCACCAACTTGTAAGGGGCAGG + Intergenic
938195065 2:129319524-129319546 CGTCCCACCTCAGAAGGGGCGGG + Intergenic
938732688 2:134158648-134158670 CCCACCAATTCGGAAGGGGGAGG + Intronic
939178678 2:138780458-138780480 CGCCCCTCCTCGGAGGGGGCCGG + Intergenic
941151298 2:161918874-161918896 CCCACCAACTCAGAAGGCGCGGG - Intronic
941266182 2:163366064-163366086 AGCCCCAACTTAGATGGGGCAGG + Intergenic
942103925 2:172614059-172614081 CCCATCAACTTGGAAGGGGCAGG - Intergenic
943023560 2:182602260-182602282 TGCCCCAACTCAGAAGGGGCAGG + Intergenic
943345771 2:186735081-186735103 CCCACCAACTCGGTAGGGGCAGG + Intronic
943526164 2:189020415-189020437 TGCACCAACTCAGAAGGGTCAGG - Intergenic
943961068 2:194264676-194264698 TGTCCTAACTCAGAAGGGGCAGG - Intergenic
944539180 2:200740388-200740410 GTCCCCAGCTAGGAAGGGGCAGG - Intergenic
944586462 2:201178013-201178035 CGCTCCAACTCAGAAGGTGGGGG - Intergenic
947327446 2:228993209-228993231 CCCACCAACTTGGAAGGGGCAGG + Intronic
948293685 2:236845708-236845730 TGCCCCAACTCAGAAGGAGCGGG + Intergenic
948476217 2:238221454-238221476 TGCCCCAGCTCAGAAGGGGCAGG + Intergenic
1170494860 20:16914922-16914944 CCCACCAACTTGGAAGGAGCAGG - Intergenic
1170612528 20:17926284-17926306 CACCCCAACTCCTGAGGGGCAGG + Intergenic
1171536606 20:25898504-25898526 CATTCCAACTCAGAAGGGGCAGG - Intergenic
1171768179 20:29301371-29301393 TCCCCCGACTCGGAAGGGGGAGG + Intergenic
1171804499 20:29662653-29662675 CATTCCAACTCAGAAGGGGCAGG + Intergenic
1171810888 20:29743614-29743636 TCCCCCGACTCGGAAGGGGGAGG + Intergenic
1171866325 20:30489207-30489229 TCCCCCGACTCGGAAGGGGGAGG + Intergenic
1172346883 20:34209234-34209256 CCCACCAACTTGGAAGGGGTAGG - Intronic
1172676545 20:36676871-36676893 GGTCCCAACCCGGAAGGGGCGGG - Intronic
1173206610 20:40999713-40999735 CGCTCGAACTCGGAAGGTGGCGG + Intergenic
1173524557 20:43721753-43721775 CCCGCCAACTTGGAAGGGGTGGG + Intergenic
1173579546 20:44137405-44137427 AGCCCCACCTGGGGAGGGGCGGG - Intronic
1173893754 20:46534162-46534184 TGCCCCAACTTGGAGGGGGCAGG - Intergenic
1174138843 20:48398794-48398816 TGCCCCAGCTTGGAAGGGGCAGG + Intergenic
1175064302 20:56272358-56272380 CCCACCAACTCAGAAGGGGCAGG - Intergenic
1175675758 20:60945542-60945564 CACCCCAACTCAGAAGGGATGGG - Intergenic
1176547336 21:8207623-8207645 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1176555241 21:8251832-8251854 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1176566287 21:8390670-8390692 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1176574161 21:8434856-8434878 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1176790230 21:13311254-13311276 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1177396195 21:20538517-20538539 TGCACTAACTCAGAAGGGGCAGG + Intergenic
1177989403 21:28019463-28019485 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1180025756 21:45161219-45161241 CCCTCCAACTTGGAAGGGGGTGG - Intronic
1180313035 22:11254071-11254093 TCCCCCGACTCGGAAGGGGGAGG + Intergenic
1184054528 22:42035451-42035473 CACCCCAACTTGGAAGGGGCGGG + Intronic
1184613493 22:45622016-45622038 CGTCCCAACTCAGAAGGGGCAGG - Intergenic
1185155255 22:49189767-49189789 GGCCCCATCTCAGCAGGGGCTGG + Intergenic
1185296965 22:50059123-50059145 TGCCCCGACTCTGAAGGGGCTGG + Intergenic
1203252209 22_KI270733v1_random:123908-123930 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
952015982 3:28958546-28958568 TGCCCCAACTCCGAAGGGGTGGG - Intergenic
952269469 3:31817449-31817471 CCCATCAACTCAGAAGGGGCAGG + Intronic
953901820 3:46847840-46847862 TGCCCCAACCCGGCAGAGGCTGG + Intergenic
954376252 3:50195526-50195548 AGCCCCAGCTAGGAACGGGCAGG + Exonic
954651031 3:52162748-52162770 CACCCCAACTCAGAAGAAGCGGG + Intergenic
956462478 3:69485570-69485592 CCCACCAACTTGGAAGGGGTAGG + Intronic
957426912 3:80051283-80051305 CCCACCAACTTGGAAGGGTCAGG - Intergenic
959389845 3:105759831-105759853 CCCACCAACTCGGAAGAGGGTGG + Intronic
959863818 3:111243452-111243474 CACCCCAACTTGGAAGGGGCAGG + Intronic
960634400 3:119768771-119768793 CACCCCAACTCAGAAGGGGCGGG + Intergenic
960639071 3:119809954-119809976 CTCCCCGAGTCGGTAGGGGCTGG + Intronic
962105405 3:132383680-132383702 CACCCCAACTCAGAAGGGGCAGG + Intergenic
962492480 3:135907881-135907903 CACCCCAAATGTGAAGGGGCAGG - Intergenic
963199060 3:142568582-142568604 CCCTGCAACTCGGAAGGGGGCGG - Intronic
965005562 3:163018830-163018852 CTCTCCAACTCAGAAGGGGCAGG - Intergenic
965272584 3:166638220-166638242 TGCCCCAACTCAGAAGGGACGGG - Intergenic
965793248 3:172411544-172411566 CCCACCAACTTGGAAGGGGCAGG + Intergenic
966255984 3:177917437-177917459 CCTGCCAATTCGGAAGGGGCAGG - Intergenic
966491324 3:180531477-180531499 TGCCCCAACTCAGAAGGGGTGGG - Intergenic
967650001 3:191974034-191974056 CACCCCAGCTTGGAAGGGGCGGG + Intergenic
968538845 4:1151932-1151954 CCACCCAACTCGGAAGGGGCAGG + Intergenic
971079639 4:23195313-23195335 GGCTCCAACTCAGAAAGGGCGGG - Intergenic
972158974 4:36199057-36199079 CTTACCAACTCGGAAGGGGCAGG + Intronic
974260421 4:59518524-59518546 CCCGCCAACTTGAAAGGGGCGGG + Intergenic
975910132 4:79258105-79258127 CCCACCAACTTGGAAGGGACAGG - Intronic
976511221 4:85911226-85911248 CGCCCTAACTCGAATGGGGTGGG + Intronic
976675579 4:87698214-87698236 CCCACCAACTCGGAAGGGGCAGG + Intergenic
976675603 4:87698333-87698355 TGCTCCAACTCAGAAGGGGCGGG + Intergenic
978149479 4:105415646-105415668 CCTGCCAACTCGGAAGGGGGTGG + Intronic
978964689 4:114726043-114726065 TGCCCCAACTCAGAAGGGACAGG + Intergenic
980180058 4:129392087-129392109 AGCCCCAGTTTGGAAGGGGCAGG - Intergenic
980703027 4:136457269-136457291 CCCACCAACTCAGAAGGAGCAGG - Intergenic
980750160 4:137077345-137077367 CCCACCAATTCAGAAGGGGCAGG + Intergenic
980750229 4:137077638-137077660 CACCCCAACTCAGAAGGGGCGGG + Intergenic
987952055 5:24687792-24687814 CCCTCCAACTTGGAAGGGGGTGG + Intergenic
987999470 5:25330636-25330658 CCCACCAACTTGGAAGGGGAGGG - Intergenic
988466937 5:31500216-31500238 GGCCCCAACTGGGGAGGTGCTGG + Intronic
988940287 5:36139024-36139046 CCCGCCAACTCGGAAGGGGGTGG - Intronic
990638992 5:57761578-57761600 TGCCCCAACTCAGAAGGGTCGGG - Intergenic
990639058 5:57761879-57761901 CCCACCAACTTAGAAGGGGCAGG - Intergenic
994245522 5:97471656-97471678 CCCACCAACTTGGAAGGGACAGG + Intergenic
994692486 5:103035163-103035185 CCCTCCAACTTGGAAGGGGGCGG + Intergenic
995331953 5:110956435-110956457 CCCTCCAACTTGGAAGGGGGTGG - Intergenic
997611759 5:135220536-135220558 CACCTCAACACAGAAGGGGCTGG - Intronic
997960284 5:138315915-138315937 TGCCCCAACTCAGAAGGGGAAGG - Intronic
999242123 5:150133783-150133805 CCCCCCAAATCAGGAGGGGCCGG + Intronic
999799587 5:155020172-155020194 CGTCTCAACTCAGAAGGGGCAGG + Intergenic
1002688945 5:181037241-181037263 CCCATCAATTCGGAAGGGGCAGG - Intergenic
1002693827 5:181070759-181070781 AGTCCCAACTCAGAAGGGACAGG + Intergenic
1004369690 6:15041258-15041280 CGCTTGAACTCGGAAGGCGCAGG - Intergenic
1004417624 6:15438946-15438968 CGCTTCAACCCGGAAGGGGGAGG + Intronic
1004520734 6:16358929-16358951 CCTGACAACTCGGAAGGGGCAGG - Intronic
1004696896 6:18042587-18042609 TGTCCCAACTCAGAAGGGGTGGG - Intergenic
1005021613 6:21423857-21423879 TGCCCCAACTCGAAAGGGGTGGG + Intergenic
1005043572 6:21620798-21620820 TGCCCCAACTCAGAAAGGGCCGG + Intergenic
1006347818 6:33497730-33497752 CGCCCCAGGTCAGAAGGGGCAGG - Intergenic
1006467293 6:34203190-34203212 GCCCCCAACTCAGAAGGGGCGGG + Intergenic
1006500755 6:34457601-34457623 CGCCCCAACTCAGAAAGGGTGGG - Intergenic
1006500828 6:34457895-34457917 CCCACCAACTCGGAAGGGGCGGG - Intergenic
1006753655 6:36396294-36396316 TGCCCCAACTCAGAAGGGGCTGG - Intronic
1006867720 6:37222510-37222532 CCCGCTAACTCGAAAGGGGCGGG + Intronic
1006867788 6:37222803-37222825 CGACTTAACTCAGAAGGGGCCGG + Intronic
1010883879 6:81214578-81214600 TGCCCCAACTCAGAAAGGGTGGG - Intergenic
1012142121 6:95636923-95636945 CCTGCCAACTCGAAAGGGGCAGG + Intergenic
1012211390 6:96522194-96522216 CGCCCCACCATGGACGGGGCCGG + Intronic
1012889817 6:104885517-104885539 CCCACCAACTCGGAAGGGGTAGG - Intergenic
1013086850 6:106864311-106864333 CCCACCAACTCGGAAGTGGCAGG + Intergenic
1013375414 6:109509800-109509822 CCCACCAACTCACAAGGGGCAGG - Intronic
1013692889 6:112667178-112667200 TACCCCAACTCAGAAGGGGTGGG - Intergenic
1013709460 6:112880084-112880106 CCCATCAACTCGGAAGGGGCGGG + Intergenic
1014289193 6:119539332-119539354 CACCCCAATTCAGAAGAGGCAGG - Intergenic
1014391555 6:120871930-120871952 CTCTCCAACTCAGAAGGGGTGGG - Intergenic
1015455752 6:133424630-133424652 CCTGCCAACTTGGAAGGGGCGGG + Intronic
1015663567 6:135603011-135603033 TGCCCCAACTCAGAAGGGGCAGG - Intergenic
1016190569 6:141260636-141260658 CACCCCAACTCGGAAGGAACAGG - Intergenic
1016339764 6:143049852-143049874 TCCACCAACTCGGAAGGGGCAGG + Intergenic
1017054338 6:150424266-150424288 TGCCCCAACTTAGAAGGGGTGGG - Intergenic
1017829309 6:158111176-158111198 AGCACCAACCCGGAAGTGGCAGG - Exonic
1019296181 7:276590-276612 CCCACCCACTCAGAAGGGGCAGG - Intergenic
1020096909 7:5374477-5374499 CGCTCCTGCTGGGAAGGGGCCGG + Exonic
1020568185 7:9823093-9823115 TGCCCCAACTCGGAAGTGGCGGG + Intergenic
1021431263 7:20560736-20560758 CGCTCCAACTAGGAAGGGGTGGG + Intergenic
1021561560 7:21972688-21972710 CCTCCCAACTCAGAAGGGGCAGG + Intergenic
1021999037 7:26207600-26207622 CGCCTCAACTCGGAAGGCAGAGG - Intronic
1023788980 7:43737209-43737231 TGTCCCAACTCAGAAGGGGCAGG - Intergenic
1025288078 7:57685212-57685234 CATTCCAACTCGGAAGGGGCAGG - Intergenic
1026018813 7:66692960-66692982 CCCCCCATGCCGGAAGGGGCTGG + Intronic
1026359708 7:69591848-69591870 CCTGCCAACTCAGAAGGGGCAGG + Intergenic
1027779983 7:82508217-82508239 CCTACCAGCTCGGAAGGGGCGGG + Intergenic
1027826789 7:83125332-83125354 CGCCCCATCTGGGAAGTGGGGGG + Intronic
1028053202 7:86209251-86209273 CCCACCAACTTGGAAGGGGTGGG + Intergenic
1028233178 7:88330009-88330031 CATCCCAATTCAGAAGGGGCAGG - Intergenic
1029272696 7:99386366-99386388 TGCCCCAGCTGGGGAGGGGCTGG + Intronic
1029899151 7:104021820-104021842 TGCCCCATCTTGGAAGGGGTGGG - Intergenic
1029973930 7:104815172-104815194 CACCCCAACTTAGAAGGGGTGGG + Intronic
1030514215 7:110520073-110520095 TGCCCCAGCAGGGAAGGGGCAGG + Intergenic
1034532938 7:151707944-151707966 CGGCCCAACCCAGACGGGGCAGG + Intronic
1035450828 7:158975983-158976005 CTTCCGAACTCAGAAGGGGCGGG - Intergenic
1035450883 7:158976246-158976268 CCCACCAACTCGGAAGGGGCAGG - Intergenic
1037803686 8:22048384-22048406 GCCCCCAGCTGGGAAGGGGCAGG + Exonic
1042395927 8:68292392-68292414 CATCCCAACTGAGAAGGGGCGGG - Intergenic
1043421630 8:80104242-80104264 CCCCCAAACTGGGAAGGAGCTGG - Intronic
1043958509 8:86389840-86389862 CGCCCCATCTGGGAAGGAGGTGG - Intronic
1044008915 8:86967438-86967460 GGTCCCAACTCAGAAGGGGCGGG + Intronic
1044259343 8:90098807-90098829 AGCTCCAACTCAGAAGGGGTGGG + Intergenic
1044525104 8:93242277-93242299 CACCCCAACTTGGAATGGGCAGG + Intergenic
1044581913 8:93833494-93833516 CGCCCCATCTGGGAAGTGGGGGG - Intergenic
1048421859 8:134284760-134284782 CTCCCCAACTCAGAAGGGTGGGG + Intergenic
1048901432 8:139041662-139041684 CGCCCCAGCTGTGAAGGGGCAGG + Intergenic
1049113545 8:140665544-140665566 TGCTGCAACTCGGAAGTGGCAGG - Intronic
1049823861 8:144654652-144654674 TGCCCCAACTCAGAAGGGGCGGG - Intergenic
1050130373 9:2406384-2406406 CACCCCAACTTGGAAGGGGCGGG - Intergenic
1050182220 9:2933969-2933991 TGCTCCAAATTGGAAGGGGCGGG - Intergenic
1050483847 9:6114083-6114105 CGCCCCAACTCGAAAGAGGTGGG - Intergenic
1051001677 9:12290414-12290436 CACCCCAATTCAGAAGGGGTGGG - Intergenic
1052623378 9:30943641-30943663 CGCACCAACTCAGAAAGGGGCGG - Intergenic
1052654360 9:31335653-31335675 TGCCCCAGCTCAGACGGGGCAGG + Intergenic
1053076452 9:35138663-35138685 CATCCCAACTCAGAAGGGGCAGG - Intergenic
1053617241 9:39781236-39781258 TACCCCAACTCAGAAGGGGTGGG - Intergenic
1053617296 9:39781483-39781505 CCAGCCAACTCAGAAGGGGCGGG - Intergenic
1053875423 9:42540601-42540623 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1053875481 9:42540846-42540868 CCAGCCAACTCAGAAGGGGCGGG - Intergenic
1053897166 9:42753787-42753809 CCAGCCAACTCAGAAGGGGCGGG + Intergenic
1053897219 9:42754034-42754056 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1054236219 9:62560878-62560900 CCAGCCAACTCAGAAGGGGCGGG + Intergenic
1054236277 9:62561123-62561145 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1054266870 9:62925954-62925976 CCAGCCAACTCAGAAGGGGCGGG + Intergenic
1054266925 9:62926201-62926223 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1054550363 9:66595408-66595430 CCAGCCAACTCAGAAGGGGCGGG + Intergenic
1054550418 9:66595655-66595677 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1055891017 9:81123161-81123183 CCCTCCAACTCGGAAGGGAGTGG + Intergenic
1056985990 9:91364181-91364203 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1057468387 9:95337075-95337097 TGCCCCAACTCAGAAGGGTGGGG - Intergenic
1057484338 9:95470687-95470709 CGACCCAGCTCGGAAGGGCACGG + Intronic
1057548363 9:96034682-96034704 CACCCAAACTCAGAAGGGGCAGG - Intergenic
1058091760 9:100813784-100813806 CACCCCAGCTCAGAAGAGGCAGG + Intergenic
1058510585 9:105713069-105713091 CCCACCAACTTGGAAGGGGCAGG - Intronic
1059401107 9:114071115-114071137 CCCACCAATTCAGAAGGGGCAGG - Intronic
1059565391 9:115379480-115379502 CATCCCAATTCAGAAGGGGCAGG - Intronic
1203468612 Un_GL000220v1:107058-107080 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1203476433 Un_GL000220v1:151030-151052 TCCCCCGACTCGGAAGGGGGAGG - Intergenic
1186805726 X:13138998-13139020 TGCCCCAACTCAAAAGGGGTGGG - Intergenic
1189360030 X:40343357-40343379 AGTCCCAACTCAGAAGGGGCAGG - Intergenic
1189487035 X:41442260-41442282 CGCACCTACTCGGTGGGGGCGGG - Intergenic
1189856574 X:45229932-45229954 CACCTCAACTTGGAAGGGGCAGG + Intergenic
1190444953 X:50514983-50515005 CCCACCAACTCAGAAGAGGCAGG + Intergenic
1190445025 X:50515273-50515295 GGTCCCAACTCAGAAGGGGGGGG + Intergenic
1190681633 X:52831197-52831219 CCCACCAACTCTGAAGGGGTGGG - Intergenic
1192885722 X:75334909-75334931 CGCCCCATCTGGGAAGTGGGGGG - Intergenic
1193108675 X:77705351-77705373 AGCTCCAACTTGGAAGGGGCAGG + Intronic
1194205221 X:91003295-91003317 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1194379209 X:93174490-93174512 TGCCCCAATTCAGAAGGGGCAGG - Intergenic
1194380139 X:93181213-93181235 CACCTCAACTCAGAAGGGGCAGG - Intergenic
1195454422 X:105051659-105051681 TGCCCTAACTCAGAAAGGGCGGG + Intronic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1196883773 X:120223876-120223898 CCCACCAACTTGGAAGGGGTGGG + Intergenic
1196883837 X:120224146-120224168 CTCCCCAACCTGGAAGGGGTGGG + Intergenic
1197951958 X:131907855-131907877 CGTCCCAACTCACAAGGGGCGGG - Intergenic
1199360166 X:146907793-146907815 TTCCCCAACTCAGAAGGGACAGG + Intergenic
1199614603 X:149647090-149647112 CCCACCAACTCGGAAGGGGCAGG - Intergenic
1199861233 X:151801729-151801751 CACTCCAACTCAGAAGGGACAGG + Intergenic
1200097535 X:153671227-153671249 CTCCCCAACCCAGCAGGGGCAGG + Intronic
1200551040 Y:4578432-4578454 CTTCCCAACTCAGAAGGGGCAGG + Intergenic