ID: 1085159396

View in Genome Browser
Species Human (GRCh38)
Location 11:74326897-74326919
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085159396_1085159399 0 Left 1085159396 11:74326897-74326919 CCTCGATGACTCCCGTCAGCTGC No data
Right 1085159399 11:74326920-74326942 TGACTTTAGTCCAAGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085159396 Original CRISPR GCAGCTGACGGGAGTCATCG AGG (reversed) Intergenic
No off target data available for this crispr