ID: 1085126891

View in Genome Browser
Species Human (GRCh38)
Location 11:74008026-74008048
Sequence TGCACCAGATACCGTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085126889_1085126891 2 Left 1085126889 11:74008001-74008023 CCATTAATGTTTGCTGGTTGCTT 0: 1
1: 0
2: 0
3: 26
4: 228
Right 1085126891 11:74008026-74008048 TGCACCAGATACCGTGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085126891 Original CRISPR TGCACCAGATACCGTGCTGA GGG Intronic