ID: 1085123956

View in Genome Browser
Species Human (GRCh38)
Location 11:73984824-73984846
Sequence CTTAAATTCTTTCAGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085123948_1085123956 4 Left 1085123948 11:73984797-73984819 CCACTGTGCCTGGCCTCAAGAAA No data
Right 1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG No data
1085123949_1085123956 -4 Left 1085123949 11:73984805-73984827 CCTGGCCTCAAGAAATTCTCTTA No data
Right 1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG No data
1085123950_1085123956 -9 Left 1085123950 11:73984810-73984832 CCTCAAGAAATTCTCTTAAATTC No data
Right 1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085123956 Original CRISPR CTTAAATTCTTTCAGGGTGG GGG Intergenic
No off target data available for this crispr