ID: 1085125444

View in Genome Browser
Species Human (GRCh38)
Location 11:73999039-73999061
Sequence GCTACTCGGGGGGCTCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085125444_1085125457 17 Left 1085125444 11:73999039-73999061 CCCACCTGAGCCCCCCGAGTAGC No data
Right 1085125457 11:73999079-73999101 GTCACCATGCCTGGCTAAAAAGG No data
1085125444_1085125458 18 Left 1085125444 11:73999039-73999061 CCCACCTGAGCCCCCCGAGTAGC No data
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125444_1085125456 8 Left 1085125444 11:73999039-73999061 CCCACCTGAGCCCCCCGAGTAGC No data
Right 1085125456 11:73999070-73999092 CAGGCACATGTCACCATGCCTGG 0: 117
1: 2578
2: 11857
3: 38384
4: 85447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085125444 Original CRISPR GCTACTCGGGGGGCTCAGGT GGG (reversed) Intergenic
No off target data available for this crispr