ID: 1085125458

View in Genome Browser
Species Human (GRCh38)
Location 11:73999080-73999102
Sequence TCACCATGCCTGGCTAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085125451_1085125458 6 Left 1085125451 11:73999051-73999073 CCCCGAGTAGCTGGGACCGCAGG No data
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125455_1085125458 -10 Left 1085125455 11:73999067-73999089 CCGCAGGCACATGTCACCATGCC 0: 16
1: 410
2: 1339
3: 3564
4: 6322
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125450_1085125458 7 Left 1085125450 11:73999050-73999072 CCCCCGAGTAGCTGGGACCGCAG No data
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125445_1085125458 17 Left 1085125445 11:73999040-73999062 CCACCTGAGCCCCCCGAGTAGCT No data
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125454_1085125458 4 Left 1085125454 11:73999053-73999075 CCGAGTAGCTGGGACCGCAGGCA 0: 45
1: 4327
2: 42995
3: 141696
4: 148973
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125453_1085125458 5 Left 1085125453 11:73999052-73999074 CCCGAGTAGCTGGGACCGCAGGC 0: 71
1: 6965
2: 90872
3: 208394
4: 237943
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125444_1085125458 18 Left 1085125444 11:73999039-73999061 CCCACCTGAGCCCCCCGAGTAGC No data
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125449_1085125458 8 Left 1085125449 11:73999049-73999071 CCCCCCGAGTAGCTGGGACCGCA 0: 42
1: 4308
2: 74136
3: 197990
4: 269278
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125447_1085125458 14 Left 1085125447 11:73999043-73999065 CCTGAGCCCCCCGAGTAGCTGGG 0: 5
1: 1192
2: 106595
3: 292114
4: 227839
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data
1085125443_1085125458 21 Left 1085125443 11:73999036-73999058 CCTCCCACCTGAGCCCCCCGAGT No data
Right 1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085125458 Original CRISPR TCACCATGCCTGGCTAAAAA GGG Intergenic
No off target data available for this crispr