ID: 1085159833

View in Genome Browser
Species Human (GRCh38)
Location 11:74329900-74329922
Sequence TTGCCTGCCTTTCCCAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085159833_1085159837 13 Left 1085159833 11:74329900-74329922 CCTGATCTGGGAAAGGCAGGCAA No data
Right 1085159837 11:74329936-74329958 CACAGATTCATAAGAACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085159833 Original CRISPR TTGCCTGCCTTTCCCAGATC AGG (reversed) Intergenic
No off target data available for this crispr