ID: 1085137368

View in Genome Browser
Species Human (GRCh38)
Location 11:74104500-74104522
Sequence ATGTGTATGTACATGTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 660}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085137368 Original CRISPR ATGTGTATGTACATGTATGG GGG Intronic
900098471 1:950754-950776 ATGTGTATGCATTTGTATGGGGG - Intronic
900859214 1:5214465-5214487 ATGTGTATATATATATATGATGG - Intergenic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
901474163 1:9477732-9477754 ATGTGTGTGTATATGTGTGTGGG - Intergenic
901723817 1:11223450-11223472 AAATGTATGTACATGTGTCGGGG + Intronic
903185042 1:21624128-21624150 CTGTGTATGTACGTGTGTGCAGG + Intronic
903578447 1:24353560-24353582 GTGTGTATGTGAATGAATGGTGG + Intronic
903771853 1:25769316-25769338 TGGTGTATGTAGGTGTATGGGGG - Intronic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905318801 1:37101082-37101104 ATATGCATGTATGTGTATGGGGG - Intergenic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
906075770 1:43050924-43050946 ACATGTATGTACATATATGTAGG - Intergenic
906824169 1:48961125-48961147 GTGTGTATGTACAGCTGTGGAGG + Intronic
907172554 1:52482795-52482817 ATGTGAATGTTCTTGAATGGGGG - Intronic
907853702 1:58280968-58280990 ATGTCTTTGTACATGGATGGAGG + Intronic
908048507 1:60200357-60200379 ATGTGTTTCTAAATGTATGTAGG - Intergenic
908961944 1:69708685-69708707 ATGGGCATGTTCATGTCTGGAGG + Intronic
910269428 1:85377719-85377741 GTGTGTGTCTACTTGTATGGGGG - Intronic
910502305 1:87906726-87906748 ATATGTGTGTACATATATGTAGG - Intergenic
910947213 1:92607121-92607143 ATGTGTATGTACCAGTGTGTTGG - Intronic
911230970 1:95361277-95361299 ATGTGTGTATACATGTGTGAGGG + Intergenic
911252907 1:95598759-95598781 ATGTATATATACATTTTTGGGGG + Intergenic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911742181 1:101398802-101398824 ATGTGTGTGTAAATATATTGAGG - Intergenic
911923197 1:103793493-103793515 ATGTGTATGTGTATATATTGAGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913443848 1:118928570-118928592 CTGTATATGTAAATGTTTGGAGG + Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
915135640 1:153729154-153729176 ATGTCTGTGTAGATGTTTGGGGG + Intronic
915431144 1:155868081-155868103 ATGTGAATAAACTTGTATGGTGG - Exonic
915817521 1:158985041-158985063 CTGTGTCTTTACATGTAAGGTGG + Intergenic
916483157 1:165233562-165233584 ATGTGACTGTAGATGTTTGGTGG - Intronic
916510254 1:165466919-165466941 ATGTGTGTGTATGTATATGGGGG - Intergenic
917309087 1:173658959-173658981 ATGTGTATATACATCTATATGGG - Intronic
917486638 1:175460898-175460920 ATGAGCATGTACATGTGTGTGGG - Intronic
918276886 1:182961399-182961421 ATGTGAATGTACAAGTTTTGGGG - Intergenic
918737367 1:188082436-188082458 ATCAGTATTTACATGTGTGGTGG - Intergenic
918832627 1:189417364-189417386 ATGTGCATGTACATATATGTAGG + Intergenic
919161997 1:193841919-193841941 GTGTGTGTGCACATGCATGGGGG + Intergenic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
921786113 1:219231534-219231556 GTGTGTATTTCCATGTATTGAGG + Intergenic
921858181 1:220011703-220011725 ATGTGTATGACCATTTATTGAGG - Intronic
921960522 1:221029060-221029082 GTGTGCATGTACATGTTCGGGGG - Intergenic
922779283 1:228238927-228238949 ATGTGTATATAGGTGTATGTGGG - Intronic
923808276 1:237284561-237284583 GTGTGTGTGTATATATATGGTGG - Intronic
924187762 1:241513974-241513996 ATATGTGTGTATATGTATGTGGG - Intronic
924637060 1:245798423-245798445 ATGTGTGTGTATGTGTGTGGGGG - Intronic
1062993398 10:1842082-1842104 GTCTGTATGTGCATGTGTGGGGG - Intergenic
1062993417 10:1842324-1842346 ACATGTATGTGCATGTATGTGGG - Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1063869494 10:10402371-10402393 ATGTTTGTTTACATGTAAGGTGG - Intergenic
1065397602 10:25256530-25256552 ATGTGTATGCACATGTCCTGTGG + Intronic
1065411339 10:25432471-25432493 AAGTATATGTACATATATGCAGG - Intronic
1065458173 10:25929480-25929502 ATGTATATGTAAATGTTTTGAGG + Intergenic
1067356764 10:45535860-45535882 ATGTGAATGTTCATGTTAGGTGG - Intronic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1069036331 10:63649448-63649470 ATGTGAAGGTACACCTATGGGGG - Intergenic
1069469382 10:68673765-68673787 ATGTCTATGTATGTGTATAGTGG - Intronic
1069718061 10:70533389-70533411 GTGTGTGTGTACCTGTATGTAGG + Intronic
1070104752 10:73420962-73420984 ATGTGTATGTGTATGTATTGGGG - Intergenic
1070361330 10:75692384-75692406 ATGTGTGTGTATATATATGTAGG - Intronic
1070495675 10:77019533-77019555 ATGTTTATGTATATCTATAGGGG - Intronic
1070620630 10:78007586-78007608 TTCTGTATGTATATGTGTGGTGG + Intronic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1070999576 10:80817265-80817287 ATGTGTGTGTCCAGGTGTGGTGG + Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073247919 10:102104722-102104744 ATGTATATGTTTGTGTATGGAGG - Intergenic
1073420170 10:103418266-103418288 ATGTGCACGTACATGCATGCTGG + Intronic
1073665062 10:105522201-105522223 AAGTGTATGTAAATGAATGCTGG + Intergenic
1073695034 10:105856626-105856648 ATGTGTATATATATATATAGTGG + Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074390250 10:113051181-113051203 GTGTGTATGCACATGTATGAAGG - Intronic
1074463453 10:113660188-113660210 ATGTATATGTACATGCATGTGGG - Intronic
1074509087 10:114096900-114096922 ATGTGTGTGTGCATGTGTTGGGG + Intergenic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074968518 10:118515836-118515858 ATGTGTGTGTACATCTGTGAAGG + Intergenic
1075450775 10:122550681-122550703 GTGTGTGTGTACATGTACAGGGG - Intergenic
1075880526 10:125846950-125846972 ATGTGTATATACATTAATGCAGG - Intronic
1075880662 10:125848015-125848037 ATGTGTATATACATTAATGCAGG - Intronic
1077041955 11:528756-528778 ATGTGTGTGCACGTGTATGTGGG - Intergenic
1078001510 11:7500424-7500446 ACGTGTATGTATGTGTGTGGCGG - Intronic
1078078957 11:8189896-8189918 ATATATATGTATATATATGGAGG - Intergenic
1078084684 11:8226589-8226611 ATGTGTTTTTAAATGTCTGGGGG - Intronic
1078355069 11:10626950-10626972 ATGTGTATGTCTGTGTGTGGAGG + Intronic
1078680815 11:13474021-13474043 TTTTGTATGTACATGAATGAAGG + Intergenic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079567956 11:21906041-21906063 ATGTGTATGTGTATTTATGTGGG - Intergenic
1080169662 11:29284656-29284678 ATATGTATGTAAATATATGTAGG + Intergenic
1080424257 11:32141889-32141911 TTATGTATGTACATATATGCTGG + Intergenic
1080672052 11:34389366-34389388 TGGTGTATGTACATATATGATGG - Intergenic
1080897229 11:36456797-36456819 ATGTGAACATACATGCATGGAGG + Intronic
1081410150 11:42748173-42748195 AAGTGTATGTACATGTGAAGAGG + Intergenic
1082709128 11:56531675-56531697 ATGTGTATATATATGTTGGGGGG + Intergenic
1083960972 11:66014875-66014897 GTGCGTGTGTATATGTATGGGGG - Intergenic
1084782807 11:71422108-71422130 ATGTGTATATATATATATGCAGG + Intergenic
1084896098 11:72270457-72270479 ATGTGTCTAGACATGTGTGGTGG + Intergenic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085365551 11:75939534-75939556 CTATGTATGTATATGTATGGGGG - Intronic
1085379773 11:76104677-76104699 GTGTGCATGTATATGTGTGGTGG - Intronic
1086056216 11:82650211-82650233 ATGTGTATATACATATATATAGG - Intergenic
1086158987 11:83699926-83699948 GTGTGTGTGTGCATGTGTGGTGG - Intronic
1086914062 11:92507457-92507479 ATATGTATATATATGTGTGGGGG + Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087838697 11:102900456-102900478 ATGTATATGTTCCTGTATGCAGG - Intergenic
1087952532 11:104240571-104240593 ATGTATATATGTATGTATGGAGG + Intergenic
1087994186 11:104782972-104782994 GTGTGTATGTGTGTGTATGGGGG + Intergenic
1088762556 11:112946180-112946202 ATTGGTATGTACATTTTTGGGGG - Intergenic
1088983607 11:114886730-114886752 ATGTGTATATGCATGAATGGAGG - Intergenic
1089235822 11:117024194-117024216 ATTTTTATTAACATGTATGGAGG - Intronic
1089681284 11:120120332-120120354 GTGTGTGTGTACATGTGTGGGGG - Intronic
1089750048 11:120645143-120645165 GTGTGTATGTGTATGTATGGTGG + Intronic
1089907407 11:122054941-122054963 TTGTGGATTTTCATGTATGGTGG - Intergenic
1090401333 11:126450139-126450161 ATGTGTATACACATGTATGTGGG + Intronic
1091061716 11:132469668-132469690 ATGTGTGTGTATATGTGTGGGGG + Intronic
1091120196 11:133051042-133051064 GTGTGTATGTACACACATGGAGG - Intronic
1091710853 12:2739125-2739147 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1092039250 12:5369063-5369085 ATGTGTTTGTACTTTCATGGAGG - Intergenic
1092229261 12:6767578-6767600 TTGTGTGTGTATGTGTATGGCGG + Intronic
1092926354 12:13275842-13275864 ATGTGCATGCACACATATGGTGG - Intergenic
1092949769 12:13490639-13490661 ATGTGGATGGATGTGTATGGGGG + Intergenic
1093052193 12:14516572-14516594 AGGTATGTATACATGTATGGGGG + Intronic
1093108311 12:15116813-15116835 ATGTGTATGTGTTTGTTTGGTGG + Intronic
1093258558 12:16903920-16903942 ATGTGTTTGTGCATGTCAGGGGG + Intergenic
1093303842 12:17487605-17487627 TTGTGTGTGTATATGAATGGGGG + Intergenic
1093837200 12:23847904-23847926 ATGTGTTTGTATATTTATGTAGG - Intronic
1093897391 12:24589761-24589783 ATGTGTATGTGTATATATGCAGG - Intergenic
1094260467 12:28491933-28491955 ATGTGTGTGTGCGTGTATGAAGG + Intronic
1094339668 12:29396853-29396875 ATGTGAATGAAAATGTACGGAGG - Intergenic
1095211815 12:39503071-39503093 ATGTGTGTGTATGTGTGTGGTGG - Intergenic
1097342611 12:58456137-58456159 AAGTGTATGTGCATGTAGTGAGG - Intergenic
1097466040 12:59925928-59925950 ATGTGTGTGTATATATATGATGG + Intergenic
1097547268 12:61019606-61019628 ATATATATATATATGTATGGTGG - Intergenic
1098176848 12:67801327-67801349 ATGTTTCAGTACATGTATGCAGG + Intergenic
1098627907 12:72695871-72695893 GTGTGTATATATATATATGGGGG - Intergenic
1098768566 12:74522061-74522083 ATGTGTGTGTGCGTGTGTGGGGG + Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1099570812 12:84315731-84315753 AACTATATGTACATGTATGTAGG - Intergenic
1099947761 12:89264356-89264378 ATGTGTTTGTACAATTATGAAGG - Intergenic
1099963688 12:89421915-89421937 ATGTGTTTGTATATGTATTCTGG - Intronic
1100093931 12:91008122-91008144 ATGATGATGGACATGTATGGAGG - Intergenic
1100373587 12:93991908-93991930 ATATGTGTGTGCATGTGTGGAGG + Intergenic
1100394766 12:94175131-94175153 ACGTGTGTGTATATGTATGCAGG + Intronic
1101174614 12:102136679-102136701 ATGTGTGTGCACATGTGTAGTGG + Intronic
1101915853 12:108895301-108895323 ATGTGTGTGTGCATGTGTGAGGG + Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103050156 12:117772151-117772173 ATGTGTATGTGCGTCTTTGGGGG - Intronic
1103805219 12:123567308-123567330 ATGTGTATGGCCAGGCATGGTGG - Intergenic
1104055244 12:125225083-125225105 ATGTGTGTGCACATGTGTGCAGG - Intronic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1104593909 12:130106530-130106552 ATGTGTATGTCCTTGTGTGTAGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105788838 13:23776913-23776935 GTGTATATGTACATATATGTGGG - Intronic
1106828347 13:33549756-33549778 ATTTTTTTGTATATGTATGGAGG + Intergenic
1106994594 13:35466996-35467018 TTGTGTATGTGCATGGAGGGGGG - Intronic
1108260292 13:48649036-48649058 GTGTGTATGTATGTGTATGTGGG + Intergenic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1110386080 13:74912321-74912343 ATTTGTGTGTGCATGTATTGGGG - Intergenic
1110621798 13:77604966-77604988 GTGTGTATGTGCATGTAGTGTGG + Intronic
1110885381 13:80627369-80627391 GTGTGTGTATACATGTGTGGTGG + Intergenic
1110927705 13:81176465-81176487 ATTTATATGTACATATATGTGGG + Intergenic
1111057709 13:82972379-82972401 ATGTGGATGGACATCTCTGGTGG - Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1111269324 13:85860339-85860361 ATGTGTGTGTATATGTATAGGGG + Intergenic
1111393359 13:87628866-87628888 ATGTTTCTGTTCATGTATGCGGG + Intergenic
1111509748 13:89245317-89245339 ATGTATCTGTACTTGTATGCTGG - Intergenic
1111547663 13:89763971-89763993 ATGGGTGTGTATATGTATGATGG - Intergenic
1112182910 13:97102968-97102990 ATGTGTATGTATGTGTGTGATGG - Intergenic
1112680484 13:101759296-101759318 ATATATATGTACATGTATTAGGG + Intronic
1112872236 13:103987824-103987846 ATGTGAGTGTACATGTTTAGGGG + Intergenic
1112968679 13:105231999-105232021 ATGTGCGTGTGCATGTTTGGGGG - Intergenic
1113327341 13:109294737-109294759 GTATGTATGTAAATGTATGTAGG - Intergenic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1113355915 13:109580004-109580026 ATGTGTGTGTACACGTTTGTGGG + Intergenic
1113870585 13:113557375-113557397 AGGTGTGTGTGCATGTATGTAGG + Intergenic
1114961262 14:27892777-27892799 GTGTTTATGTATATGTGTGGTGG - Intergenic
1115138661 14:30142482-30142504 ATGTGTTTGTTCATTTTTGGGGG - Intronic
1115208091 14:30935063-30935085 ATGTGTGTATAAATATATGGTGG - Intronic
1115524132 14:34262515-34262537 ATTTGTATGTATATGAATGTGGG - Intronic
1115844341 14:37509847-37509869 ATGTATATGTACATATATGTAGG + Intronic
1115890996 14:38028821-38028843 ATGTGCATGTATCTTTATGGTGG - Intronic
1116084200 14:40214808-40214830 TTGTTTATGTACATGTAAGCAGG - Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1117798751 14:59422086-59422108 ATGTGTGTGAAGATGTCTGGTGG + Intergenic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118233290 14:63974717-63974739 ATATGTATATATATGTATGCTGG - Intronic
1118438399 14:65791550-65791572 ATGTGTATGTACGTGTGTGGTGG + Intergenic
1118499086 14:66340662-66340684 ATGTGTGTGTATATATATGTGGG + Intergenic
1118734568 14:68692095-68692117 ATGTGTGTGTGCATGTTTTGTGG - Intronic
1119106508 14:71930417-71930439 ATATGTATGTGTATGTATGTGGG - Intergenic
1119671344 14:76521096-76521118 ATGAGTATGTTGATTTATGGTGG + Intergenic
1119827011 14:77665361-77665383 ATATGTTTGTAAATGCATGGGGG - Intergenic
1120302426 14:82725057-82725079 ATGTGTGTGTGTATGTGTGGGGG + Intergenic
1120526442 14:85582256-85582278 ATGTGTTTGTATATGCATGCAGG + Intronic
1121099273 14:91238851-91238873 GGGTGTATATACATGTAGGGTGG + Intronic
1123055274 14:105566495-105566517 ATGTGTTTGTGCCTGTGTGGTGG + Intergenic
1123079723 14:105686339-105686361 ATGTGTTTGTGCCTGTGTGGTGG + Intergenic
1123839653 15:24235358-24235380 ATATGTATATATATATATGGTGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125127238 15:36238533-36238555 ATGTGTGTGTGCGTGTAGGGGGG - Intergenic
1125653528 15:41337338-41337360 ATGTGGATGTAGATGCAGGGTGG - Intronic
1125806901 15:42501238-42501260 ATGTGTGTGTGTATGTATGGAGG - Intronic
1126066821 15:44832092-44832114 GTGTGTGTGTAGCTGTATGGTGG - Intergenic
1126783833 15:52160699-52160721 ATGTGTGTGCACATATGTGGAGG - Intronic
1127692646 15:61412969-61412991 ATGTGTATGTGTATCTGTGGAGG - Intergenic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1127778956 15:62294758-62294780 AGGTACATGTACATTTATGGAGG - Intergenic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130317256 15:82807404-82807426 ATATGTATATATATGTATGATGG - Intergenic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1131209724 15:90484174-90484196 ATGTGTATGTCCCTTTTTGGGGG + Intronic
1131642297 15:94305458-94305480 ATGTGTGTGTATGTGTGTGGAGG - Intronic
1133343905 16:5057288-5057310 ATGTGTATATATATATATAGTGG + Intronic
1133352599 16:5111866-5111888 ATATATATGTACATGTATATAGG - Intergenic
1134815870 16:17205522-17205544 ATGTGAATGTCCATGTGGGGTGG - Intronic
1135108046 16:19668051-19668073 ATGTGTCTGAAGATGGATGGTGG - Intronic
1135246124 16:20858569-20858591 ATGTATATATACATATTTGGGGG + Exonic
1135397155 16:22139940-22139962 ATGGGTGTGTACATGTGTGTAGG - Intronic
1135845394 16:25913902-25913924 ATGTGTGTGCATATGTATGTAGG + Intronic
1135845415 16:25914091-25914113 ATGTGTGTGTATGTGTATGTAGG + Intronic
1135897971 16:26427187-26427209 ATGTGTATGTGCATATATATGGG + Intergenic
1137570308 16:49561359-49561381 GTGTGTATATAGATGTATAGAGG + Intronic
1139056884 16:63196478-63196500 ATATGTATGTGCATATATGAGGG - Intergenic
1139291820 16:65865765-65865787 ATGTGTATGTACACTTATATAGG - Intergenic
1139518394 16:67465315-67465337 ATGTATAGGTACATATATGCAGG - Intronic
1140147930 16:72330213-72330235 ATGCATATGTACGTTTATGGAGG + Intergenic
1140268891 16:73445306-73445328 GTGTGTGTGTATATGTATGGGGG + Intergenic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1140921995 16:79547369-79547391 ATGTGTGTGTACAGGTTCGGGGG - Intergenic
1141110201 16:81265693-81265715 ATGGGTAGGTAGATGGATGGTGG - Intronic
1141357616 16:83363380-83363402 ATGTGTGTATACATGCATTGTGG + Intronic
1141426963 16:83950286-83950308 ATGTGTGTGTACGTGTGTGCTGG - Intronic
1141783394 16:86180678-86180700 ATGTGTATATACATGCATGTGGG - Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1143800470 17:9375735-9375757 ATATGTATGTATGTGTATGTGGG - Intronic
1144175471 17:12700900-12700922 ATGTGTGTGTATGTGTGTGGGGG + Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146051265 17:29555466-29555488 GTGTGTGTGTACATATATGGGGG + Intergenic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1146227947 17:31083496-31083518 GTGTGTATGCACATGAATGCAGG - Intergenic
1146446985 17:32939966-32939988 CTGTGTATGCGCATGTCTGGTGG - Intronic
1147116786 17:38306443-38306465 AAGTGGATGGACATGAATGGAGG + Intronic
1147544298 17:41388424-41388446 TTGTGTGTGAACATGTTTGGGGG + Intronic
1147608802 17:41789256-41789278 ATGTGTGTGTGCATGTGTGGAGG - Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1147837647 17:43346311-43346333 ATGTATATATACATATTTGGGGG - Intergenic
1148412891 17:47483158-47483180 AAGTGGATGGACATGAATGGAGG - Intergenic
1149380559 17:56089077-56089099 ATTTGTATGAACATATGTGGAGG + Intergenic
1151339611 17:73462165-73462187 ATATATGTGTACATGTATAGTGG + Intronic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152067618 17:78120445-78120467 ATGTGTATGGCCAGGCATGGTGG - Intronic
1152128338 17:78460862-78460884 ATGAGTATGTACATGAATGAAGG - Intronic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1153289098 18:3482786-3482808 ATATGTATAGATATGTATGGTGG - Intergenic
1153405700 18:4735964-4735986 AGGTGTGTGTACATGTAGTGTGG - Intergenic
1153769054 18:8400876-8400898 ATGTGTGTGTGCATGTGTTGGGG + Intronic
1154029330 18:10737988-10738010 CTGTGTATCTTCATGAATGGAGG - Intronic
1154300883 18:13191535-13191557 ATTTGTATGAACGTGTGTGGAGG + Intergenic
1154392584 18:13953100-13953122 ATGTGTTTGTACAGGTATGAGGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155369763 18:25085677-25085699 GTGTGTGTATACATATATGGTGG + Intronic
1155609501 18:27649140-27649162 GTGGGTATGTACTTGTATGTGGG + Intergenic
1155740232 18:29280320-29280342 ATGTGTGTATACATGTGTGGGGG - Intergenic
1155758845 18:29538495-29538517 ATATGTCTATACATGTATGTAGG - Intergenic
1155767933 18:29659150-29659172 GTGTGTATGTGTATGTATGGGGG + Intergenic
1155805374 18:30164342-30164364 ATATGTATGTGTATGCATGGGGG + Intergenic
1156518282 18:37699370-37699392 GTGTGTATGTGTATGTGTGGTGG + Intergenic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1157300500 18:46475620-46475642 ATGTGTGTGTACATGAGTGTGGG - Intergenic
1158061064 18:53342957-53342979 ATGTATATATAGATGTATTGTGG + Intronic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1158317701 18:56229748-56229770 ATGGGTATGTGTATATATGGGGG + Intergenic
1158397876 18:57094000-57094022 TTGTGTATATGCATGTGTGGGGG - Intergenic
1159252398 18:65896638-65896660 ATGTGTCTGTGCATGTAAGCAGG - Intergenic
1159324864 18:66901771-66901793 ATGAGTATGTGTGTGTATGGGGG + Intergenic
1159484472 18:69036997-69037019 ATGTGTATATATATGTGTGGGGG + Intronic
1160288847 18:77572023-77572045 ATGTGCATGTAGAAGGATGGAGG + Intergenic
1160365464 18:78321577-78321599 ATGTGTGTGCACGTGTATGAAGG - Intergenic
1160523344 18:79521463-79521485 ATGTGTATGTGTGTGTGTGGGGG + Intronic
1160523443 18:79521995-79522017 GTGTGTCTGTGCATGTGTGGGGG + Intronic
1161853576 19:6751402-6751424 ATGAGTATGTACATCAATGGTGG - Exonic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1162778409 19:12994054-12994076 GTGTGTGTGTACATGTACGGAGG + Intergenic
1162791776 19:13066759-13066781 GTGTGTGTGCACATGCATGGTGG + Intronic
1162979856 19:14231602-14231624 ATATGAATGTACATTTTTGGAGG - Intergenic
1163124272 19:15236350-15236372 ATGTGTGTGTATGTGCATGGGGG + Exonic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165809486 19:38602373-38602395 ATGTGTATATATATATATGCTGG - Intronic
1167072633 19:47229803-47229825 GTGTGTATGTATGTGTGTGGTGG - Intronic
1167675920 19:50885468-50885490 GTGTGCATGTACATGGGTGGTGG + Intergenic
1168159102 19:54496932-54496954 ATGTGTGTGTATATATATGTAGG - Intergenic
925354104 2:3225050-3225072 ATATCTATTTACATGTGTGGGGG + Intronic
925421345 2:3715059-3715081 AGGAGTATATACATGTATGTAGG - Intronic
926278037 2:11420702-11420724 GTATGTATATACATGTATGCTGG - Intergenic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926705260 2:15833100-15833122 ATGTGTGTGTTTATGTATGTGGG + Intergenic
926888336 2:17617860-17617882 ATGTGCATGTGCATGTATGCAGG - Intronic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928236468 2:29546100-29546122 ATATGTATGTCTATGTGTGGAGG + Intronic
928910267 2:36413821-36413843 AAGTGTATGTATTTGGATGGGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929291876 2:40201988-40202010 ATGTGTATATGCATGCATGCTGG + Intronic
929672570 2:43888902-43888924 ATGTGTGTGTGCACATATGGAGG + Intronic
929888878 2:45903276-45903298 ATGTGCCTGTTAATGTATGGAGG - Intronic
930253610 2:49064082-49064104 GTGTGTTTGCACATGCATGGTGG + Intronic
930334028 2:50023098-50023120 ATGTATATGTACATATATCAAGG - Intronic
930753607 2:54954697-54954719 AGGTGTGTGTGCATGTATTGGGG - Intronic
931105916 2:59055549-59055571 ATGAGAATGTTCCTGTATGGTGG - Intergenic
931110040 2:59100649-59100671 ATATGTATATATATGTATGAAGG + Intergenic
931789594 2:65652688-65652710 ATGTGTATGTATACGTAGTGGGG - Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932984685 2:76711008-76711030 GTATGTATGTATATGTATGCAGG - Intergenic
933556154 2:83833405-83833427 ATGTGTACGTATATGTATATAGG - Intergenic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
934578790 2:95421416-95421438 ATATGTATGTGCATGCATGTGGG - Intergenic
934600657 2:95655287-95655309 ATATGTATGTGCATGCATGTGGG + Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935973234 2:108551965-108551987 ATATATATGTATATATATGGAGG + Intronic
936074740 2:109394653-109394675 ATGTGTGTGCACATCTATGTAGG + Intronic
936534025 2:113297411-113297433 ATATGTATGTGCATGCATGTGGG + Intergenic
936745016 2:115565141-115565163 ATGTGTGTATATATGTATGTAGG + Intronic
937251955 2:120529642-120529664 ATGTGCATGTACGTGTATGGAGG - Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937725933 2:125166620-125166642 GTGTGTCTGTATATATATGGGGG - Intergenic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
940040538 2:149355571-149355593 ATGTGCATATATATGTATGTAGG - Intronic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
941416237 2:165224760-165224782 ATATGTATGTAAGTGTATGTGGG + Intergenic
941417393 2:165238306-165238328 ATGTGTATATACATATTTTGTGG + Intergenic
941605855 2:167595489-167595511 GTGTGTATGTATATGTTCGGGGG + Intergenic
941668373 2:168263855-168263877 ATGTGTATGTATATATATAAAGG - Intergenic
941878886 2:170461818-170461840 GTGTGTATGTATATGTATGGAGG + Intronic
942095170 2:172530416-172530438 TTGTATATTTACATATATGGAGG - Intergenic
942101474 2:172588583-172588605 AAGGGCATGTAGATGTATGGAGG - Intronic
942557171 2:177183818-177183840 ATGTATCTATATATGTATGGTGG - Intergenic
942561672 2:177226535-177226557 GTGTGTGTGTGCATGTGTGGAGG - Intergenic
942609355 2:177726854-177726876 ATGTGTACGTACATATCTGTGGG - Intronic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
943650725 2:190455007-190455029 ATGTATATGTATATGTGTGTTGG + Intronic
943709393 2:191073714-191073736 ATGTTTATATTTATGTATGGTGG - Intronic
943848987 2:192691570-192691592 ATATATATGAACATGTATGCTGG - Intergenic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
943890829 2:193284819-193284841 ATATATATGTATATGTATGATGG - Intergenic
943945023 2:194048623-194048645 ATGTATATATACATGTATACAGG + Intergenic
943945024 2:194048653-194048675 ATGTATATATACATGTATACAGG + Intergenic
943945026 2:194049946-194049968 ATGTATATATACATGTATATAGG - Intergenic
945377975 2:209101609-209101631 ATGTGTGTGTACATATGTGGGGG + Intergenic
945502070 2:210588723-210588745 ATGTGTGTGTATGTGTATGGAGG - Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
945695839 2:213103258-213103280 ATGTGTGTATACATGTCTGTTGG - Intronic
946430701 2:219625933-219625955 ATATGTATATATATATATGGGGG - Intergenic
947342745 2:229157049-229157071 TTGTGTGTGTATATGTATGCCGG - Intronic
947968334 2:234301070-234301092 ATGTGCATGTACATGTCTATGGG - Intergenic
948271021 2:236673306-236673328 GTGAGTGTGTACATGTGTGGGGG + Intergenic
948788900 2:240366895-240366917 ATGTGCGTGTGCATGTATGCAGG - Intergenic
1169304080 20:4473221-4473243 ATGTGTATAAACATGTCTGGAGG + Intergenic
1169480224 20:5973554-5973576 GTGTTTATGTACTTGTATGAGGG - Intronic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1170443006 20:16397746-16397768 ATGTGTTTCTACAAGTTTGGTGG - Intronic
1171030376 20:21671088-21671110 TTGTGTATGTATATGTGGGGGGG - Intergenic
1171098660 20:22359608-22359630 GTGTGTGTGTGCATGTATGGTGG - Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1172137940 20:32700234-32700256 ATGTATATGTATATGTATTGGGG - Intergenic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172275398 20:33676449-33676471 ATGTGTGTGTGCATGTACCGGGG - Exonic
1173111407 20:40193955-40193977 ATGTGTGTGTCCATGTATACTGG + Intergenic
1173164770 20:40679847-40679869 ATGTTTGTGTGCATGTATGTGGG + Intergenic
1173941715 20:46916489-46916511 ATGTGTGTGTGCATGTGTGATGG + Intronic
1175139458 20:56849247-56849269 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1175942048 20:62541911-62541933 ATGGGTATGTCCATGGAGGGGGG + Intergenic
1177399793 21:20587896-20587918 GTGTGTATATATATATATGGGGG + Intergenic
1178322662 21:31617214-31617236 GTGTGTGTGTACATGTGTGGCGG - Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1180080398 21:45484510-45484532 ATGTGTATGTGCACATATGCTGG - Intronic
1180521537 22:16211992-16212014 ATATGTGTGTACATATATGTAGG - Intergenic
1181824904 22:25507193-25507215 ATGTATATATACATATATGGAGG - Intergenic
1182805498 22:33066497-33066519 AAGTGTATGTGCATGTGTTGGGG + Intergenic
1182829742 22:33295348-33295370 ATGTGTGTGTACATGCGTGTGGG + Intronic
1183906268 22:41042940-41042962 ATGTGTGTGTATATATATGTGGG + Intergenic
1184491727 22:44813772-44813794 ATGTGTGTGTAGGTGTATGTAGG - Intronic
1184707696 22:46225680-46225702 GTGTCCATGTGCATGTATGGGGG - Intronic
1184824769 22:46942136-46942158 GTGTGTATATATATGTATGCTGG - Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
949309716 3:2683315-2683337 GTGTGTGTGTACATGTGTGCAGG - Intronic
949365438 3:3275461-3275483 ATATGTCTGTACATCTTTGGGGG + Intergenic
949807256 3:7969234-7969256 ATGGCTATATACATGGATGGGGG + Intergenic
950343320 3:12268785-12268807 TTGTACATGCACATGTATGGAGG - Intergenic
950399009 3:12756302-12756324 ACATGTATATACAAGTATGGTGG - Intronic
950956551 3:17059533-17059555 ATATGTATATATATGTCTGGAGG - Intronic
951088673 3:18545373-18545395 ATGTGTATGTGTATGCATCGAGG - Intergenic
952089056 3:29862609-29862631 GTGTGTGTGTGCATGTGTGGTGG + Intronic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
953784447 3:45900277-45900299 ATGTGTATGTGGGTGTATGCTGG + Intronic
954381687 3:50222209-50222231 GTGTGTATGTGTATGCATGGGGG - Intergenic
954426962 3:50448409-50448431 GTGTATCTGTACATGTATGTAGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954983083 3:54763877-54763899 ATATGTATATATATGTATGTGGG + Intronic
955402473 3:58602868-58602890 ATGTGTATATACATGTTTGTGGG + Intronic
955562140 3:60203013-60203035 ATGTCTATGTACTTCTATTGGGG - Intronic
956571479 3:70701369-70701391 GTGTGTATGTATGTGTATGGGGG + Intergenic
956585275 3:70857722-70857744 ATGTATATGTATATATATGTGGG - Intergenic
956801331 3:72762072-72762094 GTATGTATGTACATGTTTGTGGG - Intronic
957056600 3:75447974-75447996 ATATATATATATATGTATGGTGG - Intergenic
957175700 3:76805486-76805508 GTGTGTATATATATATATGGGGG - Intronic
957700559 3:83705709-83705731 ATTTATATGTACATGTGTGTAGG - Intergenic
958011016 3:87880682-87880704 ATGAGTATGTCCATATATGGCGG + Intergenic
958067339 3:88560321-88560343 ATGTACATGTACATGTTTGAAGG + Intergenic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958617057 3:96507809-96507831 ATGTGTATGTGTATGTAAAGGGG + Intergenic
958883509 3:99699796-99699818 ATGTGTATGTGTATGTGAGGTGG - Intronic
959805545 3:110548487-110548509 ATGTGAAGGTATATGTGTGGGGG - Intergenic
960086077 3:113592983-113593005 ATGTGTATGTGCTTGTTTGCAGG + Exonic
960453412 3:117839415-117839437 GTGTGTGTGTATATATATGGGGG - Intergenic
961130502 3:124462272-124462294 ATGTGTGTGGACTTTTATGGGGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
961796433 3:129412208-129412230 ATGTGTATATATATTTTTGGGGG - Intronic
962029074 3:131580385-131580407 ATGTATATGTATATGTATAGAGG - Intronic
962510184 3:136091325-136091347 TTGTATATGTCCAGGTATGGTGG + Intronic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963234600 3:142944860-142944882 AGGTGAATGTACATGTATGTGGG + Intergenic
963287734 3:143451746-143451768 AAGCGTATGAACATATATGGAGG + Intronic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
964289654 3:155163184-155163206 ATGTCTATGTGTGTGTATGGAGG - Intronic
965565719 3:170115454-170115476 ATGTGTATACATATGTATTGTGG - Intronic
966035244 3:175404485-175404507 ATATGTATGTTCTTGTTTGGAGG - Intronic
966326085 3:178756208-178756230 ATGTGTGTGTATATATATGTGGG + Intronic
967257632 3:187609615-187609637 AGGTGTATGTTCAGGGATGGAGG + Intergenic
967323090 3:188213158-188213180 ATGTCTGTGGACATGTAGGGAGG + Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
970025770 4:11622516-11622538 ATGTGTATGTGTATGCATGATGG - Intergenic
970544415 4:17112588-17112610 GTGTGTATGTATCAGTATGGTGG + Intergenic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
970863023 4:20725340-20725362 GTGTGTGTGTACACCTATGGGGG - Intronic
970887052 4:20998370-20998392 ATGTGTGTGTACATGTCCAGAGG + Intronic
970899916 4:21146959-21146981 ATGTATATGTATATATATGTGGG + Intronic
971820803 4:31551823-31551845 ATGTGTATGAACAAATATTGGGG + Intergenic
971952634 4:33373913-33373935 CTTTGTAGGGACATGTATGGAGG + Intergenic
972013017 4:34207478-34207500 ACCTGTATGTATGTGTATGGTGG - Intergenic
972038767 4:34562039-34562061 ATATGTATATATATGTATGTGGG - Intergenic
972204108 4:36750082-36750104 ATGTGTATATACATGCATATTGG - Intergenic
972711584 4:41601554-41601576 ATGTGTAAGGACATGTGTGGTGG + Intronic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973299356 4:48562631-48562653 ATGTGTGTGTATGTGTATGAAGG - Intronic
973834579 4:54796500-54796522 AGATGTATGGAAATGTATGGGGG - Intergenic
974881093 4:67757994-67758016 ATGTGTATGAAAATGTATTTGGG + Intergenic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
975925503 4:79446128-79446150 ATGTGTAGGTACATTTATTGCGG + Intergenic
977142477 4:93390855-93390877 ATGTGTGTGTATATATATGCTGG + Intronic
977549833 4:98429288-98429310 ATGTGTATATATATATATGATGG + Intronic
978163488 4:105578216-105578238 ATGTGTTTGTATAGCTATGGGGG + Intronic
978629378 4:110726041-110726063 ATGTGTATATACATTGCTGGTGG - Intergenic
978848434 4:113303791-113303813 ATTTTCATGTACATATATGGTGG - Intronic
978856381 4:113399169-113399191 ATGTGTGTGTGTATGCATGGGGG - Intergenic
979079974 4:116324741-116324763 ATGTTTATGTACATATTTGCTGG + Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979394313 4:120167947-120167969 ATATGTTTGTACATGAATAGTGG + Intergenic
979877908 4:125916700-125916722 ATGTGTATCTTCTTGTATGGAGG + Intergenic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980183510 4:129432502-129432524 ATGTGTATATATGTGTGTGGGGG - Intergenic
980474499 4:133294881-133294903 ATGTATATGTATATGTGTGTGGG + Intergenic
981284946 4:143005724-143005746 ATGTGTATGTGCATGAAAGTAGG - Intergenic
981483808 4:145263881-145263903 ATGTGTAGGTTCATGGAGGGTGG - Intergenic
981582702 4:146266398-146266420 ATGTGCATGGGCATGTGTGGTGG - Intronic
981824115 4:148919970-148919992 ATGTATATGAACATCTATTGTGG + Intergenic
982251893 4:153415502-153415524 AGGTGTGTGTATATGTATGATGG - Intergenic
982831755 4:160070374-160070396 CTGCATATGTATATGTATGGAGG - Intergenic
983157968 4:164375662-164375684 ATGTGTATGTGCATGTAGTAGGG - Intronic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
983350951 4:166587494-166587516 ATATGTATGTACATATATACAGG + Intergenic
984093187 4:175401472-175401494 GTGTTTATATACATATATGGAGG - Intergenic
984128514 4:175843031-175843053 ATATGTATATATATGTATGTAGG + Intronic
984577995 4:181473794-181473816 ATGTGTGTATACATATATGTGGG - Intergenic
985383812 4:189424181-189424203 ATGTGTATATGCATCTATGGGGG - Intergenic
985383859 4:189424735-189424757 ATGTGTGTGTACATGCATACAGG - Intergenic
985627053 5:994573-994595 ACGTGTGTGTGCATGTTTGGAGG + Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
986100805 5:4609295-4609317 ATGTGTACGTAGCTTTATGGTGG - Intergenic
986128279 5:4904040-4904062 ATGTGTATGTGCATGTCTTGGGG - Intergenic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
987781024 5:22435387-22435409 GTGTGTATATATATATATGGGGG - Intronic
987793810 5:22603456-22603478 ACGTGTGTGTACATATATGTAGG - Intronic
987951390 5:24681590-24681612 GTGTGTGTGTATGTGTATGGAGG + Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988207265 5:28155577-28155599 ATGTTTATGTATATGTGTTGTGG + Intergenic
988296302 5:29367294-29367316 ATGTGGATGTGCGTGTGTGGTGG - Intergenic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
989207082 5:38821620-38821642 ATGTGTATATACATGTATATAGG - Intergenic
989298393 5:39859046-39859068 ATGTGTGTGTATATGTATACGGG + Intergenic
989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG + Intergenic
990539076 5:56754214-56754236 ATGAGAATGTACATGGCTGGAGG - Intergenic
990991399 5:61687860-61687882 CTGTGTATGTCCTTGTGTGGTGG - Intronic
991051967 5:62282457-62282479 GTGTGTGTGTATGTGTATGGAGG - Intergenic
991181684 5:63758868-63758890 AGGTGTATGTACAGGGATGGGGG + Intergenic
991393069 5:66170459-66170481 ATGTATATGTAAATGTCTGTAGG + Intronic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991454929 5:66792859-66792881 ATGTGTGTGTTCAAGTATGGGGG + Intronic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
992185249 5:74238149-74238171 ATGTGTGTGTATCTGTATTGGGG - Intergenic
992479974 5:77140887-77140909 ATGTGTATGTATATATACGGTGG - Intergenic
992763571 5:79973691-79973713 ATGTGTTTGGAAATGTGTGGTGG - Intergenic
993284350 5:85971984-85972006 ATTTTTATATACATGTATAGGGG - Intergenic
993621416 5:90172636-90172658 AAGTTGATGTACATGTATGTAGG - Intergenic
993629100 5:90262461-90262483 ATGTATATGTATAGGAATGGAGG + Intergenic
994131056 5:96227887-96227909 ATGTGTAAGGGCAAGTATGGTGG + Intergenic
994146696 5:96403034-96403056 ATGTGCAGGTGCATGTGTGGAGG + Intronic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
994314014 5:98310925-98310947 ATGTATATGTATATATAAGGAGG - Intergenic
994471039 5:100207791-100207813 ATATATATGTACATATATGGAGG - Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
995220587 5:109643161-109643183 ATGAGTAGGTTCATGTTTGGGGG + Intergenic
995339638 5:111043559-111043581 ATGTACATGTACATATATGCTGG + Intergenic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995416162 5:111915671-111915693 ATGTGTAGGTGCATGTGTGAGGG - Intronic
995776716 5:115731139-115731161 ATGTGTGTGTATATATATAGGGG + Intergenic
996040927 5:118810130-118810152 ATCTGTGTGGACAGGTATGGTGG - Intergenic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996475722 5:123918382-123918404 ATATATATGTACATGCATTGTGG + Intergenic
996505157 5:124260306-124260328 ATGTGTAGACACATGTCTGGAGG - Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
999400555 5:151260717-151260739 TTATGTATGTAATTGTATGGGGG - Intronic
999922148 5:156332953-156332975 ATATGTATGTACATCTATTGAGG - Intronic
1000367632 5:160505946-160505968 ATGTGTGTGTGTATGTGTGGGGG - Intergenic
1000584471 5:163079765-163079787 ATGTGTGTGTACATATATGTGGG + Intergenic
1000601977 5:163286025-163286047 ATGTTTAGGGACATGTATTGTGG - Intergenic
1000983934 5:167846680-167846702 ATGTTTATATACATATTTGGGGG - Intronic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002056874 5:176603223-176603245 CTGTGTGTGTACATGTTTTGGGG - Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002390423 5:178907366-178907388 ATGTATATATACATATTTGGGGG + Intronic
1003302864 6:4900427-4900449 GTGTGTATAAACATATATGGGGG - Intronic
1003469720 6:6417935-6417957 ATGTGTGTGCACAGGTATGCAGG - Intergenic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003740289 6:8929453-8929475 TTGTGTATGTGTATGTGTGGAGG - Intergenic
1003754230 6:9098487-9098509 ATTTGGATACACATGTATGGTGG - Intergenic
1003905045 6:10691677-10691699 ATGTGGATATACATTTTTGGAGG - Intronic
1004782733 6:18929515-18929537 ATGTATATGTACGTGTGTGCTGG - Intergenic
1005460748 6:26067415-26067437 ATGTGTATTAACATGTACAGGGG + Intergenic
1005534368 6:26740423-26740445 ATGTATATATACATGTATTATGG - Intergenic
1006256239 6:32834906-32834928 AAGTGTATGTGAAGGTATGGGGG - Intronic
1007168403 6:39845015-39845037 TGGTGTATGTATATGTGTGGGGG - Intronic
1007384262 6:41510049-41510071 ATGTGTGTGTACGTGTGTGTTGG - Intergenic
1009389791 6:63132333-63132355 ATATGTGTGTATATATATGGGGG + Intergenic
1009840443 6:69066153-69066175 ATGTGGATGTATATGTGTGAAGG - Intronic
1010084361 6:71899534-71899556 ATGTGAGATTACATGTATGGAGG - Intronic
1010482993 6:76377355-76377377 ATGTGTCTTTGCATGTATGATGG + Intergenic
1011241606 6:85277409-85277431 GTGTGTATGTATAGGGATGGAGG + Intergenic
1011435492 6:87332316-87332338 ATATATATATACATATATGGGGG - Intronic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1012509695 6:99989002-99989024 ATGACTATGTACATGCATGTGGG - Intronic
1012835550 6:104261108-104261130 ATGTGTATATGGATGTCTGGAGG + Intergenic
1013083009 6:106829334-106829356 ATGTGTGTGTACATGTGAGAGGG + Intergenic
1013398727 6:109770422-109770444 ATGTGTGTATGCATGCATGGAGG + Intronic
1013707401 6:112853924-112853946 TTTTGTTTGTACATATATGGAGG + Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014354027 6:120382037-120382059 ATATGCATGTAAATATATGGTGG + Intergenic
1014681942 6:124441960-124441982 ATGTGTATGTAAATGTACATGGG - Intronic
1014975149 6:127871284-127871306 ATGTGTATGTGTATGTATATAGG - Intronic
1015048012 6:128802076-128802098 ATATGTGTGTATATATATGGGGG + Intergenic
1015067759 6:129051977-129051999 AAGTGTGTGTATATGTATGCAGG + Intronic
1015068038 6:129054590-129054612 AAGTGTGTGTATATGTATGCAGG + Intronic
1015137467 6:129890031-129890053 GTGTGTATATACATATATGATGG + Intergenic
1015455925 6:133426100-133426122 CTGTAAATGTACATGTATGCAGG - Intronic
1016041389 6:139435080-139435102 ATGTGTGTGTACGTGTGGGGGGG + Intergenic
1017107183 6:150898751-150898773 ATGTGTATGTAGATGGGGGGTGG - Intronic
1017447388 6:154519041-154519063 ATATGTGTGTATATATATGGGGG + Intergenic
1017656432 6:156633906-156633928 ATGTGTATCTGCATGTCTGCAGG + Intergenic
1018638525 6:165885825-165885847 ATGTGTATGCATATGTGTGTTGG + Intronic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1018854360 6:167664912-167664934 ATGTGTGTGCACATGCATGTGGG + Intergenic
1019103440 6:169650210-169650232 ATGAGTAGGTGCATGGATGGTGG - Intronic
1019103587 6:169650801-169650823 ATGCGTGTGTGCATGGATGGTGG - Intronic
1019137376 6:169918934-169918956 ATGTGTGTATACATGTGTGCAGG + Intergenic
1019282706 7:208379-208401 ATGGGTATGTACATGACTGTGGG + Intronic
1019902368 7:4030998-4031020 ATGTGAATGTGTATGTATGGGGG - Intronic
1020557301 7:9686455-9686477 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1020810496 7:12845252-12845274 ATGTACATGTACATTTATTGTGG + Intergenic
1021299441 7:18954708-18954730 ATGTGTATGTATGTGTGTGAAGG - Intronic
1021301345 7:18976726-18976748 ATATTTATGTACATTTATGGTGG - Intronic
1021333822 7:19373306-19373328 GTGTGTGTGTATGTGTATGGAGG + Intergenic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1022957252 7:35392468-35392490 TTGTACATGTACATGTATAGTGG + Intergenic
1023091533 7:36622094-36622116 ATGTGAATGTGTATGTATGGGGG + Intronic
1023640182 7:42249736-42249758 GTGTATATGTACTTGTATGAGGG - Intergenic
1024340071 7:48248441-48248463 CAGTGTAAGTACATGTTTGGTGG + Exonic
1024970781 7:55068112-55068134 GTGTGTGTGTGCATGTGTGGTGG + Intronic
1026220806 7:68395987-68396009 ATGTGTGTGTATATATATGATGG + Intergenic
1026432582 7:70361872-70361894 ATGTATATGTATATGTATATAGG + Intronic
1026567071 7:71497997-71498019 ATGTGTATGCACATGCGTGTGGG + Intronic
1027581464 7:80001457-80001479 ATTTGCATGTAAATATATGGGGG - Intergenic
1028229221 7:88286750-88286772 GTGTGTGTTTATATGTATGGAGG - Intronic
1028718420 7:94001236-94001258 ATGTGTTTGTAGGTTTATGGGGG - Intronic
1028722064 7:94044662-94044684 ATGCATATGTGCATGTTTGGGGG + Intergenic
1028912256 7:96221875-96221897 ATGTGGATGTAATTGTTTGGAGG - Intronic
1029165250 7:98584540-98584562 ATGAGTAAGTACATTTATTGTGG - Intergenic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1029852135 7:103473608-103473630 GTGTGTATGTACATATGTGGGGG - Intronic
1029987193 7:104933313-104933335 ATGTGTATGTACGTGTGCGTAGG - Intergenic
1030729086 7:112963190-112963212 AGGTGTATTTAAATGTATTGGGG + Intergenic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031194899 7:118600877-118600899 GTGTGTATATACATGCATGTGGG - Intergenic
1031275052 7:119711308-119711330 GTGTGTGTGTACATGTAGGAAGG - Intergenic
1031276615 7:119732222-119732244 GTGCTTATGTACATATATGGAGG + Intergenic
1031431893 7:121681963-121681985 TTTTATATGTACATGTATGAGGG + Intergenic
1031939398 7:127771637-127771659 ATGTGTATGTATGTGTATAGGGG - Intronic
1032625422 7:133586584-133586606 ATGTGCATGTATCTTTATGGTGG + Intronic
1033445699 7:141420020-141420042 ATGGGTATGTGAATGTCTGGGGG - Intronic
1033828955 7:145228822-145228844 ATGTGTGTATACATGTATGTGGG - Intergenic
1033852942 7:145519312-145519334 ATATATCTGTATATGTATGGAGG + Intergenic
1033944622 7:146700777-146700799 TTGTGGATGCACATTTATGGTGG - Intronic
1034701382 7:153099243-153099265 TTCTCCATGTACATGTATGGAGG + Intergenic
1035342301 7:158170962-158170984 ATATGTATGTATATATATGAAGG - Intronic
1035615848 8:1000839-1000861 ATGTGTGTGGACAGGTGTGGGGG + Intergenic
1036542096 8:9725749-9725771 ATGTTTATGTACATGAAGTGTGG - Intronic
1036643381 8:10597773-10597795 GTGTTTATGTGCATGTATTGGGG - Intergenic
1036987484 8:13552087-13552109 ATATGTATGTACCTGTCTAGAGG + Intergenic
1037305782 8:17502113-17502135 ATACGTATATATATGTATGGTGG + Intronic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1038088496 8:24227365-24227387 ATGTATATGTATATGTATATGGG + Intergenic
1039185649 8:34913122-34913144 ATGTGTAGATAGATGTGTGGTGG + Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039694299 8:39894342-39894364 ATGTGTATGGGCATGTACTGGGG - Intergenic
1039763190 8:40600143-40600165 GTGTGTGTATACATGTATTGGGG + Intronic
1039784474 8:40821076-40821098 GTGTGTGTGTATGTGTATGGGGG + Intronic
1040486951 8:47882652-47882674 ATGTGGGTGTGCATGTATGATGG - Intronic
1040638061 8:49299056-49299078 GTGTGTGTGTATATATATGGTGG + Intergenic
1040741967 8:50587206-50587228 ATATGTATATACATATATGTAGG + Intronic
1041195472 8:55397625-55397647 ATGTGTGTGTGCATGTGTGGTGG - Intronic
1043077967 8:75726515-75726537 GTGTGTATGTGTGTGTATGGGGG - Intergenic
1043219235 8:77637554-77637576 ATGTGTATATATATGTATATGGG + Intergenic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1044371460 8:91416646-91416668 ATGTGAATGAACATCTATTGGGG + Intergenic
1044417922 8:91956948-91956970 ATGTGTAGGTGCATGTCTTGGGG - Intronic
1044796642 8:95907307-95907329 ATATGTATGTATATGTGTGTAGG - Intergenic
1045095463 8:98792959-98792981 GTGTGTATGTATATATATGATGG + Intronic
1045684053 8:104692826-104692848 GTGTGTGTGTATATGTGTGGGGG - Intronic
1045744677 8:105404658-105404680 AAGTGTATGTGTATGTATGTTGG - Intronic
1045779098 8:105843024-105843046 GTGTGTATGTACACATATGGAGG + Intergenic
1046167853 8:110462019-110462041 GTGTGTATGTATGTGTTTGGGGG + Intergenic
1046572903 8:115989051-115989073 ATGTCTATGTACAGTTAGGGGGG - Intergenic
1048445052 8:134487120-134487142 ATGTGTGTATACATGTACGCAGG + Intronic
1048632402 8:136258238-136258260 ATGTGTCTGTACATTTTTAGGGG - Intergenic
1048852848 8:138661063-138661085 GTGTGTATGTATGTGTATGTGGG - Intronic
1049525402 8:143123240-143123262 GGGTGTGTGTACATGTGTGGAGG - Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049525577 8:143125050-143125072 GTGTGTGTGTACATGTTTGAGGG - Intergenic
1049525582 8:143125124-143125146 GGGTGTATGTACATGTGTGAGGG - Intergenic
1049632672 8:143667028-143667050 ATGTGTGTGCACATGGAGGGAGG - Intergenic
1050719914 9:8576571-8576593 ATATCTATATACATGTATGTGGG - Intronic
1051222826 9:14868676-14868698 AAGTGTATGAAAATGTGTGGGGG - Intronic
1052467008 9:28841216-28841238 ATGTATATGTACATGTGGGATGG + Intergenic
1053024333 9:34717946-34717968 TTCTGTATGTACCTGTGTGGTGG + Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1055254168 9:74346302-74346324 ATGTGTGTATATATGTATGATGG - Intergenic
1055254169 9:74346336-74346358 ATGTGTGTATATATGTATGATGG - Intergenic
1055254172 9:74346432-74346454 ATGTGTGTGTATATATATGATGG - Intergenic
1055254173 9:74346462-74346484 ATGTGTGTGTATATATATGATGG - Intergenic
1055254174 9:74346494-74346516 ATGTGTGTGTATATATATGATGG - Intergenic
1055254175 9:74346526-74346548 ATGTGTGTGTATATATATGATGG - Intergenic
1056088206 9:83177088-83177110 ATATGTATATACTTGTATTGTGG - Intergenic
1056315057 9:85380370-85380392 CTGTGTCTGCACATGGATGGAGG + Intergenic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057495225 9:95555175-95555197 ATGTGTGTGAAAAGGTATGGAGG + Intergenic
1057523709 9:95781488-95781510 GTGTGTGTGTGCATGTATTGGGG - Intergenic
1057526285 9:95805209-95805231 ATGTGTGTGTGCATGCATGTTGG + Intergenic
1057586120 9:96330302-96330324 GTGTGTGTGTATATGTGTGGGGG - Intronic
1057932101 9:99203083-99203105 ATGTGTGTGTACATATATACAGG + Intergenic
1059316885 9:113433341-113433363 ATGTGTAGGTCGAGGTATGGGGG + Intergenic
1059502656 9:114768222-114768244 GTGTGTATGTATGTGTGTGGGGG + Intergenic
1059868589 9:118545559-118545581 ATGTGTGTGTACAGGTAAAGTGG - Intergenic
1060162756 9:121381189-121381211 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1060285768 9:122250572-122250594 GTTTGTATGTACGTGTGTGGAGG - Intronic
1060376729 9:123121167-123121189 ATCTGTATGTACATTTAATGTGG - Intronic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062104265 9:134744518-134744540 GTGTGAGTGTGCATGTATGGGGG - Intronic
1062205968 9:135337557-135337579 AAGTGTATGCACATGTGTGCAGG + Intergenic
1185652589 X:1659681-1659703 ATATGTATGCACGTGTATGCTGG + Intergenic
1186130062 X:6456652-6456674 ATATGTATATATATATATGGGGG + Intergenic
1186703815 X:12120750-12120772 ATGTGTATATTCATCTATGCTGG + Intergenic
1186719753 X:12290806-12290828 ATATGTATGCACATGTGTAGGGG - Intronic
1187203308 X:17157021-17157043 ATTTGTGTGTATGTGTATGGAGG + Intergenic
1187265094 X:17725140-17725162 ATGTATATATACATATATGAGGG + Intronic
1187538595 X:20167553-20167575 GTGTGTATGTACATATAGAGTGG + Intronic
1187794474 X:22987012-22987034 ATGAGTACGTATATATATGGAGG - Intergenic
1187840672 X:23484064-23484086 GTGTGTTTGTATATATATGGGGG - Intergenic
1187952811 X:24487329-24487351 ATGTTTATGTCCATGTGTGCAGG - Intronic
1188783819 X:34319565-34319587 ATGTATAAGCACTTGTATGGTGG + Intergenic
1188998225 X:36912484-36912506 GTGTGTATGTATGTGTAGGGAGG - Intergenic
1189067138 X:37822172-37822194 ATGTGTGTGTGCATGCATGGGGG + Intronic
1191658460 X:63626983-63627005 ATATGTATATACATATATAGGGG + Intergenic
1191658461 X:63627058-63627080 ATATGTATGTACATATATATAGG + Intergenic
1192349421 X:70344700-70344722 ATGTGTATGCAGATGCCTGGTGG + Intronic
1192391617 X:70734384-70734406 AATTGTATGTGCATGTGTGGGGG + Intronic
1192485044 X:71517752-71517774 ATGTGTGTGTATGTGTAGGGGGG + Intronic
1192761994 X:74103846-74103868 ATGTCTATGTCCATGAAGGGTGG - Intergenic
1193074716 X:77343475-77343497 ATGTGTAGGTACATGTACTGGGG - Intergenic
1194143841 X:90239947-90239969 ATGTATATGTAACTGAATGGGGG - Intergenic
1195215517 X:102697521-102697543 ATGAGTATGGAAATGTTTGGGGG - Intergenic
1195320911 X:103721419-103721441 ATATGTGTGTGCATGTATGTGGG - Intronic
1196409746 X:115403796-115403818 ATGTATATATACATATATGTAGG - Intergenic
1196409747 X:115403822-115403844 ATGTATATATACATATATGTAGG - Intergenic
1196409748 X:115403848-115403870 ATGTATATATACATATATGTAGG - Intergenic
1196656064 X:118218218-118218240 ATGTGTATGTGTGTATATGGGGG + Intergenic
1196778269 X:119360594-119360616 AAGTGTATGCAGGTGTATGGTGG + Intergenic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1197273317 X:124449603-124449625 GTGTGAATGTATTTGTATGGAGG - Intronic
1197286976 X:124607209-124607231 ATGTGTATGTGTATGTGTAGGGG + Intronic
1197659542 X:129155362-129155384 ATGTGTATGTATACATTTGGGGG + Intergenic
1197957820 X:131971847-131971869 ATGTGTGTGTATATATATGAGGG - Intergenic
1198301970 X:135342494-135342516 GTGTGTATGTGCTTGTGTGGAGG + Exonic
1198631841 X:138648067-138648089 ATGTGAATGTAATTGTAAGGAGG - Intronic
1199204260 X:145129833-145129855 GTGTGTGTGTATATATATGGTGG + Intergenic
1199235232 X:145485167-145485189 ATGTATATGTACATATATATAGG + Intergenic
1199682611 X:150237556-150237578 ATGTGTATGTACGTATATTTGGG - Intergenic
1200040326 X:153360917-153360939 TTGTGTGTGTACATATATGCAGG - Intergenic
1200042975 X:153383275-153383297 GTGTGTGTGTTCATGTGTGGAGG - Intergenic
1200052219 X:153440198-153440220 ATGTGTGTGTGCAAGTGTGGGGG + Intergenic
1200489603 Y:3809248-3809270 ATGTATATGTAACTGAATGGGGG - Intergenic
1200591175 Y:5078331-5078353 ATGTGCATGTATCTGTATCGTGG + Intronic
1201298853 Y:12488992-12489014 ATGTGTTTGTTTATGTATGAGGG - Intergenic
1201479207 Y:14419443-14419465 ATGGGTATATAAGTGTATGGCGG - Intergenic