ID: 1085125455

View in Genome Browser
Species Human (GRCh38)
Location 11:73999067-73999089
Sequence GGCATGGTGACATGTGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11651
Summary {0: 16, 1: 410, 2: 1339, 3: 3564, 4: 6322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085125455_1085125458 -10 Left 1085125455 11:73999067-73999089 CCGCAGGCACATGTCACCATGCC 0: 16
1: 410
2: 1339
3: 3564
4: 6322
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085125455 Original CRISPR GGCATGGTGACATGTGCCTG CGG (reversed) Intergenic
Too many off-targets to display for this crispr