ID: 1085126891 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:74008026-74008048 |
| Sequence | TGCACCAGATACCGTGCTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 92 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 84} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1085126889_1085126891 | 2 | Left | 1085126889 | 11:74008001-74008023 | CCATTAATGTTTGCTGGTTGCTT | 0: 1 1: 0 2: 0 3: 26 4: 228 |
||
| Right | 1085126891 | 11:74008026-74008048 | TGCACCAGATACCGTGCTGAGGG | 0: 1 1: 0 2: 0 3: 7 4: 84 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1085126891 | Original CRISPR | TGCACCAGATACCGTGCTGA GGG | Intronic | ||