ID: 1085125449

View in Genome Browser
Species Human (GRCh38)
Location 11:73999049-73999071
Sequence TGCGGTCCCAGCTACTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 545754
Summary {0: 42, 1: 4308, 2: 74136, 3: 197990, 4: 269278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085125449_1085125456 -2 Left 1085125449 11:73999049-73999071 CCCCCCGAGTAGCTGGGACCGCA 0: 42
1: 4308
2: 74136
3: 197990
4: 269278
Right 1085125456 11:73999070-73999092 CAGGCACATGTCACCATGCCTGG 0: 117
1: 2578
2: 11857
3: 38384
4: 85447
1085125449_1085125457 7 Left 1085125449 11:73999049-73999071 CCCCCCGAGTAGCTGGGACCGCA 0: 42
1: 4308
2: 74136
3: 197990
4: 269278
Right 1085125457 11:73999079-73999101 GTCACCATGCCTGGCTAAAAAGG No data
1085125449_1085125458 8 Left 1085125449 11:73999049-73999071 CCCCCCGAGTAGCTGGGACCGCA 0: 42
1: 4308
2: 74136
3: 197990
4: 269278
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085125449 Original CRISPR TGCGGTCCCAGCTACTCGGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr