ID: 1085120711

View in Genome Browser
Species Human (GRCh38)
Location 11:73965646-73965668
Sequence GGAGTGGAAGGATCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085120700_1085120711 19 Left 1085120700 11:73965604-73965626 CCATGCTTTCCACAGATGGAACC 0: 1
1: 1
2: 0
3: 22
4: 248
Right 1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1085120707_1085120711 -3 Left 1085120707 11:73965626-73965648 CCATCTGGACATGCGACTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1085120705_1085120711 -2 Left 1085120705 11:73965625-73965647 CCCATCTGGACATGCGACTGGGG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1085120698_1085120711 28 Left 1085120698 11:73965595-73965617 CCGATGCGGCCATGCTTTCCACA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1085120702_1085120711 10 Left 1085120702 11:73965613-73965635 CCACAGATGGAACCCATCTGGAC 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085120711 Original CRISPR GGAGTGGAAGGATCCCCAGT GGG Intronic