ID: 1085106972

View in Genome Browser
Species Human (GRCh38)
Location 11:73853227-73853249
Sequence AATAACTAAAAGAGTATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4075
Summary {0: 7, 1: 409, 2: 980, 3: 1219, 4: 1460}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085106972 Original CRISPR AATAACTAAAAGAGTATAGT TGG Intronic
Too many off-targets to display for this crispr