ID: 1085127515

View in Genome Browser
Species Human (GRCh38)
Location 11:74011672-74011694
Sequence CCTCACAACCCCATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085127512_1085127515 24 Left 1085127512 11:74011625-74011647 CCAAAAGTAGGCGAAGCACTTTC No data
Right 1085127515 11:74011672-74011694 CCTCACAACCCCATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085127515 Original CRISPR CCTCACAACCCCATGAAGCT GGG Intergenic
No off target data available for this crispr