ID: 1085150391

View in Genome Browser
Species Human (GRCh38)
Location 11:74248097-74248119
Sequence TGTTAGCTAGATAACAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085150391 Original CRISPR TGTTAGCTAGATAACAGTGG AGG Intronic
904452881 1:30627690-30627712 TGTTATCTACAGAACAGTGCAGG + Intergenic
906371144 1:45254913-45254935 ACTTAGCTAGAGAACACTGGAGG + Intronic
908937070 1:69388929-69388951 TGCTAGATAAATAAAAGTGGGGG - Intergenic
910660975 1:89672179-89672201 AGTTAGCTAGGTAAAATTGGAGG - Intronic
911026640 1:93442967-93442989 TGTTAGCTTGATAGCAGTCATGG - Intergenic
911297008 1:96130036-96130058 TATTAGCTAGATCACGGTGGTGG - Intergenic
917865691 1:179192376-179192398 TGTTATGGAGATAACAGTGTTGG - Intronic
918691933 1:187491802-187491824 AGTAACCTAGAAAACAGTGGTGG + Intergenic
920518695 1:206606182-206606204 GACTAGCTGGATAACAGTGGGGG + Intronic
922421341 1:225462800-225462822 TGTTATCTATAGAACAGTGACGG - Intergenic
1068341496 10:55710201-55710223 TGTAACTTAGATAAGAGTGGTGG - Intergenic
1070057270 10:72947627-72947649 TTTGAGCTAGATAAAAGTGATGG - Intronic
1073607593 10:104911886-104911908 TATTATCTAGATTATAGTGGAGG - Intronic
1074303112 10:112250854-112250876 TGTTATCTATAGAACAGTTGAGG + Intergenic
1075301505 10:121328733-121328755 TGTGAGCTCAATGACAGTGGAGG + Intergenic
1078390706 11:10933140-10933162 TGTGGGCTTAATAACAGTGGTGG + Intergenic
1078688107 11:13551525-13551547 TGTGAGGTAGATAAAAGAGGAGG + Intergenic
1081406243 11:42701817-42701839 CGTTAGCTAGACAATAGAGGAGG + Intergenic
1083493148 11:63027875-63027897 TATTTCCTAGATAACAGTGGGGG + Intergenic
1085150391 11:74248097-74248119 TGTTAGCTAGATAACAGTGGAGG + Intronic
1088140221 11:106606991-106607013 TCTTTGGGAGATAACAGTGGAGG + Intergenic
1093520956 12:20049334-20049356 TGTAGGCTAGATAACAGTTTTGG + Intergenic
1093606047 12:21089131-21089153 TGTTAGGTAGATTACAGCTGAGG - Intronic
1095263959 12:40131910-40131932 TGTGAGGTAAATAACTGTGGAGG - Intergenic
1095835804 12:46637752-46637774 TGTTAGCCAGAGAACACTGGTGG - Intergenic
1097582977 12:61481158-61481180 TGTTGGCTAGAGAACACTGGTGG - Intergenic
1097688006 12:62709155-62709177 TATCAGCTAGATAACAGTCCCGG - Intronic
1098438586 12:70495540-70495562 TATGAGCCAGAAAACAGTGGGGG - Intergenic
1098765624 12:74485033-74485055 TGTTAGCAATAAAAGAGTGGAGG + Intergenic
1099840181 12:87955071-87955093 TGTTAGCTAGATAGCAAGAGAGG - Intergenic
1104156479 12:126137780-126137802 TAGTAACCAGATAACAGTGGTGG + Intergenic
1104515430 12:129420916-129420938 TGTTAGATAAATAAAAGTAGAGG - Intronic
1112958731 13:105094384-105094406 TGTTAGATAGGGAACATTGGAGG - Intergenic
1114727187 14:24951008-24951030 TGTTAGCTTGCTAACAATGATGG + Intronic
1115967840 14:38912058-38912080 TGTCAGCCAGAGAACACTGGTGG - Intergenic
1116247097 14:42429278-42429300 TGCTAGCTACATAACAGAGGTGG + Intergenic
1129878494 15:78992426-78992448 CGTTAGCCAGAGGACAGTGGTGG + Intronic
1131347111 15:91660447-91660469 TGTCAGCTTGATTACAGTGTTGG + Intergenic
1133947633 16:10362464-10362486 TGCTAGCTGTATAACAGGGGTGG + Intronic
1135722868 16:24832049-24832071 TGTTAGGTAAATAACAGTTGAGG + Intergenic
1139657902 16:68400055-68400077 TGCTACCAAGATCACAGTGGAGG + Intronic
1141136585 16:81469535-81469557 TGTTACCAAGATTACAGAGGAGG + Intronic
1141244468 16:82293259-82293281 TGTTAACTAGCTAACATGGGTGG - Intergenic
1144848986 17:18234557-18234579 TGTAAGGTAGAGAGCAGTGGAGG + Intronic
1147231466 17:39022018-39022040 CTTAAACTAGATAACAGTGGGGG - Intergenic
1148175517 17:45560715-45560737 CTTAAACTAGATAACAGTGGGGG + Intergenic
1148295855 17:46502281-46502303 CTTAAACTAGATAACAGTGGGGG - Intergenic
1148673783 17:49433073-49433095 TGTGTGCTGGATGACAGTGGAGG - Intronic
1150406734 17:64907659-64907681 CTTAAACTAGATAACAGTGGGGG + Intronic
1155577114 18:27259845-27259867 TGTTGGCTGGAAAACACTGGTGG + Intergenic
1158170864 18:54597943-54597965 GGATAGCTGGATAACAATGGAGG - Exonic
1158792932 18:60804099-60804121 TGTTAGTTTGCTAACAGTGATGG - Intergenic
1159968667 18:74621970-74621992 CATTCACTAGATAACAGTGGAGG - Intronic
933166448 2:79082079-79082101 TGTGAGCCAGAAGACAGTGGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933877717 2:86635446-86635468 TGTTTGCTATATGAGAGTGGTGG - Intronic
941668855 2:168269162-168269184 TTTTAGCTAGTTAAAAGGGGAGG - Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1174459601 20:50673170-50673192 TGGTATCTAGAGAAGAGTGGAGG - Intronic
1178179967 21:30148527-30148549 TGTTAGCTAGATAAAAATTTGGG + Intergenic
1183170652 22:36185282-36185304 TGTTTGCTGGGTAACAGTTGAGG + Intergenic
1184459014 22:44626686-44626708 AGTTAACTGGAGAACAGTGGTGG - Intergenic
950445379 3:13034469-13034491 TGTTAGCAAGATCCCACTGGTGG - Intronic
951674174 3:25218195-25218217 TTCAAGCTAGATAAAAGTGGGGG - Intronic
953517700 3:43612341-43612363 TTTTAGTGAGATAACAGTGTTGG - Intronic
955168598 3:56540545-56540567 TGGAAGCTAGACTACAGTGGAGG - Intergenic
956544357 3:70383690-70383712 AGCTAGCTAGATTTCAGTGGAGG + Intergenic
957733237 3:84170464-84170486 TGCTAGCTACATAACAGGGGTGG + Intergenic
957892021 3:86371957-86371979 TGTTACCTGCATAACAGTGAAGG + Intergenic
957935517 3:86936769-86936791 TGTTAGCAATATAAAAATGGGGG - Intergenic
960754794 3:120999935-120999957 TGTAAGCTAGAAAAGACTGGGGG - Intronic
963056965 3:141193835-141193857 TGTTGGCCAGAGAACACTGGTGG - Intergenic
971969842 4:33606551-33606573 TTTCAGCTAGAGAACACTGGTGG - Intergenic
974125242 4:57688002-57688024 TGTCAGCTGGATCTCAGTGGGGG + Intergenic
974420823 4:61671004-61671026 TGCTAGCTACATAACAGGGGTGG + Intronic
975344248 4:73275909-73275931 TGTAAGCTCAGTAACAGTGGAGG - Intergenic
975466149 4:74712291-74712313 TATAAGCCAGAAAACAGTGGGGG - Intergenic
975774870 4:77775144-77775166 TTTGAGCTGGATAATAGTGGAGG - Intronic
978025395 4:103867417-103867439 TGTAGGCCAGAGAACAGTGGTGG + Intergenic
980517124 4:133877888-133877910 TGCTAGCTGGAAAACACTGGTGG + Intergenic
981041920 4:140231074-140231096 TGTTAACTAAGTAACTGTGGTGG - Intergenic
983590201 4:169400639-169400661 TGTTTTTTAGATAACAGTGATGG - Exonic
983663375 4:170154808-170154830 TGTGGGCTAGCTCACAGTGGTGG + Intergenic
984577378 4:181466660-181466682 TGTAAACTAGATAACTGTAGAGG - Intergenic
986309511 5:6541944-6541966 TTTGAACTAGATAAAAGTGGTGG + Intergenic
986684618 5:10265564-10265586 TATTAACTAGCTAACAGTGATGG + Exonic
987675231 5:21064774-21064796 TGTCAGCTGGAGAACACTGGTGG + Intergenic
988631928 5:32940712-32940734 TCTTACTTAGATAGCAGTGGTGG - Intergenic
989253716 5:39343889-39343911 TGTTTGCTGGGTATCAGTGGCGG - Intronic
992140459 5:73791463-73791485 TGTTAACAAGACAACACTGGTGG + Intronic
995790452 5:115881520-115881542 TGTAAGCCAGAAAACAGTGGAGG - Intronic
997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG + Intergenic
998478244 5:142439712-142439734 TGTTAGGATGAAAACAGTGGGGG - Intergenic
1000698165 5:164415179-164415201 TGGTAGCTAGATAACACAGAAGG + Intergenic
1000803888 5:165764162-165764184 TATTAGCTAGAAAATGGTGGAGG - Intergenic
1001067924 5:168554161-168554183 TGTTGGCAAGTTAACACTGGAGG + Exonic
1005434857 6:25798036-25798058 TCTTAGCAAGATATTAGTGGTGG + Intronic
1007785514 6:44277157-44277179 AGTTAGATAAACAACAGTGGAGG - Exonic
1010167506 6:72934412-72934434 TGATAGTGTGATAACAGTGGTGG + Intronic
1010642483 6:78346085-78346107 TGTTATTTAAATGACAGTGGTGG - Intergenic
1012616369 6:101283797-101283819 TGTCAGCTAGAGAACACTGGTGG - Intergenic
1013988528 6:116225753-116225775 TTTTAGCTAGAAGACAGTGTAGG + Intronic
1017536191 6:155349927-155349949 TGTCAGCTGGAGAACACTGGTGG + Intergenic
1018554663 6:165036956-165036978 TACTACCTAGATAACAATGGAGG - Intergenic
1023582137 7:41694561-41694583 GGTTAGCTAGGTAATAGTGCAGG - Intronic
1027829004 7:83154446-83154468 TGTATGCTAAATAACAGTGTGGG + Intronic
1028388040 7:90281681-90281703 TTTTTGCTAGATATCAGTGTAGG + Intronic
1044346406 8:91109386-91109408 TATTAGGTAGATAACAGTGATGG - Intronic
1045082775 8:98646823-98646845 TGTTAGGTTGGTAACAGTGGAGG - Intronic
1046398017 8:113665704-113665726 TGCTAGCTACATAACAGTGGTGG + Intergenic
1047083490 8:121491293-121491315 TGTGTGCTAGAGAACAGTGGCGG - Intergenic
1050167779 9:2784064-2784086 TGTAAGGTAGATAACAGTTTTGG + Intronic
1051821999 9:21180133-21180155 TGTCTGCCAGAAAACAGTGGTGG - Intergenic
1052116789 9:24658474-24658496 TGTAAGCTAGAAGATAGTGGAGG - Intergenic
1052835710 9:33248500-33248522 TGTCAGCTGGAGAACAGTGGTGG + Exonic
1054969151 9:71064240-71064262 TGTTGGCAAGTTAACACTGGAGG + Intronic
1055208578 9:73762564-73762586 TGTTAGCTGGAGAACACTGGCGG - Intergenic
1055224886 9:73984197-73984219 TGTTGGCCAGAGAACACTGGTGG - Intergenic
1056907482 9:90666051-90666073 TGTCAGCTGGAGAACACTGGTGG + Intergenic
1056907563 9:90666506-90666528 TGTTGGCCAGAGAACACTGGTGG + Intergenic
1058365100 9:104200343-104200365 TCTTAGATAGATAACATTTGAGG + Intergenic
1190386065 X:49883177-49883199 TGTTACCTAGATAATCCTGGAGG + Intergenic
1192131513 X:68556111-68556133 TGTCAACTAGATAAAAGAGGCGG + Intergenic
1192926280 X:75758441-75758463 GTTTAGCCAGATAACAGTGGTGG - Intergenic
1193712332 X:84894580-84894602 TGTTGGCCAGAAAACATTGGTGG + Intergenic
1193762845 X:85488913-85488935 TGTCAGCCAGAAAACACTGGTGG + Intergenic
1194067837 X:89284227-89284249 TGTCAGCCAGAGAACACTGGGGG + Intergenic
1195493477 X:105501835-105501857 TCTTGGCTAGATAAGTGTGGGGG - Intronic
1195986827 X:110639483-110639505 TGTAAGCTTGATAAAGGTGGGGG - Intergenic
1196582223 X:117392001-117392023 TGTTAGCTGGAGAGCACTGGTGG - Intergenic
1197122152 X:122905918-122905940 TGTTTGCCAGAGAACACTGGTGG - Intergenic
1198648474 X:138836009-138836031 TGTAAGCTAGAAGACATTGGGGG - Intronic
1200721981 Y:6618387-6618409 TGTCAGCCAGAGAACACTGGCGG + Intergenic
1201281400 Y:12345565-12345587 TGATGGATAGTTAACAGTGGAGG - Intergenic