ID: 1085159978

View in Genome Browser
Species Human (GRCh38)
Location 11:74331600-74331622
Sequence CTCAAGGACTTGCCTCCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085159976_1085159978 -10 Left 1085159976 11:74331587-74331609 CCAGTGTGTGTAGCTCAAGGACT 0: 1
1: 0
2: 0
3: 44
4: 791
Right 1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 124
1085159973_1085159978 21 Left 1085159973 11:74331556-74331578 CCGGCCTATGTTTATATATCTTG 0: 1
1: 0
2: 3
3: 25
4: 451
Right 1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 124
1085159974_1085159978 17 Left 1085159974 11:74331560-74331582 CCTATGTTTATATATCTTGCACT 0: 1
1: 0
2: 3
3: 15
4: 214
Right 1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 124
1085159972_1085159978 22 Left 1085159972 11:74331555-74331577 CCCGGCCTATGTTTATATATCTT 0: 1
1: 0
2: 19
3: 130
4: 1181
Right 1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 124
1085159971_1085159978 27 Left 1085159971 11:74331550-74331572 CCGAGCCCGGCCTATGTTTATAT 0: 1
1: 0
2: 13
3: 328
4: 4606
Right 1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 124
1085159970_1085159978 30 Left 1085159970 11:74331547-74331569 CCACCGAGCCCGGCCTATGTTTA 0: 1
1: 5
2: 150
3: 1198
4: 7958
Right 1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085159978 Original CRISPR CTCAAGGACTTGCCTCCACT GGG Exonic
900553711 1:3269467-3269489 CTCTGGGACTTTCCTCCTCTGGG - Intronic
900553798 1:3269850-3269872 CTCTGGGACTTTCCTCCTCTGGG - Intronic
900553802 1:3269866-3269888 CTCTGGGACTTTCCTCCTCTGGG - Intronic
900553806 1:3269882-3269904 CTCTGGGACTTTCCTCCTCTGGG - Intronic
900865531 1:5266230-5266252 CTGAAGGACTTACCTCTGCTCGG - Intergenic
901029041 1:6295709-6295731 CCCATGGACTTGCCTCTTCTGGG - Intronic
901612553 1:10510393-10510415 CACAAAGACTTGCCTTTACTTGG - Intronic
902575423 1:17374283-17374305 CTCAGGGAGTTGCCTGCCCTGGG - Intronic
903446448 1:23425144-23425166 CGCACCGAGTTGCCTCCACTTGG - Intergenic
904627304 1:31814387-31814409 CTGAGGGACTCCCCTCCACTGGG + Exonic
904976416 1:34460403-34460425 CCCAAGGACATACCACCACTAGG + Intergenic
905381820 1:37567500-37567522 CTCAAGGACCTGCATCTAGTGGG + Intronic
906419326 1:45651033-45651055 CTAAAGAACTTGCCACCAATTGG - Intronic
910953663 1:92678295-92678317 CTCAAGCACTTGGCCCCCCTTGG - Intronic
914196895 1:145452299-145452321 CTCAGGGACTTGGGTCCACAGGG + Intergenic
916155881 1:161847218-161847240 GTCAAGGACCTGGCTCCATTTGG - Intronic
920349472 1:205328492-205328514 CTCCTGGCCCTGCCTCCACTTGG + Intergenic
920865057 1:209744879-209744901 CTCAAGGACCACCCTCCAGTGGG + Intergenic
921242892 1:213204860-213204882 CTCAAGGAGATTCTTCCACTTGG + Intronic
922192158 1:223328842-223328864 AGCCAGGACTTGCCTCCACTAGG - Intronic
1062982550 10:1737326-1737348 CTCTATGACTTGCTCCCACTGGG + Exonic
1069790320 10:71015109-71015131 CTCAAGGAATTGGAGCCACTGGG - Intergenic
1070676826 10:78417674-78417696 GACAAGGACTTGCCACCACTGGG - Intergenic
1070758603 10:79009105-79009127 ATCAATTATTTGCCTCCACTGGG + Intergenic
1075343825 10:121667832-121667854 CTCAAGCACCTGCCTCTTCTGGG + Intergenic
1076549927 10:131271713-131271735 CTCCAGGCCTTCCCTCCACATGG - Intronic
1081584881 11:44377329-44377351 CTCAAGAACTTTCCTGCACATGG + Intergenic
1082000120 11:47389617-47389639 TTCAAGGGCTTGCCTCCTCCAGG + Intergenic
1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG + Exonic
1092016627 12:5164576-5164598 CTCATGGCTTTGCCTCCATTAGG - Intergenic
1093252488 12:16824280-16824302 CTCCAGCTCTTTCCTCCACTAGG - Intergenic
1093300507 12:17448206-17448228 CTCAAAGCTTTGCCTTCACTGGG - Intergenic
1093758855 12:22882511-22882533 CTCTAGGACTTACCACCACAGGG + Intergenic
1094354946 12:29566987-29567009 CTCAGGGAGTTGCCTCCCCAAGG + Intronic
1096834213 12:54338416-54338438 CTAGAGGACTTCCCTCCACTAGG + Intronic
1098290387 12:68952255-68952277 TTCAAGGAAATGCCTCCACTGGG + Intronic
1101683112 12:106988118-106988140 CTCAAGGAATTCACTCCACAGGG - Intergenic
1102694724 12:114789866-114789888 CTCAAGGAGCTGCCTCCAGTGGG - Intergenic
1104528464 12:129547065-129547087 CTCAAGGCCTTGCTTCCTCTGGG + Intronic
1104985379 12:132593651-132593673 CTCAAGCCCTTGCCTGCTCTGGG - Intergenic
1110854730 13:80283649-80283671 CTCCAGGACTTTTCTCCACATGG + Intergenic
1113445173 13:110360571-110360593 CTCAAGGTGTTTCCTTCACTAGG - Intronic
1113980349 13:114269492-114269514 CAGAAGCACTTGCTTCCACTGGG - Intronic
1117749437 14:58904535-58904557 CTCAAAAGCTTCCCTCCACTGGG - Intergenic
1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG + Intronic
1122647867 14:103207182-103207204 CTCCTGGACTTGCTTCCACCCGG - Intergenic
1125380957 15:39086182-39086204 TTCATGGGCTTGCCTCCACAAGG + Intergenic
1125403706 15:39331463-39331485 CTTAAGGAATTTCCTCCAATAGG - Intergenic
1129231634 15:74200282-74200304 CTCATGCACTTCCCTCCACCTGG - Intronic
1133467225 16:6039196-6039218 CTCCAGGACTTGCCCCGACCAGG - Intronic
1134573194 16:15309360-15309382 CTCATCGACCTGCCTCTACTGGG + Intergenic
1134834878 16:17352880-17352902 CACAAGGCCTTGTCTCCACATGG + Intronic
1135494826 16:22942288-22942310 CTCCAGGAGTTGCTTCCCCTGGG - Intergenic
1136547401 16:30963495-30963517 CTCAGGGCCTTGCCCCCAGTGGG - Exonic
1139558086 16:67725274-67725296 CCCAAGAACCTGCCTCCACAAGG + Exonic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1141774981 16:86117157-86117179 CCCCAGGACTTGCCACCATTTGG - Intergenic
1148969874 17:51470494-51470516 CTCAAAGAATTTCCTCTACTGGG + Intergenic
1149763760 17:59257244-59257266 CTCAAGGCATTGCCTCCTCTGGG + Intronic
1150851065 17:68704121-68704143 CTCAAGGGCTTGACTCCAGTAGG + Intergenic
1152531632 17:80922506-80922528 CTCTTGGACATGCATCCACTGGG - Intronic
1155825139 18:30432236-30432258 CTCAAGGACTTCTCAGCACTTGG + Intergenic
1157083162 18:44550296-44550318 ATCAAGAAATTGCCTCCATTTGG + Intergenic
1158171707 18:54607068-54607090 CTAAGGGACTTGCCCGCACTAGG + Intergenic
1160284105 18:77523280-77523302 CTCAGAGACTTTCATCCACTGGG + Intergenic
1160753028 19:743622-743644 CCCAGGGACTCGCCTCCTCTCGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
926046815 2:9716093-9716115 AGCATGGACTTGCTTCCACTGGG - Intergenic
927115740 2:19900597-19900619 CTCCAAGTCTTGCCTCGACTGGG - Intronic
930879930 2:56259295-56259317 CTGAAGGACTTACTTCCAATAGG - Intronic
937930951 2:127204935-127204957 CTCAAAGCCTTGCCTCCAGATGG + Intronic
942972803 2:181977882-181977904 CTCAAAGTCTGGGCTCCACTGGG + Intronic
944579839 2:201122777-201122799 CTCAAGCATTTGCCTCCATTTGG - Intronic
944985160 2:205167905-205167927 CTCAAGGACTAGCCTACATTAGG + Intronic
949067501 2:242002118-242002140 CTCAGGGACAAGCCTCCCCTGGG - Intergenic
1173360543 20:42340535-42340557 CTCAGGGAGTTGCCTCCACTTGG - Intronic
1173874135 20:46359106-46359128 CTCCAGGACCTGGCCCCACTGGG + Intronic
1175749232 20:61483724-61483746 CTCCAGGGCATGCATCCACTAGG - Intronic
1176414508 21:6467178-6467200 CTCCAGGACTCGCCGCCAGTGGG + Intergenic
1179690006 21:43075500-43075522 CTCCAGGACTCGCCGCCAGTGGG + Intronic
1182615708 22:31588213-31588235 CTCAAAGACTGGGCTCAACTGGG + Intronic
1183962946 22:41423424-41423446 CACAAAGACTTGCATGCACTTGG + Intergenic
953757006 3:45655346-45655368 GTAAAGGAATTCCCTCCACTAGG - Intronic
954901114 3:54020930-54020952 CTAGTGGTCTTGCCTCCACTGGG - Intergenic
955488231 3:59456567-59456589 CTTCAGGACTTGACTCCCCTGGG + Intergenic
959131590 3:102363167-102363189 CTCAAGGACTTCTCTCCCTTGGG - Intronic
959552199 3:107674525-107674547 CTCAATGTCTTCCCTTCACTTGG - Intronic
961531864 3:127544902-127544924 CTCAGGGACTTTCCTCTAATTGG + Intergenic
967062072 3:185881443-185881465 CTCTAGGAATCGCCTCCCCTTGG - Intergenic
975670336 4:76773777-76773799 CTCTAGGGGTTGCATCCACTGGG - Intronic
982811194 4:159827708-159827730 CTCAAGGGCTTTCTTTCACTGGG + Intergenic
983256786 4:165408987-165409009 CTCAAGCATTTACCTCCACCTGG + Intronic
987693594 5:21299876-21299898 CTCAAGGAGTTACCTCTACCAGG + Intergenic
989199145 5:38746294-38746316 TTCCAGGTCTTTCCTCCACTGGG + Intergenic
989449731 5:41572638-41572660 CTGAAGGACTGCCCTCCACTAGG - Intergenic
990611507 5:57461499-57461521 CTGAGGGACTTGCCTTGACTGGG + Intergenic
991746675 5:69749670-69749692 CTCAAGGAGTTACCTCTACCAGG - Intergenic
991751030 5:69805572-69805594 CTCAAGGAGTTACCTCTACCAGG + Intergenic
991798277 5:70329613-70329635 CTCAAGGAGTTACCTCTACCAGG - Intergenic
991826053 5:70624982-70625004 CTCAAGGAGTTACCTCTACCAGG - Intergenic
991830317 5:70680467-70680489 CTCAAGGAGTTACCTCTACCAGG + Intergenic
991890612 5:71328929-71328951 CTCAAGGAGTTACCTCTACCAGG - Intergenic
997598807 5:135125658-135125680 CTCAATGATTTTCCTCCCCTTGG - Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1003082353 6:3031674-3031696 CTCATGGACATGTGTCCACTAGG - Intergenic
1003129946 6:3386838-3386860 AACAAGGACTTGCTTCCACAGGG + Intronic
1004005377 6:11633095-11633117 CACAAGGACTAGCCTACACCTGG - Intergenic
1004633319 6:17442652-17442674 CTCAAGCAATTCCCCCCACTTGG - Intronic
1005557315 6:27000062-27000084 CTCAAGGAGTTACCTCTACCAGG - Intergenic
1009817912 6:68760279-68760301 CTCAAGGACATTTCTCCCCTAGG + Intronic
1011283777 6:85703238-85703260 TTCAATTACTTGCCTCTACTGGG + Intergenic
1014773435 6:125482566-125482588 ATAAAGGAATGGCCTCCACTTGG + Intergenic
1019005592 6:168793981-168794003 CTCTAGGCCCTGACTCCACTGGG + Intergenic
1020493327 7:8816632-8816654 CTCAGGGACTTGACAGCACTTGG - Intergenic
1021129954 7:16899720-16899742 CTGAAGTTCTTTCCTCCACTTGG + Intergenic
1023793426 7:43771615-43771637 CCCAAGGTCTAGGCTCCACTTGG - Intronic
1024706350 7:51964638-51964660 CTCATGGACAGGCCTTCACTAGG + Intergenic
1034971546 7:155422807-155422829 CTCAGGGCCTTTCCTGCACTAGG + Intergenic
1037639771 8:20731952-20731974 CTCAAGAACTTCCCTCCCCTGGG + Intergenic
1045246099 8:100442792-100442814 CTCAAAGACTCAGCTCCACTAGG - Intergenic
1048195928 8:132331654-132331676 CTGAAGGACCTGTGTCCACTGGG + Intronic
1049995363 9:1029170-1029192 CTGAAGGACCTGCCTCCCCAGGG + Intergenic
1050850219 9:10275835-10275857 CTCAGGGATTTTTCTCCACTTGG - Intronic
1053009443 9:34624882-34624904 CTCGAGGCCTCCCCTCCACTGGG - Intronic
1056549990 9:87644414-87644436 CTGAAGTACTTGGCTCCACCGGG - Intronic
1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG + Intronic
1060744910 9:126124891-126124913 CTCAATGACTGCCATCCACTTGG - Intergenic
1061371198 9:130198479-130198501 CTCAAGGAGTTGTATCCAATTGG + Intronic
1061665494 9:132158655-132158677 CATCAGGACTTGCCTCCTCTTGG + Intergenic
1062697839 9:137884543-137884565 CTCAGGGACTTGGGTCCACAGGG - Intronic
1186456607 X:9714716-9714738 CTCTAGGACTTCCCACCACGAGG - Intronic
1189239207 X:39512675-39512697 ATAAAGGAGTTGCCTCCCCTGGG - Intergenic
1189882707 X:45508777-45508799 CCCAAGGACTGCCCTCCACCTGG - Intergenic
1189963943 X:46352569-46352591 CTCAAGGACTTTCCTCTTCTGGG - Intergenic
1190481846 X:50885031-50885053 CTCATGGACTTGGCTCTGCTGGG + Intergenic
1194502688 X:94700343-94700365 CTCAAGGATTTGCCCCAACCAGG - Intergenic
1194654275 X:96553137-96553159 CTCAAAGACATGCCTTCTCTAGG + Intergenic
1195174317 X:102300307-102300329 CTCAAGCACATGACTCTACTGGG + Intergenic
1195184548 X:102386786-102386808 CTCAAGCACATGACTCTACTGGG - Intronic
1200206476 X:154320100-154320122 CTCAAGGCATTTCCTCCTCTCGG - Intronic