ID: 1085122853

View in Genome Browser
Species Human (GRCh38)
Location 11:73978321-73978343
Sequence TGCCACTGTGAAGTTTCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085122853_1085122860 -4 Left 1085122853 11:73978321-73978343 CCCCAAGAAACTTCACAGTGGCA 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1085122860 11:73978340-73978362 GGCAGTAGGGGGCACATCTGTGG 0: 1
1: 0
2: 0
3: 24
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085122853 Original CRISPR TGCCACTGTGAAGTTTCTTG GGG (reversed) Exonic
900723789 1:4201178-4201200 AGACACTGTGAAGTTTATGGTGG + Intergenic
905861485 1:41354973-41354995 TGGCACTGTGAAGTTTCCTCAGG + Intergenic
906059164 1:42937057-42937079 TGGCACTGTGATGTTTCTGCTGG - Intronic
906480458 1:46196068-46196090 TGCCACTGTGTAGGTGCTGGAGG - Exonic
908507347 1:64818026-64818048 TACCATTGAGAAGTTTCTTCAGG + Intronic
911428591 1:97754704-97754726 CACCACTGTGAAGATTCTTGAGG - Intronic
913181926 1:116330592-116330614 TGCACCTGTGAACTTTCTAGAGG + Intergenic
917134281 1:171774040-171774062 TAACACTGTGAAGCTTCTAGAGG - Intergenic
917969366 1:180197169-180197191 TGCTCCAGTGAAGCTTCTTGGGG + Exonic
918639035 1:186816025-186816047 TGCCTATGTGAAGTTTCTCAGGG + Intergenic
919779844 1:201214672-201214694 AGTCACTGTGATGTCTCTTGGGG - Intronic
920352424 1:205346134-205346156 TTCCTCTGTGAAGGTTCTAGAGG - Intronic
920670739 1:208002209-208002231 AGCCACTGTGATGTTCCTTGTGG + Intergenic
921141961 1:212316872-212316894 TGGCACTGTTCAGTTTCTTTAGG + Intronic
921289735 1:213646408-213646430 GGCCAATGAGAAGTATCTTGTGG + Intergenic
923839141 1:237648811-237648833 GGTCAGTGGGAAGTTTCTTGAGG - Intronic
924634579 1:245773898-245773920 TTCTGCTGTTAAGTTTCTTGAGG - Intronic
1065199720 10:23301271-23301293 TTCCACTTTCAATTTTCTTGGGG - Intronic
1066250903 10:33631872-33631894 AGCCACTGTGAAATTCTTTGTGG - Intergenic
1066349539 10:34624727-34624749 TGGCACTGTGGGGTTTCTTGGGG - Intronic
1067404139 10:46005214-46005236 TGCAGCTCTGTAGTTTCTTGAGG - Intronic
1068475665 10:57521167-57521189 AGCCTCTGTGAATTCTCTTGAGG - Intergenic
1069873493 10:71547502-71547524 AGCCACTGTGGAGTTACTGGAGG + Intronic
1071950863 10:90701349-90701371 TACCTCTGTGAAGTTTCTAGAGG - Intergenic
1075183138 10:120230102-120230124 TGCTACTGTGAACATTCTTGCGG + Intergenic
1075350468 10:121720156-121720178 TGTTACTGTTAGGTTTCTTGTGG + Intergenic
1075434354 10:122422337-122422359 TGTCACTGTTAAGTATCTTGTGG - Intronic
1076242406 10:128918648-128918670 TGCCACTATGCTGTTTCTCGAGG - Intergenic
1079276073 11:19038903-19038925 TGGCACTTTGTAGTCTCTTGGGG + Intergenic
1079601633 11:22317324-22317346 TTCCACTTTCAATTTTCTTGGGG - Intergenic
1080703514 11:34666544-34666566 TATCATTATGAAGTTTCTTGAGG - Intergenic
1081024586 11:37994437-37994459 TGCCATTGAGAAGTCTCTTGTGG + Intergenic
1081894232 11:46571024-46571046 TGCCACTTTGTACTTCCTTGAGG - Intronic
1083010413 11:59391976-59391998 TGCCACTCAGTATTTTCTTGGGG - Intergenic
1083459911 11:62804390-62804412 TGCCACTTTGAAGTTTTGTGAGG + Intronic
1084264552 11:67998110-67998132 TGCCAGTGGGATCTTTCTTGGGG - Intronic
1084360895 11:68667869-68667891 TGCCAGTGTGCAGTTTTTTTCGG - Intergenic
1084950287 11:72661397-72661419 TGCCTCTGTCCAGTTTTTTGGGG + Intronic
1085122853 11:73978321-73978343 TGCCACTGTGAAGTTTCTTGGGG - Exonic
1088262354 11:107955983-107956005 AATCTCTGTGAAGTTTCTTGGGG - Intronic
1090849103 11:130555817-130555839 TGCCACTGTGTAGATTCTAAAGG + Intergenic
1091846466 12:3659865-3659887 TGCAACTGTTAGGTTTCATGTGG + Intronic
1092672689 12:10882248-10882270 TGCCCCTGTGGAGGTCCTTGTGG + Exonic
1092677005 12:10931027-10931049 TGCCCCTGTGGAGGTCCTTGTGG - Exonic
1094270795 12:28612078-28612100 CTCAACTGTGAAGTTTCGTGGGG - Intergenic
1097377656 12:58858778-58858800 TTCCACTTTCAATTTTCTTGGGG - Intergenic
1097678499 12:62627523-62627545 TGCCATGGTTAAGTTTCCTGAGG + Intergenic
1097883307 12:64705400-64705422 TGCCACTGTAAATTTTTCTGGGG - Intergenic
1098656856 12:73042150-73042172 TGCCACTGAGAAATTTATTTCGG + Intergenic
1098940109 12:76524601-76524623 TACCACTGTGAAGTTTTTTTTGG + Intronic
1099560186 12:84163797-84163819 TGCAAATGTGCAGGTTCTTGCGG - Intergenic
1101410069 12:104460121-104460143 TGCTTCTCTGAAGTATCTTGGGG + Intronic
1102403765 12:112654343-112654365 TGTCCCTGTGAATTTTCTTGGGG + Intronic
1106437458 13:29735995-29736017 TGCCAAAGTGCAGTTTCTGGTGG - Intergenic
1108759225 13:53542632-53542654 TGCCAGTGTGAAGTTTGTCTTGG - Intergenic
1109422143 13:62128019-62128041 TGTTACTGTGATGTGTCTTGTGG + Intergenic
1109928905 13:69186041-69186063 TGCTTCTGTGAAGTTTCTCTAGG + Intergenic
1109931404 13:69222647-69222669 TTCCACTTTCAATTTTCTTGGGG + Intergenic
1110333844 13:74303275-74303297 CTCCACAGTGAAGGTTCTTGGGG - Intergenic
1110374623 13:74778100-74778122 AGGCACTGTGAACTTTCCTGAGG - Intergenic
1111360046 13:87164059-87164081 TGTCACTGTGAAGTTAGTAGTGG + Intergenic
1112921975 13:104625324-104625346 TGCAACTGTGCATTTTCTGGTGG - Intergenic
1113190316 13:107738282-107738304 TGCCTATGAGAAGTTTCTTCTGG + Intronic
1113340409 13:109417854-109417876 GAACACTGTTAAGTTTCTTGGGG + Intergenic
1113785299 13:112999274-112999296 TGTCACACTGAAGTTTCTGGTGG - Intronic
1114383961 14:22237374-22237396 TCCCACTTTCAACTTTCTTGGGG + Intergenic
1115976590 14:39003696-39003718 TGCCTCTGAAAAGTTTCTTAGGG - Intergenic
1116401841 14:44516410-44516432 TGCTACTGTGAATATTGTTGCGG + Intergenic
1118216792 14:63816397-63816419 TTGGACTGTGAAATTTCTTGGGG + Intergenic
1119016512 14:71061936-71061958 CTTCACTGTGAATTTTCTTGGGG - Intronic
1119354786 14:73997090-73997112 TGGGACTGGGAAGCTTCTTGAGG + Intronic
1120053219 14:79892550-79892572 TGCAAAGGTGAAGTTTCTAGAGG + Intergenic
1120922069 14:89764330-89764352 TGTGACTCTGAATTTTCTTGGGG + Intergenic
1120992322 14:90388525-90388547 TGCAACTGTGAACCTTCGTGTGG + Intergenic
1121430095 14:93880370-93880392 TGCCACTGTAAACTTTGTTAAGG + Intergenic
1121864901 14:97353586-97353608 GCCCACTGTGAGGTTTCTTGTGG - Intergenic
1122871650 14:104641479-104641501 GGCCACTGGGAAGGTCCTTGTGG - Intergenic
1124033269 15:26030645-26030667 ATCCACTGGGAATTTTCTTGCGG + Intergenic
1124033322 15:26031089-26031111 ATCCACTGGGAATTTTCTTGCGG + Intergenic
1124509545 15:30311658-30311680 TACCTCAGTGAAGTTTCTAGGGG + Intergenic
1124734015 15:32227004-32227026 TACCTCAGTGAAGTTTCTAGGGG - Intergenic
1129989089 15:79946288-79946310 CTCCACTATTAAGTTTCTTGTGG - Intergenic
1131677363 15:94684258-94684280 TTACACTGTGAACTTTTTTGGGG - Intergenic
1136056548 16:27694024-27694046 TGACACTGAGATGGTTCTTGGGG + Intronic
1136916941 16:34214055-34214077 TGCTTCTGTGTAGTTTCTTTGGG + Intergenic
1139389178 16:66595066-66595088 TGCCACTTTCAAGTTCCTAGGGG - Intergenic
1141587947 16:85047629-85047651 TGCCGCTGTGGAATTTCCTGGGG + Intronic
1146277802 17:31526046-31526068 TGCCCCTGTGCAGTTTGGTGAGG + Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1147415683 17:40287916-40287938 TGCCGCTGTGCAGTTTGTTCAGG + Exonic
1148197993 17:45728632-45728654 TGCCCCGGTGAAGTTCCATGTGG - Intergenic
1148350089 17:46935079-46935101 TGCCGTTGTGAACTTTCTGGAGG - Exonic
1148695495 17:49555867-49555889 TCCCACTGCCAGGTTTCTTGGGG + Intergenic
1149344240 17:55718165-55718187 AGCCACTGTGAAGTGGCTTAGGG + Intergenic
1149523099 17:57333318-57333340 TGCCACTGGGAACTTTCCAGGGG - Intronic
1150299495 17:64036531-64036553 TGGCCCAGTGAAGTTTCTAGAGG - Intergenic
1150457907 17:65322562-65322584 TTGCACTGTGAGGTTTCTAGAGG + Intergenic
1150906460 17:69343561-69343583 TGCCACTGATAATTATCTTGAGG - Intergenic
1155791646 18:29978073-29978095 TGCCACTGTGAAGCCAGTTGTGG + Intergenic
1156506331 18:37597040-37597062 TGCCACTGTCTAGTTTCCTGTGG - Intergenic
1157929546 18:51806212-51806234 TGCCTTTGTGAATTTTGTTGGGG + Intergenic
1160197269 18:76766314-76766336 TGCCACTGTGAAGTATCTCCAGG - Intergenic
1160770325 19:828179-828201 GGCCACTGTGTGGATTCTTGGGG + Intronic
1161763540 19:6192501-6192523 TGCCACTCTAAAGTTCATTGTGG + Intronic
1161902280 19:7128090-7128112 TGCAACTGTGATGTTGCATGTGG + Intronic
1162528513 19:11221917-11221939 GGCCACTGTGAAGGCTCGTGTGG - Exonic
1164056993 19:21630123-21630145 TTCCACTTTCAATTTTCTTGGGG + Intergenic
1166995583 19:46718261-46718283 TCCCAGAGTGAAGTTGCTTGAGG + Intergenic
924974410 2:159779-159801 TTCCACTTTCAATTTTCTTGGGG - Intergenic
926864094 2:17339931-17339953 TTCCACTTTCAATTTTCTTGGGG + Intergenic
929376623 2:41294972-41294994 TGATCCTTTGAAGTTTCTTGAGG + Intergenic
929772432 2:44903563-44903585 TGGGACTGAGAAGTTTCCTGCGG + Intergenic
930167326 2:48215756-48215778 TGCCTCTGTCTAGTTTCTAGTGG - Intergenic
932917288 2:75872696-75872718 TTCCACTTTTAATTTTCTTGGGG + Intergenic
935609340 2:105004790-105004812 CACCACTGGGAAATTTCTTGTGG - Intergenic
940831532 2:158471808-158471830 TGCCATTGTTAAGTTTAATGAGG - Intronic
940896466 2:159085835-159085857 TGCCCCTTTGAAATTTCATGTGG - Intronic
942745162 2:179223650-179223672 TGCCAAAGTGAAGTTTCTCATGG - Intronic
943099809 2:183474316-183474338 TGATACTGTGAAGTTCCTTGTGG + Intergenic
944165371 2:196714012-196714034 TTCCAATGTTAAATTTCTTGGGG - Intronic
945034083 2:205689173-205689195 TGCCACTGAGAAGTTTTGTGGGG + Intronic
947686900 2:232095884-232095906 TGCCACTGTAAAGTTTCCACTGG + Intronic
948028593 2:234798597-234798619 TCCCAGTTTAAAGTTTCTTGGGG + Intergenic
948128932 2:235585988-235586010 TGCCACTGAGAAGTGTATTTAGG + Intronic
1169687489 20:8291442-8291464 TGCCACCATGAAGCTACTTGTGG + Intronic
1169781734 20:9317429-9317451 TCCCTCTCTGAAGTTTCTTTGGG + Intronic
1170480235 20:16757844-16757866 TGCCAATGAGAAGTTTATTCTGG + Intronic
1173104737 20:40123242-40123264 TGCCACCATGAAGTTTGATGGGG - Intergenic
1174531780 20:51220116-51220138 TGCCACTGTGGAGTGTCCTATGG + Intergenic
1174849306 20:53976811-53976833 TCCCACAGTGAAGTTTCTCTGGG + Intronic
1175283885 20:57824121-57824143 CTTCACTGTGAATTTTCTTGAGG + Intergenic
1177263869 21:18759546-18759568 TTCCACTTTCAATTTTCTTGGGG - Intergenic
1177895841 21:26855414-26855436 TTCCACTTTCAATTTTCTTGGGG + Intergenic
1178045580 21:28690324-28690346 TGCCACAATTCAGTTTCTTGAGG - Intergenic
1178563444 21:33660735-33660757 TGACACTGGGTAGTTTCTTAAGG + Intronic
1179259496 21:39745645-39745667 TTCCACTTTCAATTTTCTTGGGG - Intronic
1179707608 21:43191287-43191309 TGCCACTGTCATGTTTTCTGGGG - Intergenic
1181078363 22:20396309-20396331 TTTGACTGTCAAGTTTCTTGAGG - Intronic
1182278002 22:29202460-29202482 TTCCCCTGTGAAGTCTCTGGGGG - Intergenic
1182365595 22:29776851-29776873 TGCCATTGTGCAGTATCATGGGG - Intergenic
1184626972 22:45742560-45742582 TTCCTCTGTGATCTTTCTTGAGG - Intronic
949584799 3:5426983-5427005 AGACACTGTGAAGTATCTGGGGG + Intergenic
949674803 3:6441189-6441211 TGCCTGTGTGAAGTTACTTTAGG - Intergenic
951201070 3:19875856-19875878 TTCCACTTTCAATTTTCTTGGGG - Intergenic
952032791 3:29164404-29164426 TCCTACTGTGAAGCTTCTGGAGG + Intergenic
953473460 3:43185673-43185695 TGTTAATGTGAAGTTTCTTAGGG - Intergenic
955560687 3:60186508-60186530 TGCCACTGTCAAGTTGCTCTTGG - Intronic
958596102 3:96225877-96225899 TTTCACTGTGAATTTTCCTGGGG - Intergenic
958630254 3:96674416-96674438 TTCCACTTTCAATTTTCTTGGGG - Intergenic
960087225 3:113604373-113604395 TCCCACTATGAAATTTCATGTGG - Intronic
960231028 3:115227663-115227685 AAACACTGTGAAGTTTCCTGAGG - Intergenic
963494705 3:146044724-146044746 TGTAACTGTTAAGTTTCCTGAGG - Intergenic
964287647 3:155137038-155137060 TGCCACTGTGAACTTGAATGAGG + Intronic
965358401 3:167707227-167707249 TCCCACTTAGAAGTTTCTTCAGG + Intronic
971729701 4:30361504-30361526 TCCCACTGCTAAGATTCTTGAGG + Intergenic
971857168 4:32058568-32058590 TGCCACTTAGAAATTTCTTCTGG + Intergenic
972529616 4:39949844-39949866 TGCCACAGTCAGGTTTTTTGTGG - Intronic
973343616 4:49031060-49031082 TGCCCCAGTGATGCTTCTTGGGG + Intronic
973953964 4:56044958-56044980 TGCCAGTGTGGGGTTTCTTTTGG - Intergenic
975024411 4:69531193-69531215 TACCTCAGTGAAGTTTCTTAGGG + Intergenic
976189397 4:82474269-82474291 TTCCACTTTGAATTTTCCTGGGG + Intergenic
976946043 4:90769247-90769269 GTCTCCTGTGAAGTTTCTTGGGG - Intronic
977847147 4:101779666-101779688 TGCCTCAGTGAAATTTCTAGTGG - Intronic
978844738 4:113259480-113259502 TTCCACAGTGAAGTTTCTGATGG + Intronic
979811095 4:125037265-125037287 TTCCACTGTAAAGTTATTTGTGG - Intergenic
989688113 5:44112105-44112127 TTCCACTTTCAATTTTCTTGGGG + Intergenic
990283096 5:54272645-54272667 GGCCATTGTGAGGTTTCTTTTGG - Intronic
992293602 5:75305193-75305215 TTCCACTTTCAATTTTCTTGGGG + Intergenic
992820684 5:80493074-80493096 TGGCACTTTGAATTTTCTTCAGG - Intronic
994283432 5:97934540-97934562 TGCCACTGCAAAATTTCATGTGG + Intergenic
995182134 5:109239223-109239245 TGCCACTGTTAAGTTCCTAATGG + Intergenic
995465276 5:112444695-112444717 TGCCACTTTCAATTTTCTTGGGG + Intergenic
996915773 5:128710832-128710854 TGATACTGTCTAGTTTCTTGAGG - Intronic
997419437 5:133754447-133754469 TGCCATTGTGAATTTTTGTGTGG - Intergenic
997432600 5:133851163-133851185 TGCCAGTGGGAGGGTTCTTGGGG - Intergenic
997622994 5:135311920-135311942 GGACACTGGGAAGTTTGTTGAGG + Intronic
998882824 5:146661124-146661146 TGCCACTGGGCAGTGTCTGGAGG + Intronic
1001002041 5:168016661-168016683 TCCCACTGAGAAGGTGCTTGGGG - Intronic
1001242274 5:170079827-170079849 GCCCACTGGGAAGTTTCTGGAGG - Intronic
1004039415 6:11961025-11961047 TCTCACTGTGAAGGATCTTGTGG - Intergenic
1004803215 6:19173847-19173869 TGACACTGGGGAGTTTCTAGGGG + Intergenic
1005324025 6:24682034-24682056 TTCCACTTTCAATTTTCTTGGGG - Intronic
1008990642 6:57597768-57597790 GGCAACTCTGAAGTGTCTTGCGG + Intronic
1009179214 6:60496314-60496336 GGCAACTCTGAAGTGTCTTGTGG + Intergenic
1009607651 6:65895314-65895336 TGTAACTGTTAAGTTTCCTGAGG - Intergenic
1010980755 6:82365768-82365790 TGCCATTGTGAAGGACCTTGAGG - Exonic
1011841279 6:91502588-91502610 TGCAATTGTGAAGTTACTTAGGG - Intergenic
1011956270 6:93028865-93028887 TTCCACCCTGAAGTTTCCTGAGG - Intergenic
1013134551 6:107268703-107268725 TGCAACTGTGAAGAATATTGCGG - Intronic
1013949112 6:115758068-115758090 TGCCACTGAGTAGTTACTTTTGG + Intergenic
1014931093 6:127337177-127337199 TTGCCCTGCGAAGTTTCTTGTGG + Intronic
1015387812 6:132645787-132645809 GGCCACTGTGGACTTTCTTCTGG - Exonic
1018498544 6:164377436-164377458 TGGCACTTTGAAGTTTCTGTTGG - Intergenic
1018609355 6:165632433-165632455 CTCCACTGAGAAGTTTCTTTAGG + Intronic
1018760675 6:166891901-166891923 TTCCACTTTCAATTTTCTTGGGG + Intronic
1021518320 7:21511184-21511206 TGCAACTGTGACAATTCTTGGGG - Exonic
1022124690 7:27344102-27344124 TGCTACTGTGAAGTTTGGTATGG + Intergenic
1023182072 7:37494907-37494929 TGCCACTCTGAATTTTCTTGGGG + Intergenic
1023209256 7:37785403-37785425 TGCCACTCTGAAGTATTTTTAGG - Intronic
1024120876 7:46238224-46238246 CACCCCTTTGAAGTTTCTTGAGG - Intergenic
1024491890 7:49995051-49995073 TGCCTCAGTGAAATTTCTAGGGG - Intronic
1024521914 7:50312783-50312805 TTCCACTGTGAAACTTTTTGAGG - Intronic
1026169124 7:67937580-67937602 TCCAACTGTTAAATTTCTTGGGG + Intergenic
1027867329 7:83664224-83664246 TGATTCTGTGAAATTTCTTGGGG - Intergenic
1028756077 7:94435755-94435777 TGGCACTGTAAAATGTCTTGAGG + Intergenic
1028788375 7:94823411-94823433 TCCCTCTGTGAATTTTCTTCTGG - Intergenic
1028810586 7:95081890-95081912 TGGCACTGGGAAGTTTGTTGGGG - Intronic
1030359671 7:108581479-108581501 TGACACTTGGAAGTTTCTTTTGG + Intergenic
1030843878 7:114385520-114385542 TTCCACTTTCAATTTTCTTGGGG - Intronic
1031264439 7:119566354-119566376 TTCCACTTTCAATTTTCTTGGGG + Intergenic
1033719193 7:144039127-144039149 TGCTAGTCTGAAGTTTCCTGAGG - Intergenic
1034023189 7:147668183-147668205 TTTCACTGTGAATTTCCTTGGGG - Intronic
1036234484 8:7026474-7026496 TGTCACTGTAAGGGTTCTTGGGG + Intergenic
1036527402 8:9547953-9547975 TACCCCAGTGAAGTTTCTAGGGG - Intergenic
1037518394 8:19656420-19656442 TGCTACTGCTAAGTTTCTTCTGG - Intronic
1038727359 8:30093801-30093823 TGCCACTTTGAAGTCTGGTGTGG - Intergenic
1040690828 8:49936545-49936567 TGCCAAAGTGAATTTTCTGGAGG - Intronic
1042500382 8:69502322-69502344 TGACACTGTGGAGTATGTTGTGG - Intronic
1043067528 8:75594280-75594302 TGACACTCTCAAATTTCTTGAGG - Intergenic
1043611322 8:82066866-82066888 TGCAACTGTGAAATTTCCTGGGG + Intergenic
1046984687 8:120374408-120374430 TGTCACTGTGCAGTTACTTAAGG + Intergenic
1047174821 8:122530358-122530380 TGTCATTGTGAAGTTTCTAAAGG - Intergenic
1047204090 8:122789528-122789550 TGTCATGGTGAAGTTTTTTGTGG + Intronic
1049322390 8:142003478-142003500 CCCCACTGTGAAGTGACTTGGGG + Intergenic
1050000546 9:1072783-1072805 TCCCACTGGGAAATTCCTTGTGG - Intergenic
1050094547 9:2050425-2050447 TGCCAATGTGATGATTCCTGAGG - Intronic
1050396208 9:5199626-5199648 TGTGACTATGAAGATTCTTGTGG - Intergenic
1051316370 9:15837578-15837600 AGCCTCTGGGCAGTTTCTTGAGG - Intronic
1051605688 9:18916007-18916029 TCCCTCTGTGAAGTCTCTTTAGG - Intergenic
1052753751 9:32519906-32519928 TGCCAGTTTGAAGATTCTAGTGG + Intronic
1056590309 9:87961606-87961628 TGCCAAAGCTAAGTTTCTTGGGG + Intergenic
1059297640 9:113286117-113286139 AGCCATTGTAAAGTTTATTGGGG + Intronic
1060845507 9:126833760-126833782 TGCCTGTGTGAATTTTCATGTGG - Exonic
1062471003 9:136704432-136704454 TGCCACGATGATGTTTCCTGAGG - Intergenic
1186345191 X:8684738-8684760 AGCCATTGTGAAGTTTCTCTTGG + Intronic
1186457949 X:9725480-9725502 TGCCACTAGGAAGTTTTCTGAGG - Exonic
1187892027 X:23945466-23945488 TGCCTCTGTGTAGTTTGTGGTGG - Intergenic
1191014768 X:55797385-55797407 TTTCACTGTGGATTTTCTTGAGG + Intergenic
1192330910 X:70174602-70174624 TGCTCCTTTGAAGTTTCTTTGGG + Intergenic
1193306357 X:79956678-79956700 TTCCACTTTCAATTTTCTTGGGG + Intergenic
1193476957 X:81978096-81978118 TGCCACAGTGTATTTTCTTCAGG + Intergenic
1195584713 X:106551999-106552021 TTCCACTTTCAATTTTCTTGGGG + Intergenic
1198913464 X:141638972-141638994 TGCCACTTAGAAATTTCTTCTGG + Intronic