ID: 1085125454

View in Genome Browser
Species Human (GRCh38)
Location 11:73999053-73999075
Sequence TGCCTGCGGTCCCAGCTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338036
Summary {0: 45, 1: 4327, 2: 42995, 3: 141696, 4: 148973}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085125454_1085125457 3 Left 1085125454 11:73999053-73999075 CCGAGTAGCTGGGACCGCAGGCA 0: 45
1: 4327
2: 42995
3: 141696
4: 148973
Right 1085125457 11:73999079-73999101 GTCACCATGCCTGGCTAAAAAGG No data
1085125454_1085125456 -6 Left 1085125454 11:73999053-73999075 CCGAGTAGCTGGGACCGCAGGCA 0: 45
1: 4327
2: 42995
3: 141696
4: 148973
Right 1085125456 11:73999070-73999092 CAGGCACATGTCACCATGCCTGG 0: 117
1: 2578
2: 11857
3: 38384
4: 85447
1085125454_1085125458 4 Left 1085125454 11:73999053-73999075 CCGAGTAGCTGGGACCGCAGGCA 0: 45
1: 4327
2: 42995
3: 141696
4: 148973
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085125454 Original CRISPR TGCCTGCGGTCCCAGCTACT CGG (reversed) Intergenic
Too many off-targets to display for this crispr