ID: 1085125453

View in Genome Browser
Species Human (GRCh38)
Location 11:73999052-73999074
Sequence GCCTGCGGTCCCAGCTACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544245
Summary {0: 71, 1: 6965, 2: 90872, 3: 208394, 4: 237943}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085125453_1085125457 4 Left 1085125453 11:73999052-73999074 CCCGAGTAGCTGGGACCGCAGGC 0: 71
1: 6965
2: 90872
3: 208394
4: 237943
Right 1085125457 11:73999079-73999101 GTCACCATGCCTGGCTAAAAAGG No data
1085125453_1085125456 -5 Left 1085125453 11:73999052-73999074 CCCGAGTAGCTGGGACCGCAGGC 0: 71
1: 6965
2: 90872
3: 208394
4: 237943
Right 1085125456 11:73999070-73999092 CAGGCACATGTCACCATGCCTGG 0: 117
1: 2578
2: 11857
3: 38384
4: 85447
1085125453_1085125458 5 Left 1085125453 11:73999052-73999074 CCCGAGTAGCTGGGACCGCAGGC 0: 71
1: 6965
2: 90872
3: 208394
4: 237943
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085125453 Original CRISPR GCCTGCGGTCCCAGCTACTC GGG (reversed) Intergenic
Too many off-targets to display for this crispr