ID: 1085122069

View in Genome Browser
Species Human (GRCh38)
Location 11:73973678-73973700
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085122061_1085122069 -3 Left 1085122061 11:73973658-73973680 CCTGGCTTCTTGCGGCCTCCTTG No data
Right 1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG No data
1085122057_1085122069 13 Left 1085122057 11:73973642-73973664 CCTGTGCAGCCAAGGCCCTGGCT No data
Right 1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG No data
1085122060_1085122069 -2 Left 1085122060 11:73973657-73973679 CCCTGGCTTCTTGCGGCCTCCTT No data
Right 1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG No data
1085122056_1085122069 14 Left 1085122056 11:73973641-73973663 CCCTGTGCAGCCAAGGCCCTGGC No data
Right 1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG No data
1085122054_1085122069 15 Left 1085122054 11:73973640-73973662 CCCCTGTGCAGCCAAGGCCCTGG No data
Right 1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG No data
1085122059_1085122069 4 Left 1085122059 11:73973651-73973673 CCAAGGCCCTGGCTTCTTGCGGC No data
Right 1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085122069 Original CRISPR TTGGATGCCTAGCTGGGGCA GGG Intergenic
No off target data available for this crispr