ID: 1085127438

View in Genome Browser
Species Human (GRCh38)
Location 11:74011297-74011319
Sequence GGGCCCAGGGGACCTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085127438_1085127451 -2 Left 1085127438 11:74011297-74011319 CCCTCTTTAGGTCCCCTGGGCCC No data
Right 1085127451 11:74011318-74011340 CCCAAGGGAAGTGGGGCCCTGGG No data
1085127438_1085127449 -3 Left 1085127438 11:74011297-74011319 CCCTCTTTAGGTCCCCTGGGCCC No data
Right 1085127449 11:74011317-74011339 CCCCAAGGGAAGTGGGGCCCTGG No data
1085127438_1085127447 -9 Left 1085127438 11:74011297-74011319 CCCTCTTTAGGTCCCCTGGGCCC No data
Right 1085127447 11:74011311-74011333 CCTGGGCCCCAAGGGAAGTGGGG No data
1085127438_1085127455 18 Left 1085127438 11:74011297-74011319 CCCTCTTTAGGTCCCCTGGGCCC No data
Right 1085127455 11:74011338-74011360 GGGCCTTGAATGCTCTGTGCTGG No data
1085127438_1085127445 -10 Left 1085127438 11:74011297-74011319 CCCTCTTTAGGTCCCCTGGGCCC No data
Right 1085127445 11:74011310-74011332 CCCTGGGCCCCAAGGGAAGTGGG No data
1085127438_1085127457 30 Left 1085127438 11:74011297-74011319 CCCTCTTTAGGTCCCCTGGGCCC No data
Right 1085127457 11:74011350-74011372 CTCTGTGCTGGTGACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085127438 Original CRISPR GGGCCCAGGGGACCTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr