ID: 1085146090

View in Genome Browser
Species Human (GRCh38)
Location 11:74199028-74199050
Sequence ATAGCTAACTGGAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085146090_1085146095 21 Left 1085146090 11:74199028-74199050 CCCACCTCATTCCAGTTAGCTAT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1085146095 11:74199072-74199094 TGTTCCCTATGACAGGCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1085146090_1085146094 14 Left 1085146090 11:74199028-74199050 CCCACCTCATTCCAGTTAGCTAT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1085146094 11:74199065-74199087 TTTTCAGTGTTCCCTATGACAGG 0: 1
1: 0
2: 1
3: 12
4: 176
1085146090_1085146097 25 Left 1085146090 11:74199028-74199050 CCCACCTCATTCCAGTTAGCTAT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1085146097 11:74199076-74199098 CCCTATGACAGGCAGCAGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 209
1085146090_1085146099 26 Left 1085146090 11:74199028-74199050 CCCACCTCATTCCAGTTAGCTAT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1085146099 11:74199077-74199099 CCTATGACAGGCAGCAGGCTGGG 0: 1
1: 0
2: 3
3: 23
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085146090 Original CRISPR ATAGCTAACTGGAATGAGGT GGG (reversed) Intronic
902613761 1:17612608-17612630 ATGGATAGATGGAATGAGGTTGG - Intronic
906964547 1:50443704-50443726 ATAGTTAAATGGAATAATGTTGG + Intronic
912046977 1:105471046-105471068 TCAGCTACTTGGAATGAGGTGGG - Intergenic
916823174 1:168419664-168419686 ATACCTAACTGTAATGAGTGAGG - Intergenic
919877471 1:201880615-201880637 ATAGTTCACTGAAATGGGGTTGG - Exonic
922043907 1:221924827-221924849 AGAGCTAACTGGACTGAGAATGG - Intergenic
923929377 1:238676410-238676432 AGAGCTAAGTGGAATGTGATTGG + Intergenic
1067117231 10:43444950-43444972 ATACATAACTGGAAGGAGGATGG - Intronic
1069458003 10:68569112-68569134 ATTGTTAATTGGAATGTGGTAGG + Intronic
1071231951 10:83598225-83598247 ATAGCTAAGGGGAAGGATGTGGG - Intergenic
1073524865 10:104170870-104170892 AGAGCCTAATGGAATGAGGTTGG - Intronic
1074554664 10:114477315-114477337 ATAGCTCACTGGGTTGGGGTGGG + Intronic
1075211078 10:120491443-120491465 AAAGAGAACTGGAAAGAGGTTGG - Intronic
1075361724 10:121843043-121843065 ATAGATAACATGACTGAGGTAGG + Intronic
1077895765 11:6452115-6452137 GTAGCAGACTGGAATGGGGTAGG + Intronic
1080728911 11:34927393-34927415 ACAGCTTACTGGAATAAGGAGGG + Intronic
1085146090 11:74199028-74199050 ATAGCTAACTGGAATGAGGTGGG - Intronic
1087865230 11:103217428-103217450 AGAGATCACTGGAATGTGGTCGG + Intronic
1089876424 11:121726135-121726157 ACAGAGAACTGGAATGAGGGTGG - Intergenic
1091046285 11:132328723-132328745 AAAGATAACTGGAAGGAGGAAGG - Intronic
1095674897 12:44904839-44904861 ATAGCTTAAGGGAATGAGATAGG + Intronic
1097223544 12:57463854-57463876 ATAGGAAACTGGCATGGGGTGGG - Intronic
1102804775 12:115770067-115770089 TTAGCTAGCTGGGTTGAGGTTGG - Intergenic
1106062534 13:26308809-26308831 ACAGTTAAGTGGAATGAGGGAGG - Intronic
1118016330 14:61664847-61664869 TCAGTTAACGGGAATGAGGTGGG - Intergenic
1119252854 14:73171719-73171741 GCAGGTAACTGGAATGAGGGTGG + Intronic
1119418569 14:74493047-74493069 CTACCTAACTGGAATGGGCTGGG - Intronic
1124234430 15:27975622-27975644 ATAGATAAATGGAATAAAGTAGG - Intronic
1124445954 15:29732398-29732420 AAGGCTAACTTAAATGAGGTTGG - Intronic
1124575283 15:30902654-30902676 AATGTTACCTGGAATGAGGTAGG + Intergenic
1125879628 15:43182748-43182770 ATAGAAAACTGCAATGAGGCTGG - Intronic
1134325336 16:13202175-13202197 TAAGGAAACTGGAATGAGGTGGG - Intronic
1139493703 16:67301204-67301226 AGAACAAGCTGGAATGAGGTAGG + Intronic
1143914157 17:10276497-10276519 AGAGCAAACTGGGAGGAGGTGGG - Intergenic
1145413847 17:22695962-22695984 ATAGCTAACTGGAAGGATGGAGG - Intergenic
1145414320 17:22702803-22702825 ATAGCTAACTGGAAGGATGGAGG + Intergenic
1147198062 17:38780866-38780888 ATAGCTATCTGGGATCAGGATGG - Intronic
1155661062 18:28248795-28248817 ATAGGTAATTGGAAGGAGGAGGG + Intergenic
1155988429 18:32254844-32254866 ACAGCTAACAGCAATGAGGGAGG - Intronic
1156228209 18:35129629-35129651 TTAGCCAACTGGAAGTAGGTTGG + Intronic
1156808674 18:41220888-41220910 ATGGCAGAATGGAATGAGGTGGG + Intergenic
1160016149 18:75142080-75142102 ATAGGTAGCTGGAAGGATGTAGG + Intergenic
1165673560 19:37701401-37701423 GTAGGTAACTGGAATGAGTTAGG - Intronic
925983229 2:9193680-9193702 ATACGTAGCTGAAATGAGGTTGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929410148 2:41689888-41689910 ATAGAAAAATGGACTGAGGTTGG - Intergenic
930951472 2:57147970-57147992 ATAGCTGGCTGAAATAAGGTAGG + Intergenic
931508203 2:62956522-62956544 ATAGATAACTTGAAAGAGGAAGG - Intronic
932835202 2:75029520-75029542 AGAGCTAGCTGGATTGGGGTGGG + Intergenic
934807977 2:97253591-97253613 AGATAGAACTGGAATGAGGTGGG - Intronic
934829533 2:97503596-97503618 AGATAGAACTGGAATGAGGTGGG + Intronic
936277779 2:111115626-111115648 ATAACTAACAGGAATGATGCCGG + Intronic
939986882 2:148837872-148837894 ATATCTCACTGGAATTAAGTTGG - Intergenic
940504138 2:154531226-154531248 CTATCTAACTGCAAAGAGGTAGG + Intergenic
943481107 2:188418952-188418974 ATACCTAAGTGGAATTATGTAGG + Intronic
944882697 2:204029642-204029664 TTATCTAAATGGAAAGAGGTTGG - Intergenic
944975349 2:205043656-205043678 AAAGCTAACTGAAATGAGAGGGG - Intronic
945769265 2:214020059-214020081 ATAGCTTACTGGAATCTGATTGG + Intronic
947242780 2:228014485-228014507 AAAGCTAAATCAAATGAGGTAGG - Intronic
947898999 2:233704414-233704436 ATATTTAACTGGAATTAAGTTGG - Intronic
948577047 2:238960077-238960099 ATAGCTTAATAGAATGATGTAGG - Intergenic
1169718455 20:8645531-8645553 ATTGCTTTCTGGTATGAGGTAGG + Intronic
1172678108 20:36689649-36689671 ATAGCTTACTGGAGTCAGGGAGG + Intronic
1174129176 20:48329685-48329707 ATTGCAAACTGGCATGTGGTAGG - Intergenic
1176700083 21:10036086-10036108 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1178156847 21:29864067-29864089 ATACTTCACTGGAATGAGGGAGG - Intronic
1178195312 21:30338167-30338189 ATATCTGAGTGGAATGAGATTGG - Intergenic
1178712900 21:34935284-34935306 ATTCCTAACTGGGATGTGGTTGG + Intronic
1178780343 21:35597576-35597598 ATAAATATCTGGAATGAGGTGGG + Intronic
1184024027 22:41840564-41840586 CTACCAAAGTGGAATGAGGTTGG - Intronic
951359794 3:21711802-21711824 ATAGTGAGCTGGACTGAGGTAGG + Intronic
957275182 3:78081721-78081743 ACAGCTGACAGGAATGAGGCAGG + Intergenic
957788660 3:84913290-84913312 ATAGCTAATTGTAATCATGTTGG - Intergenic
959674952 3:109024349-109024371 ATAACTAGCTGGAATGTTGTAGG + Intronic
963492934 3:146023611-146023633 ATAGCTGAGTGGAATGGGATGGG + Intergenic
970121810 4:12762379-12762401 GTAGCTACCTGAAATGAGATGGG - Intergenic
971293441 4:25367184-25367206 GTTGCTAACTGGAATGATGCTGG + Intronic
975598987 4:76079611-76079633 ATGGCTAACTGGAATATGTTGGG + Intronic
976881079 4:89925770-89925792 ATGGCTGATTGGAGTGAGGTGGG - Intronic
979524943 4:121706793-121706815 AGAGCTGACTGGAGTGAGGAGGG - Intergenic
980372483 4:131894718-131894740 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
982941196 4:161558854-161558876 ATAAATAACTGGATTGGGGTTGG - Intronic
983603755 4:169560908-169560930 TTAGCTAAATGGATGGAGGTGGG + Intronic
991451764 5:66758858-66758880 ATAACTAACTGGAAGTATGTAGG + Intronic
992636301 5:78728788-78728810 AGAGCTCACTGGAATGAGGCAGG - Intronic
1002973912 6:2054538-2054560 ATAGCTATTGGAAATGAGGTTGG + Intronic
1004663114 6:17727598-17727620 AGAGCTAATTGGAATTAAGTGGG - Intergenic
1011835738 6:91429301-91429323 ATATCTAACTTGAAAGAGGTTGG + Intergenic
1012352150 6:98265525-98265547 ATACCAAACTAGATTGAGGTGGG + Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1015457344 6:133441702-133441724 GTAGGTAATTGGAATGAGTTGGG + Intronic
1015882285 6:137881312-137881334 ATGGCTAACCGGAAACAGGTGGG + Exonic
1016562149 6:145408592-145408614 AGACTTAACTGGGATGAGGTAGG - Intergenic
1017589520 6:155963517-155963539 ATAGTGAACTGGAATGAGTGAGG + Intergenic
1019900780 7:4019250-4019272 TTAGCTAACTGGAATTTAGTTGG + Intronic
1022274766 7:28844278-28844300 AAAGCTATCAGGCATGAGGTCGG - Intergenic
1022342317 7:29480077-29480099 AGAGCAAACTGGAAAGAGCTGGG + Intronic
1023463127 7:40422167-40422189 TAAGCTAACTGCAATGTGGTGGG + Intronic
1026841664 7:73672697-73672719 ATAACTATCTGGAAAGAGGAAGG + Intergenic
1027681396 7:81226068-81226090 TTAGCTAAGTGGATTGAGGCAGG + Intergenic
1028831986 7:95338225-95338247 ATAGCTAATTGGAAGGAAGCTGG - Intergenic
1029978171 7:104853154-104853176 CTAGGTAACTGGATCGAGGTGGG - Intronic
1030098616 7:105923958-105923980 ATAACTAGCTAGAATAAGGTTGG + Intronic
1030429782 7:109430536-109430558 ATAGCTAAAAGGAATTAGTTTGG - Intergenic
1030486520 7:110175483-110175505 ATAGGCAACTGTAAAGAGGTAGG + Intergenic
1033092887 7:138403287-138403309 GTAGGTAATTGGAATGAGTTAGG - Intergenic
1035757967 8:2048305-2048327 AGAGCTCACTGAAATGAAGTTGG - Intronic
1042087026 8:65120562-65120584 ATAGGTAACTGGAATGAGTCAGG + Intergenic
1042927879 8:73985139-73985161 ATAGCAAAGTGGCATGAGGGAGG - Intergenic
1045901931 8:107292162-107292184 TTAGTTAACTGGATGGAGGTAGG - Intronic
1047643125 8:126842016-126842038 GTAGGTAACTGGAATGAGTTAGG + Intergenic
1050327956 9:4515911-4515933 ATAGCTAACTGGGAAGAGGGTGG - Intronic
1051594055 9:18806351-18806373 ATAGCTAACTGCAAAAAGGCTGG + Intronic
1053611950 9:39722861-39722883 ATAACTCTCTGGAATGAGGATGG + Intergenic
1053637223 9:40022561-40022583 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1053728831 9:41031650-41031672 AGAACAAAGTGGAATGAGGTGGG + Intergenic
1053768804 9:41442360-41442382 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1053869988 9:42480856-42480878 ATAACTCTCTGGAATGAGGATGG + Intergenic
1054086304 9:60748294-60748316 ATAACTCTCTGGAATGAGGATGG - Intergenic
1054241569 9:62619532-62619554 ATAACTCTCTGGAATGAGGATGG - Intergenic
1054318058 9:63619410-63619432 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1054547471 9:66353837-66353859 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1054555695 9:66654055-66654077 ATAACTCTCTGGAATGAGGATGG - Intergenic
1054699679 9:68400433-68400455 AGAACAAAGTGGAATGAGGTGGG - Intronic
1054827702 9:69589677-69589699 AAAGCTAACTGAATTGAGGAGGG - Intronic
1055287712 9:74746876-74746898 ATAGCTAAGAGCAATGGGGTGGG + Intronic
1057124173 9:92603164-92603186 ACAGCTAAGTGGGCTGAGGTGGG + Intronic
1059218785 9:112592107-112592129 GCAGGTAACTGGAATGAGTTAGG + Intronic
1059392253 9:114006558-114006580 ATAGGTAACTAACATGAGGTTGG - Intronic
1202785095 9_KI270719v1_random:6146-6168 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1187421702 X:19139960-19139982 ATAGCTAACTGTAGGGAGGCTGG + Intergenic
1195069528 X:101265926-101265948 ATACTTAACTGGAACGAGGGAGG + Intergenic
1196038077 X:111168911-111168933 ATAGCTAATTTGAATAAGGATGG + Intronic
1198795116 X:140386317-140386339 AAAGGTAACTGGCATGTGGTAGG + Intergenic
1199522208 X:148748818-148748840 ACAGCTGACTGAGATGAGGTTGG + Intronic