ID: 1085126832

View in Genome Browser
Species Human (GRCh38)
Location 11:74007694-74007716
Sequence TCTTAGCCACTCATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085126827_1085126832 9 Left 1085126827 11:74007662-74007684 CCTCAGCGTGATCACTTGACAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1085126832 11:74007694-74007716 TCTTAGCCACTCATGGAAAATGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085126832 Original CRISPR TCTTAGCCACTCATGGAAAA TGG Intronic
901693561 1:10990214-10990236 TCATGGCCACTCATGGAAGTAGG - Intergenic
902302807 1:15514479-15514501 TCTCAGCAGCTCATGGAAAATGG + Intronic
903070547 1:20724957-20724979 TCTTGGCCATTCCTGGAAGAGGG - Intronic
905526010 1:38640307-38640329 ACTTGGCCAGTCATGGAATATGG + Intergenic
905759699 1:40544766-40544788 TCTTAGAAATTCATAGAAAATGG + Intronic
908014026 1:59813964-59813986 TCCTAGGCACTCATTGGAAAGGG - Intergenic
909850953 1:80463516-80463538 TATTAGATATTCATGGAAAATGG + Intergenic
916541470 1:165759734-165759756 TCATAGCTACTGATGGTAAAAGG + Intronic
916762812 1:167832607-167832629 TCTTAGCACCTAATGGAAGAGGG + Intronic
917691579 1:177475263-177475285 TGTTAGCCAATAATGCAAAATGG + Intergenic
918150974 1:181798140-181798162 TCACATCCACTCAGGGAAAAAGG - Intronic
919249553 1:195035010-195035032 TCTTACAGACTCATGGTAAAGGG - Intergenic
922858563 1:228795944-228795966 TCTCAGCCCCACATGGAGAAGGG - Intergenic
923061592 1:230480274-230480296 TCTTAGAGGCACATGGAAAAAGG + Intergenic
924235220 1:241994453-241994475 TCACAGCCACTCATGGAAGCAGG + Intergenic
1064221398 10:13443665-13443687 TATTGTCCAGTCATGGAAAATGG + Intronic
1066974656 10:42356554-42356576 TCTTAGATATTCATGAAAAAGGG - Intergenic
1068212892 10:53944742-53944764 TCTTAGCCATCTTTGGAAAATGG - Intronic
1072087745 10:92097182-92097204 TTCTAGCCACTCTTGAAAAATGG - Intronic
1072122627 10:92417807-92417829 ACATAGCAGCTCATGGAAAAAGG + Intergenic
1075539486 10:123300163-123300185 TTTTAGCCACTCTGGGCAAAGGG + Intergenic
1079849828 11:25517552-25517574 TCTTATTTACTCATGCAAAAGGG - Intergenic
1082252512 11:49997324-49997346 TCTGAGCCACTATTGTAAAATGG - Intergenic
1083016506 11:59459561-59459583 TCGCAGCTACTCATGGCAAAAGG + Intergenic
1084272723 11:68037816-68037838 TCTTGGCCACTGATGAAAACAGG + Intergenic
1085126832 11:74007694-74007716 TCTTAGCCACTCATGGAAAATGG + Intronic
1087151736 11:94866222-94866244 TCTCTGCCACTCATGGGACACGG + Intronic
1087914982 11:103799800-103799822 TCTCAGCCTCTCATGTAAATGGG - Intergenic
1090307191 11:125701817-125701839 TTTTAGATACTCAGGGAAAATGG + Intergenic
1090599858 11:128358811-128358833 CCTCAGCCACCCATGGAAGAAGG + Intergenic
1091132428 11:133157732-133157754 TCTAAACAACTCAAGGAAAATGG + Intronic
1092059930 12:5540218-5540240 TTTTGGGGACTCATGGAAAAAGG - Intronic
1092730151 12:11523809-11523831 TCTTGGACACACATGGAAAAGGG + Intergenic
1093589439 12:20883027-20883049 ACTTAGCCACTCATGAAAATGGG - Intronic
1105230095 13:18486543-18486565 TCTTAGATATTCATGAAAAAGGG - Intergenic
1105321955 13:19334251-19334273 TTTTATCCACTCATGCAAGAAGG + Intergenic
1108577042 13:51799656-51799678 TCATAGCCACTCCTAGAAAGAGG + Exonic
1110170090 13:72490259-72490281 TCTGAGCCAATAATTGAAAATGG + Intergenic
1110515626 13:76408866-76408888 TTTTTGCCACTCATATAAAACGG - Intergenic
1111027566 13:82551355-82551377 TCTTATACACTCTTGGAAAGAGG - Intergenic
1112245501 13:97729799-97729821 TCTTATCCCTTCCTGGAAAATGG + Intergenic
1114014344 14:18413355-18413377 TCTTAGATATTCATGCAAAAGGG - Intergenic
1116510485 14:45739576-45739598 TCTTAGTCACTCAAGTAGAAAGG - Intergenic
1119172006 14:72542873-72542895 CCTTAGGATCTCATGGAAAAGGG - Intronic
1126994952 15:54431383-54431405 ATTTAGCCATTAATGGAAAAAGG - Intronic
1127458131 15:59173133-59173155 TATCAGCCACTCTGGGAAAATGG + Intronic
1128334696 15:66778434-66778456 TCTGCCCCACCCATGGAAAAAGG - Intronic
1128818496 15:70631260-70631282 TCTTAGCAACTCCGGGGAAAGGG + Intergenic
1131348171 15:91670961-91670983 CTTTACCCACTCATGGAAATGGG + Intergenic
1132037938 15:98502085-98502107 TCTGAGCCTCACCTGGAAAATGG - Intronic
1134313794 16:13099772-13099794 TCTAACCCACTCAGAGAAAAAGG - Intronic
1136131891 16:28227855-28227877 TTTTAGTCACTTCTGGAAAATGG - Intergenic
1144333509 17:14247772-14247794 TCTTTGGAACTCATGGAGAAAGG - Intergenic
1146427888 17:32761139-32761161 ACTAAGCCACACATGGACAAAGG + Intronic
1151226597 17:72652631-72652653 TCTTAGTCTCTCTTGGAAAGAGG - Intronic
1154523309 18:15253296-15253318 TCTTAGATATTCATGAAAAAGGG + Intergenic
1161156568 19:2734934-2734956 TCTCAGTCACCCCTGGAAAATGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163199645 19:15756897-15756919 TCTTAAAGACTCATGGTAAAGGG - Intergenic
1163667048 19:18608075-18608097 TCTAAGGGACTCCTGGAAAAGGG - Intronic
925352995 2:3215299-3215321 CCTTAGGCACTCAAGGATAATGG + Intronic
928524998 2:32130785-32130807 TTTGAGCCTCTCATGGAAAGAGG - Intronic
928993305 2:37258917-37258939 TCCTTGCCAATTATGGAAAATGG + Intronic
929929877 2:46245554-46245576 TCGTAGCCACTAAGGGCAAAGGG - Intergenic
929977472 2:46649074-46649096 TCTTATCCACTCGTGGAAGCTGG - Intergenic
933530278 2:83501014-83501036 TATTGTCCACTCATGAAAAATGG - Intergenic
933812296 2:86040335-86040357 TCCTAGCCTCTCCTGGAGAAGGG - Intronic
936006747 2:108895811-108895833 TCTGAGCCAGTCAGGGAAAGTGG - Exonic
938522613 2:132086168-132086190 TCTTAGATATTCATGAAAAAGGG + Intergenic
938740431 2:134226581-134226603 TCTGAACCACACATGTAAAATGG + Intronic
942455120 2:176132723-176132745 TGTTAGTGATTCATGGAAAAGGG - Intergenic
942995046 2:182250659-182250681 TCATAGTCACTCATGTACAATGG - Intronic
946795612 2:223348419-223348441 TCTTATAAACTCAAGGAAAAGGG + Intergenic
946857235 2:223963058-223963080 TCATAGAAACTCATGTAAAATGG - Intronic
947360403 2:229340247-229340269 TCTCTGACACTCATGGAGAATGG - Intergenic
948657420 2:239485241-239485263 TCTCAGCCACTGCTGGGAAAGGG + Intergenic
948954498 2:241277107-241277129 TCTAAGTAACTCATGGAACAAGG + Intronic
1169724579 20:8714971-8714993 GCTTAAACATTCATGGAAAAGGG + Intronic
1169968759 20:11246440-11246462 TTTTGTTCACTCATGGAAAATGG + Intergenic
1172836366 20:37875817-37875839 TCTTTGGCACACATGGAAAGTGG + Intergenic
1173962382 20:47084775-47084797 TCTCATCCACTGCTGGAAAATGG + Intronic
1174936439 20:54875405-54875427 GTTTAACCACTCATGGAAAAAGG - Intergenic
1175231131 20:57474026-57474048 TATTAGCAACTCATGGAGATTGG + Intergenic
1176774080 21:13114889-13114911 TCTTAGATATTCATGAAAAAGGG - Intergenic
1177297983 21:19201906-19201928 TCTATGCCACTCTTGGCAAATGG + Intergenic
1179448568 21:41451934-41451956 ACTTAGCCACTCTTAGAAATAGG + Intronic
1180438841 22:15344161-15344183 TCTTAGATATTCATGCAAAAGGG - Intergenic
1182520653 22:30882729-30882751 TGATAGCCTCTCATAGAAAATGG - Intronic
954085920 3:48243851-48243873 TCTTTGCCACTCATGACAAGAGG - Intronic
955342567 3:58136696-58136718 TCTTAGAAACTGAAGGAAAAAGG - Intronic
960127709 3:114018557-114018579 TCTTAACCACTTATGAAATATGG - Intronic
962596289 3:136947841-136947863 TGTTAGCTACACATTGAAAAGGG + Intronic
964326178 3:155548391-155548413 TCTGAGGCACTCATGGGAAAGGG - Intronic
964628991 3:158788664-158788686 TCTTAGCCACCCCTGGCTAAGGG + Intronic
966953390 3:184846278-184846300 TCTTAGCCATTCCTGCAATATGG - Intronic
968126390 3:196163635-196163657 CCTTGGGCACTCATGGCAAAGGG - Intergenic
969091934 4:4701255-4701277 GCACAACCACTCATGGAAAACGG - Intergenic
969307630 4:6334930-6334952 CCTTATCCCCTCATGGGAAATGG + Intronic
970808379 4:20062550-20062572 TGCTATCCACTCCTGGAAAATGG - Intergenic
971401406 4:26279232-26279254 GCCTAGCCACTTATAGAAAAGGG + Intronic
976257406 4:83112849-83112871 CCTTAGCCATTCAAGGTAAAAGG + Intronic
976341416 4:83949794-83949816 CTTCAGCCACTAATGGAAAATGG + Intergenic
978531958 4:109724035-109724057 TCTTTGCTTCTCATGGAACAGGG - Intronic
980220867 4:129912302-129912324 TCTTAGTGACTCATGGTTAAAGG - Intergenic
982072294 4:151706057-151706079 TCTTAGCAACTCAGATAAAAGGG - Intronic
982179329 4:152734993-152735015 TCTTACCACCTCAGGGAAAATGG + Intronic
982449383 4:155533927-155533949 TCATGCCCACTTATGGAAAAGGG + Intergenic
984376472 4:178937292-178937314 TATGAGTCACTCTTGGAAAAAGG - Intergenic
984741006 4:183162996-183163018 TGCTAGGCACTCATGTAAAAGGG - Intronic
987616953 5:20287401-20287423 TCTTAGGAACCTATGGAAAAAGG - Intronic
987770401 5:22294964-22294986 TCTTACCCACTCACAGAAACTGG - Intronic
988201127 5:28070057-28070079 TCTAAGCCACTCCTTTAAAATGG + Intergenic
989410789 5:41118180-41118202 GCTTAACCACTTATTGAAAATGG - Intergenic
990869864 5:60419790-60419812 TGTTAGCCACTGTTTGAAAACGG - Intronic
993612161 5:90068309-90068331 TCTTAGCCTTTGATGGAAATGGG - Intergenic
994050654 5:95358846-95358868 TCTTAGGCACTCCAGGAAAAGGG + Intergenic
995714025 5:115064087-115064109 TATTTGCCACTCAGAGAAAAAGG - Intergenic
996208459 5:120774219-120774241 TCTTAGCTACCTATGGAGAAGGG + Intergenic
996550568 5:124725922-124725944 TCTTTGCCCCTTATAGAAAAGGG + Intronic
996794127 5:127325623-127325645 TCACAGCCCCACATGGAAAATGG - Intronic
998731307 5:145080646-145080668 TTTCAGCTACTAATGGAAAATGG + Intergenic
999456100 5:151717528-151717550 TCTTAGCCCCACTTAGAAAAAGG + Intergenic
1004567350 6:16810679-16810701 TCTTAGCAACTCCTTGAACAGGG + Intergenic
1005675324 6:28148628-28148650 CCTCAGCCACTGATGGCAAAGGG - Exonic
1011366840 6:86591722-86591744 CCTTAGCAACTCAGGTAAAAAGG + Intergenic
1011435409 6:87330841-87330863 TCTTAATCATGCATGGAAAAGGG + Intronic
1012023801 6:93962403-93962425 TCTTAGCCAATTATGGAAAATGG + Intergenic
1012555721 6:100509348-100509370 TCTTAGCCACTCCTTTCAAATGG + Exonic
1015000314 6:128205997-128206019 TCTTGGACCCTCATGGAAAGAGG + Intronic
1021565739 7:22014629-22014651 TCTTGGACACTCATGGAAAGTGG + Intergenic
1022042695 7:26595405-26595427 TTTTAGCTTCTCATGGAAGAGGG - Intergenic
1023904500 7:44512790-44512812 GATTAGCCCCTCCTGGAAAATGG - Exonic
1024632680 7:51262496-51262518 TCTGAGACCCTCAGGGAAAATGG + Intronic
1028219635 7:88182030-88182052 TCTGAACCTCTAATGGAAAAAGG + Intronic
1030759113 7:113328932-113328954 AGTTAGCCAGTCAAGGAAAAGGG - Intergenic
1042677412 8:71337189-71337211 TCTAAGCCACCCATCTAAAAAGG + Intronic
1043239351 8:77913164-77913186 TGTTAACCATCCATGGAAAAAGG + Intergenic
1044718302 8:95121571-95121593 TTTTTGCCACTCATGTGAAAAGG - Intergenic
1045680664 8:104656416-104656438 TATTAGCCATTCCAGGAAAAAGG - Intronic
1045818027 8:106300339-106300361 TCTTAGGTAGTCATAGAAAATGG - Intronic
1046853631 8:119004367-119004389 TCTTAGCCACTTAGGAAAAAAGG - Intronic
1048669698 8:136704255-136704277 TCTTAGCCAGTCCTTGGAAAAGG + Intergenic
1052295578 9:26893379-26893401 CTTTAGCCACTGAGGGAAAAAGG + Intergenic
1053701296 9:40693299-40693321 TCTTAGATATTCATGAAAAATGG + Intergenic
1054411360 9:64816755-64816777 TCTTAGATATTCATGAAAAATGG + Intergenic
1203451199 Un_GL000219v1:118642-118664 TCTTAGTCTCTCATGGATACTGG + Intergenic
1186254600 X:7704505-7704527 TCTTGGCCACTTCTGAAAAATGG + Intergenic
1188197874 X:27261002-27261024 TCTTAGCCCCTCAAGGACATAGG - Intergenic
1193040734 X:77001100-77001122 TCATTGCCACTCAGGGAAAGTGG - Intergenic
1196123410 X:112074628-112074650 TTTAAGCCATTCATGGAAACAGG - Intronic
1196258148 X:113547072-113547094 ACTTAGCCACTCAAGAACAATGG + Intergenic
1198796470 X:140401780-140401802 TCTAAGCCCCTCATGGATACTGG - Intergenic
1199312484 X:146337547-146337569 TCTTAGGAATCCATGGAAAAGGG - Intergenic
1200690213 Y:6300849-6300871 TCCTAGCCACTCATTTAAAATGG - Intergenic
1200714523 Y:6522232-6522254 TCCTAGCCACTCCTTTAAAATGG + Intergenic
1201019301 Y:9638925-9638947 TCCTAGCCACTCGTTTAAAATGG - Intergenic
1201045060 Y:9873867-9873889 TCCTAGCCACTCATTTAAAATGG + Intergenic