ID: 1085146826

View in Genome Browser
Species Human (GRCh38)
Location 11:74207820-74207842
Sequence AGCTGAAAACCATTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085146826_1085146830 -1 Left 1085146826 11:74207820-74207842 CCAGCCTCCAATGGTTTTCAGCT 0: 1
1: 0
2: 1
3: 9
4: 185
Right 1085146830 11:74207842-74207864 TTTGGTACCTCTGAAGAATCTGG 0: 1
1: 0
2: 1
3: 11
4: 160
1085146826_1085146831 0 Left 1085146826 11:74207820-74207842 CCAGCCTCCAATGGTTTTCAGCT 0: 1
1: 0
2: 1
3: 9
4: 185
Right 1085146831 11:74207843-74207865 TTGGTACCTCTGAAGAATCTGGG 0: 1
1: 0
2: 1
3: 42
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085146826 Original CRISPR AGCTGAAAACCATTGGAGGC TGG (reversed) Intronic
900415878 1:2534485-2534507 AGCTGGAAACCCTTGGGGACAGG - Intergenic
901937918 1:12639746-12639768 AGCTGGAAACCCTGGGATGCTGG - Intergenic
907329692 1:53662962-53662984 AGCTGATAAGCACTGGAGCCAGG + Intronic
907818737 1:57946139-57946161 AGGTGGAAAACAGTGGAGGCTGG - Intronic
908551501 1:65213333-65213355 AACTGAAAACCAGTGGAAGGAGG + Intronic
909350309 1:74644746-74644768 AGCTGGAAAAGATTGGAGGTGGG - Intronic
909521161 1:76569312-76569334 AGCTGAAATCCATTTCAGACTGG - Intronic
915247996 1:154569539-154569561 AGCTCAGAGCCATTGGTGGCTGG - Exonic
915957681 1:160236033-160236055 TGTTGAAAACCATTGTGGGCAGG - Intronic
918045694 1:180939720-180939742 AGGGAAAAACCATTGCAGGCAGG - Intronic
918533398 1:185548247-185548269 AGCTGGAGACCCTTGGATGCTGG + Intergenic
919658953 1:200224288-200224310 AGCTGATAACTAGTGGAGCCAGG - Intergenic
921174593 1:212583177-212583199 AGCTAAAAAGCAGTGGAGGCAGG - Intronic
922202850 1:223421150-223421172 TGTTGAAAAGCATGGGAGGCTGG + Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
924726985 1:246680224-246680246 AGCTGAAGACCACAGGAGACAGG + Intergenic
1065687400 10:28300278-28300300 CTCTGAAAACCATTGGGGGAGGG + Intronic
1066099264 10:32103245-32103267 AGCTCCAAAGCATTGGATGCTGG - Intergenic
1070275091 10:74998245-74998267 AGAAAATAACCATTGGAGGCTGG - Intronic
1071604243 10:86973627-86973649 ATCTGAAAAACATTTTAGGCTGG + Intronic
1072625998 10:97112346-97112368 AGCTCAGAACCATGGGAGGATGG - Intronic
1074196789 10:111195928-111195950 AGATGGAAACCATTGGCTGCAGG - Intergenic
1074859734 10:117501321-117501343 AGCAGAAAAAGATTGGAGGAGGG + Intergenic
1074989295 10:118688497-118688519 ACGTGAAAACAACTGGAGGCAGG + Intronic
1075520953 10:123143216-123143238 ACCTGAAAACAGTTGGGGGCTGG + Intergenic
1080674149 11:34409261-34409283 AGATGAAAATAATTTGAGGCTGG + Intergenic
1080874195 11:36261617-36261639 AACTGAAAACCACTGGACGTGGG + Intergenic
1081742091 11:45448018-45448040 AGCAGAAAGACACTGGAGGCAGG + Intergenic
1083141854 11:60728751-60728773 AGCTGAGAAGCATTGGGGGAGGG - Intergenic
1084718835 11:70891216-70891238 GGCTGAAAACCACCAGAGGCCGG + Intronic
1085146826 11:74207820-74207842 AGCTGAAAACCATTGGAGGCTGG - Intronic
1086699250 11:89881376-89881398 AGCTGAAACCCAAAGGATGCGGG + Intergenic
1086706922 11:89963134-89963156 AGCTGAAACCCAAAGGATGCGGG - Intergenic
1091523885 12:1276533-1276555 AGTTGAAAAACATGAGAGGCTGG - Intronic
1091578078 12:1757951-1757973 AGCTCCAAAGCATTGGATGCTGG - Intronic
1091852807 12:3713817-3713839 AGCTGAAAAACGATGGAGGAGGG + Intronic
1093828946 12:23731262-23731284 AGCTGGAGACCCTGGGAGGCTGG - Intronic
1093854081 12:24077333-24077355 GACTGAAAACCTTTGGAGACTGG + Intergenic
1096230535 12:49894421-49894443 AGGTGAGAACCAATGGAGGGAGG + Intronic
1097008687 12:55937291-55937313 AGCTGAGAAGCATCTGAGGCAGG - Intronic
1098382332 12:69882072-69882094 AGCAGAAAACCATCGCAGGATGG - Intronic
1098730004 12:74023966-74023988 ACCTGAAAACCATGGAAGGGAGG + Intergenic
1100965578 12:100009778-100009800 AGCTCCAAAGCATTGGATGCTGG - Intergenic
1101428445 12:104606770-104606792 AGCTGTAAACAATTACAGGCTGG + Intronic
1104979685 12:132568237-132568259 AGCTGGAAACCCAGGGAGGCAGG - Intronic
1107455687 13:40552702-40552724 AGCAGAAAAACACTGGCGGCCGG + Intergenic
1107632892 13:42360534-42360556 AGCACAAAACCATGGAAGGCTGG + Intergenic
1110754292 13:79153292-79153314 AGCTGAAAAATAATAGAGGCTGG - Intergenic
1112428262 13:99325038-99325060 AGCTGAAAAGTAGTGGAGACAGG + Intronic
1112457603 13:99576426-99576448 AGCAGCAAACCAGTGGAGGTGGG - Intergenic
1112554410 13:100453203-100453225 ATATGAAAACAAATGGAGGCCGG + Intronic
1113759864 13:112839937-112839959 GGCTGGAAACCATGGGAGTCGGG + Intronic
1113767279 13:112889231-112889253 AGCTGAGAACCATTTTATGCCGG - Intergenic
1114575122 14:23706171-23706193 AGCTGAAAGCCATTGAGGGTTGG + Intergenic
1117041873 14:51775387-51775409 GGATGAAGACCATTGCAGGCTGG - Intergenic
1118241790 14:64066894-64066916 AGCTGTAAACCCCTGTAGGCTGG + Intronic
1123205016 14:106704144-106704166 AGCAGACACCCATTGGAGGGTGG + Intergenic
1123210014 14:106750585-106750607 AGCAGACACCCATTGGAGGGTGG + Intergenic
1124187932 15:27546170-27546192 AGCAGAAAACCACTGCAGGCGGG + Intergenic
1126111159 15:45175482-45175504 TGCTGAGAAGCATTGGAGGAGGG - Intronic
1127195525 15:56581633-56581655 AGCTAAAAACCCTTGGAGCTAGG - Intergenic
1127756558 15:62097873-62097895 TGCTGATAACCATTGGGGGAAGG + Intergenic
1128424317 15:67524242-67524264 AGCTGAAAATCAATGGAGTGAGG - Intronic
1128938959 15:71771520-71771542 AGGTGCAAACCAGTGTAGGCTGG + Intronic
1132632837 16:928206-928228 TGCTGAAAACACGTGGAGGCTGG - Intronic
1139129726 16:64127121-64127143 AGGAGAAAAACAATGGAGGCAGG + Intergenic
1140829338 16:78736903-78736925 ATATGAAAACCATTGTGGGCCGG - Intronic
1140989430 16:80194200-80194222 AGGTGTAAGACATTGGAGGCAGG - Intergenic
1141492333 16:84382555-84382577 AGCTCAACACCATTGCAGCCAGG + Intronic
1142397315 16:89839600-89839622 AGCAGGAAACCCCTGGAGGCGGG + Intronic
1142540786 17:657487-657509 AGCTCCAAAGCATTGGATGCTGG - Intronic
1142753493 17:2002058-2002080 AGCTGACAAGCATCGGAGGTTGG + Intronic
1145755180 17:27385067-27385089 AGCTGAAAGCCAGAGGAGGCAGG + Intergenic
1150680679 17:67281896-67281918 AACTGACAACCATTGCTGGCAGG + Intergenic
1151144932 17:72031676-72031698 AGCAGAACACGATTAGAGGCAGG + Intergenic
1152193676 17:78903617-78903639 AACTGAAACCCACTGGAGGCGGG + Intronic
1155833337 18:30545791-30545813 AGCTGAAGTCCATTGAAGGCAGG - Intergenic
1157455330 18:47823131-47823153 TGCTGAGAACCATTGAAGCCAGG - Exonic
1162024690 19:7887428-7887450 GTCTGAAAAACCTTGGAGGCCGG - Intergenic
1165924374 19:39318221-39318243 AACTGAAATCCATGCGAGGCAGG + Intergenic
1166772819 19:45294524-45294546 AGATGATAGGCATTGGAGGCTGG + Intronic
1167111762 19:47466515-47466537 AGCTGAGGACCAATGCAGGCAGG + Intronic
926307972 2:11653277-11653299 TGCTGAGAACCATCGGAAGCTGG + Intergenic
930852858 2:55980026-55980048 TGCTGAAAACCCTTGAAGCCAGG - Intergenic
931547135 2:63401577-63401599 AGCTCAAGACCACTTGAGGCTGG + Intronic
931568625 2:63643986-63644008 AGCTCCAAAGCATTGGATGCTGG - Intronic
931568803 2:63646304-63646326 AGTTGAAAAGCATGGGAGGAAGG - Intronic
932611094 2:73200824-73200846 AGCTTAAAACCATATGTGGCTGG - Intergenic
933491932 2:82996221-82996243 AGCTGAAAACCATTGTATTTGGG + Intergenic
937766784 2:125670651-125670673 AGGGGCAAACCACTGGAGGCAGG - Intergenic
939820734 2:146954161-146954183 AGCTGCAAAGCAGTGGAGCCTGG - Intergenic
941005135 2:160240076-160240098 AGCAGGAACCCATTGGAGGATGG + Intronic
941753277 2:169156654-169156676 AGCTGATAAGCAATGGAGACAGG + Intronic
945606230 2:211935645-211935667 AGCTGAAGACCCTCGGATGCTGG - Intronic
945819506 2:214646559-214646581 AGCTGATAACCAGAGGAAGCAGG + Intergenic
1168810754 20:703066-703088 AGCTGAAAAGAGTTGAAGGCAGG - Intergenic
1169320591 20:4630159-4630181 AGCTCCAAAGCATTGGATGCTGG - Intergenic
1170428133 20:16255908-16255930 AGCTGAAGACCCTGGGATGCGGG + Intergenic
1170980017 20:21203749-21203771 ATTTTAAAACCTTTGGAGGCTGG - Intronic
1175603953 20:60297217-60297239 GGCTGGAAAGCAGTGGAGGCAGG + Intergenic
1177420171 21:20846023-20846045 TCATGAAAACCAGTGGAGGCCGG - Intergenic
1177779717 21:25608874-25608896 ATCACAAACCCATTGGAGGCAGG + Intergenic
1179024432 21:37668064-37668086 AGCTGAGAACCACTGGTGCCTGG + Intronic
1179108622 21:38425817-38425839 AGGTCAAAACCATCTGAGGCAGG + Intronic
1179286346 21:39980423-39980445 AGCTGAAAACCCCTGGAGAACGG - Intergenic
1179345253 21:40550190-40550212 AGCAGAAAGCCCTGGGAGGCAGG - Intronic
1182037595 22:27211359-27211381 AACTGAAGACCAGTAGAGGCTGG + Intergenic
1182183460 22:28376028-28376050 AGCTGGAGACCCTTGGATGCTGG - Intronic
1182424307 22:30264082-30264104 CGCTGAAAAGCATCCGAGGCAGG + Exonic
949710371 3:6863717-6863739 ACCTGAGAACCACTGGGGGCTGG + Intronic
950550331 3:13662346-13662368 AGTTAAAAACCAGAGGAGGCAGG - Intergenic
953248714 3:41222846-41222868 TGCAGAAATACATTGGAGGCTGG + Intronic
953403468 3:42647486-42647508 AGCTGACAACCCTTGGTGGAGGG + Exonic
953701614 3:45200345-45200367 AGATGAGAACACTTGGAGGCAGG + Intergenic
956050303 3:65240822-65240844 AGCTAATAACCAGTGGAGCCAGG + Intergenic
956391033 3:68772744-68772766 AGCTGGAAACCCTGGGATGCTGG - Intronic
957224601 3:77427161-77427183 ACCTGAAAACCACTGGATTCAGG + Intronic
961435930 3:126916651-126916673 AGCTGACCACCAGTGGGGGCAGG - Intronic
962925496 3:139989337-139989359 AGCTGGAAAGCATGGGAGGAAGG - Intronic
965447915 3:168798914-168798936 AACAGAAAACCAGTGTAGGCTGG + Intergenic
967870478 3:194225160-194225182 AGCTGCAAACCATTAAAGGCAGG + Intergenic
977072004 4:92403061-92403083 AGTTGGAAACCAGTAGAGGCTGG - Intronic
979009419 4:115348371-115348393 AGTTGAAAAACAATGTAGGCAGG + Intergenic
983740810 4:171130563-171130585 AGTTGAAAGCCATCTGAGGCAGG - Intergenic
984674967 4:182536633-182536655 AGCAGGAAAACATAGGAGGCTGG - Intronic
985907252 5:2849508-2849530 AGCTGTAACCCAGTGGTGGCGGG + Intergenic
986131054 5:4930544-4930566 AGCTGAAAGACATTGGAGGCTGG + Intergenic
987328774 5:16836393-16836415 AGATGCAAACCACTGGAGGTGGG - Intronic
990282965 5:54271166-54271188 AGCTGGAGACCATGGGATGCTGG - Intronic
990323883 5:54655513-54655535 AGCTGGAAACCCTGGGATGCTGG - Intergenic
993051215 5:82928252-82928274 AGATGAAAACCCCTGGAGGTGGG + Intergenic
995560041 5:113370918-113370940 AGCTGAAAGACAGTTGAGGCTGG + Intronic
999146277 5:149397748-149397770 AGCTGGAGACCCTGGGAGGCTGG + Intronic
999589909 5:153133546-153133568 TGCTGACAACCACTGGAAGCTGG - Intergenic
1000423328 5:161062154-161062176 AGCTGAAAACCCTGGGATACTGG + Intergenic
1000902187 5:166924722-166924744 AACTGAAAACCATTAGAGAGTGG - Intergenic
1000948714 5:167453911-167453933 AGCTTAAAACCATTATAGACAGG - Intronic
1004197845 6:13521304-13521326 AGCTCCAAAGCATTGGATGCTGG + Intergenic
1004266712 6:14154285-14154307 AGCTGAATTCCTTTGGAGGTGGG + Intergenic
1004488090 6:16087086-16087108 AGCTCAAACCCATTGGAGCCTGG + Intergenic
1006952212 6:37832193-37832215 GGCTGAAAATAATTGTAGGCTGG + Intronic
1007385988 6:41520450-41520472 AACTCAAAACCCTTTGAGGCAGG - Intergenic
1007627074 6:43252737-43252759 AGCTGAAAAAGATCGGGGGCGGG + Exonic
1008306492 6:49907987-49908009 AGCTGAACACATTTTGAGGCAGG - Intergenic
1011631040 6:89324691-89324713 AGGAGAAAACCATTGTAGGATGG + Intergenic
1016373270 6:143395740-143395762 ATCTGAAAACTATTGGAAGAGGG - Intergenic
1016390048 6:143565713-143565735 AGCAGAAAACCAGTGGATGATGG + Intronic
1017003547 6:150013572-150013594 AGCTGAAAAGCCATGGTGGCAGG - Intergenic
1018143330 6:160861351-160861373 AGCTGAAATGCACAGGAGGCTGG + Intergenic
1018225104 6:161621294-161621316 AGCTGAAGACCCTGGGATGCTGG + Intronic
1018651837 6:165998849-165998871 ATCTGCAAAGGATTGGAGGCAGG - Intergenic
1023362466 7:39430799-39430821 AGCTGAAAGCCTGTGGAAGCTGG - Intronic
1023433732 7:40120671-40120693 ATATGAAAATCTTTGGAGGCAGG + Intergenic
1024063360 7:45714777-45714799 AGCTGGAAGCCATTGGCGGAGGG - Exonic
1024338769 7:48236424-48236446 AACTGAAAACCAGCAGAGGCAGG - Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026776390 7:73233770-73233792 AACTAAAAACCATTTGGGGCTGG + Intergenic
1027017242 7:74787140-74787162 AACTAAAAACCATTTGGGGCTGG + Intronic
1027070781 7:75158792-75158814 AACTAAAAACCATTTGGGGCTGG - Intergenic
1027767788 7:82366882-82366904 AGGTCAAAACCAGTGGATGCTGG - Intronic
1028673498 7:93431647-93431669 TGCTGTAAACCACTAGAGGCTGG + Intronic
1030710713 7:112745457-112745479 AGTTAAAAAGCAATGGAGGCCGG - Intergenic
1031111354 7:117613388-117613410 AGCTGAAGACCAATTGAGCCAGG - Intronic
1031786069 7:126034508-126034530 AGCTGAACTCAATTGCAGGCTGG - Intergenic
1037040673 8:14228079-14228101 ATCTGAAAACATCTGGAGGCAGG - Intronic
1037047403 8:14325138-14325160 AGCTTGAAATGATTGGAGGCAGG + Intronic
1037763961 8:21760336-21760358 AGCAGAAAGCTAGTGGAGGCTGG + Intronic
1038579387 8:28734413-28734435 ATTTGAAAACCACTGGAGGCCGG + Intronic
1041785066 8:61622676-61622698 AGGTGGAAGCCATTGGAGGGAGG - Intronic
1044513150 8:93107587-93107609 AGCTGGAAGCCATCAGAGGCAGG - Intergenic
1052593578 9:30530645-30530667 AGCAGAAAACATTTGGAAGCAGG + Intergenic
1053754155 9:41286178-41286200 AGCTGAAAAAAATAGGAGGTTGG - Intergenic
1053856955 9:42347794-42347816 ATTTGAAAATCATTTGAGGCCGG + Intergenic
1054332097 9:63769494-63769516 AGCTGAAAAAAATAGGAGGTTGG + Intergenic
1054568341 9:66782959-66782981 ATTTGAAAATCATTTGAGGCCGG - Intergenic
1055562671 9:77536157-77536179 AACTGGAAACAATTGGAGACAGG + Intronic
1056721416 9:89075455-89075477 AGGTGAAAACTCTTGCAGGCAGG + Intronic
1059129988 9:111737048-111737070 AGTTGAAAAACAATAGAGGCTGG + Intronic
1059216646 9:112570816-112570838 AGCTGGAAACCCTGGGATGCTGG + Intronic
1060570082 9:124630543-124630565 GGCTTAAAACCAGTGGAGGCTGG + Intronic
1060912339 9:127361073-127361095 AGCTGAGAACCACTGGATTCTGG - Intronic
1061098333 9:128473032-128473054 AGCTGAAAACAGTAGGTGGCAGG + Exonic
1185484646 X:473167-473189 ATTTGAAAAACACTGGAGGCCGG - Intergenic
1188120925 X:26306170-26306192 AGCTGACAATCAAAGGAGGCAGG + Intergenic
1188295113 X:28437628-28437650 AGCTGATAACCATTAGGGGAAGG - Intergenic
1189313421 X:40035930-40035952 AGCTGGAATCCTTTGGGGGCTGG - Intergenic
1192528467 X:71867650-71867672 AGCTGGAAACCAATGGTGGTGGG - Intergenic
1192580349 X:72276177-72276199 AGCTCCAAAGCATTGGATGCTGG - Exonic
1193413427 X:81193423-81193445 AGCTGGAAAGCCTTGAAGGCTGG - Intronic
1193895328 X:87108540-87108562 AACTGAAAACCAGTGGAGCAAGG - Intergenic
1194659912 X:96619181-96619203 AGCTGAAGACCCTGGGATGCTGG - Intergenic
1196910905 X:120483423-120483445 GGCTGCAAACATTTGGAGGCAGG + Intergenic
1197368052 X:125590721-125590743 ACTTGAAAACTGTTGGAGGCAGG + Intergenic
1198141456 X:133808013-133808035 AGCAGAAATGCATGGGAGGCAGG - Intronic
1198748015 X:139909596-139909618 ATCTGAAAAACATTGGTGGACGG + Intronic
1199675758 X:150187974-150187996 TGATGAAAACTATTGTAGGCTGG - Intergenic