ID: 1085122158

View in Genome Browser
Species Human (GRCh38)
Location 11:73974162-73974184
Sequence CTGTGGCTGTGGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085122147_1085122158 10 Left 1085122147 11:73974129-73974151 CCCAGTTCAGTAACATTTCCTCT No data
Right 1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG No data
1085122153_1085122158 -8 Left 1085122153 11:73974147-73974169 CCTCTGTGGGTGTGGCTGTGGCT No data
Right 1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG No data
1085122145_1085122158 19 Left 1085122145 11:73974120-73974142 CCTGCTCCACCCAGTTCAGTAAC No data
Right 1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG No data
1085122148_1085122158 9 Left 1085122148 11:73974130-73974152 CCAGTTCAGTAACATTTCCTCTG No data
Right 1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG No data
1085122146_1085122158 13 Left 1085122146 11:73974126-73974148 CCACCCAGTTCAGTAACATTTCC No data
Right 1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085122158 Original CRISPR CTGTGGCTGTGGAGGGTGGA AGG Intergenic
No off target data available for this crispr