ID: 1085162155

View in Genome Browser
Species Human (GRCh38)
Location 11:74358201-74358223
Sequence CATATGTACCACTCTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 4, 2: 29, 3: 133, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085162148_1085162155 30 Left 1085162148 11:74358148-74358170 CCTAACATAAACTATGGGCTTTG 0: 1
1: 5
2: 91
3: 382
4: 837
Right 1085162155 11:74358201-74358223 CATATGTACCACTCTAATGGGGG 0: 1
1: 4
2: 29
3: 133
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085162155 Original CRISPR CATATGTACCACTCTAATGG GGG Intronic
901750141 1:11401513-11401535 CAAATGCACCACTCTGATGGGGG - Intergenic
902424924 1:16312707-16312729 CACATGTACCACTCTGGTGGGGG + Intronic
902908248 1:19575335-19575357 CATATGTACTGCTCTGGTGGCGG - Intergenic
903727731 1:25463954-25463976 CAAATGTACCACTCTGGTGGGGG - Intronic
904521327 1:31098388-31098410 CAAATGTACCACTCTGATGGGGG - Intergenic
905020018 1:34803216-34803238 CAAATGTACCTCTCTGGTGGGGG - Intronic
905578777 1:39067482-39067504 CAAATGTACCACTGTAGTGTGGG - Intergenic
905813186 1:40928123-40928145 CAAATGTACCCCTCTAATGGAGG + Intergenic
905831054 1:41067843-41067865 GAAATGTACCACTCTGGTGGAGG + Intronic
906806372 1:48782718-48782740 CAGATATACCACTCTGGTGGGGG - Intronic
907531809 1:55106842-55106864 CATATGTACCCCACCACTGGAGG + Intronic
908238111 1:62166818-62166840 CAAATGTACCATTCTGGTGGAGG - Intergenic
908279228 1:62513013-62513035 CAAATGCACTACTCTGATGGGGG + Intronic
908585892 1:65567859-65567881 CAAATGTACCACTCTGAGGGGGG - Intronic
908917289 1:69143464-69143486 CAAATGAACCACTCTGGTGGGGG + Intergenic
909213439 1:72853612-72853634 CAAATGTATCACTCTGATGCAGG - Intergenic
909471083 1:76028879-76028901 CAAATGTACCACTCTCGTGGAGG + Intergenic
909728145 1:78860777-78860799 CAAATGTGCCACACTAATGTTGG - Intergenic
909755811 1:79223701-79223723 CAAATGTACCTTTCTAATGTAGG + Intergenic
910097428 1:83539347-83539369 CAAATGTACCACTCTGGTGGGGG + Intergenic
910732142 1:90409688-90409710 CAAAGGTACCACTCTGGTGGGGG - Intergenic
910978410 1:92932974-92932996 CATATGTACCACTCTGGTGAGGG + Intronic
911028662 1:93462387-93462409 CAAATGTACCATACTAATGTAGG - Intronic
911426591 1:97722441-97722463 CAAATGTACCATACTAATGTAGG + Intronic
911774551 1:101791723-101791745 CATATGAAGCACTCTGATGCAGG + Intergenic
911813739 1:102315809-102315831 CAAATGTACCACTCTTGTGAGGG + Intergenic
912010911 1:104961182-104961204 CAGTTGTACCACTCTGGTGGAGG + Intergenic
912367578 1:109147652-109147674 CGAATGTACCACTCTGGTGGGGG + Intronic
912677329 1:111695964-111695986 CAAATGTACCACTCTGGTGCAGG + Intronic
913092691 1:115490283-115490305 CAAATGTACCACTCTGATGTGGG + Intergenic
913236978 1:116793683-116793705 CGAATGTACCACTCTGGTGGGGG - Intergenic
914993990 1:152524305-152524327 CAAATGTACCACTCTGGTGGGGG - Intronic
915941134 1:160119077-160119099 CAAATGTAACACTCTGATGCAGG + Intronic
915982785 1:160431919-160431941 CAAATGTACCACTCTGGTGGGGG + Intergenic
916332993 1:163639105-163639127 CAAATGCACCACTCTGGTGGGGG - Intergenic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
917616360 1:176749395-176749417 CAAATGTACCACTCTGGTGGGGG - Intronic
918241778 1:182626623-182626645 CAAATGTACCCCTCTGCTGGGGG - Intergenic
918523143 1:185436863-185436885 AATGCATACCACTCTAATGGGGG + Intergenic
918534823 1:185562242-185562264 CAACTGTACCACTCTGGTGGGGG + Intergenic
918557614 1:185822248-185822270 CAAATGTACCACTCTGGTGGGGG + Intronic
918646539 1:186912259-186912281 CAAATGTACCACTCTGGTGTGGG - Intronic
918950992 1:191137286-191137308 CAAATGTAACACTCTGGTGGGGG + Intergenic
919462908 1:197900260-197900282 TTTATGTACCACTCTAAGGTGGG + Intergenic
919633473 1:199981633-199981655 CAAATGTACCACTCTGGTGGGGG - Intergenic
920507748 1:206528601-206528623 CAAATGTACCACTCTGGTGGGGG + Intronic
920805111 1:209225852-209225874 CAAATTTACCACTCTAGTTGGGG + Intergenic
921243520 1:213212030-213212052 TAAATGTACCACTCTGGTGGGGG - Intronic
921289507 1:213644319-213644341 CAAATGTACCTCTCTGGTGGGGG - Intergenic
921327681 1:214003443-214003465 CTTCTGTATCAGTCTAATGGAGG + Intronic
921356925 1:214293639-214293661 TATATTTACCACTCTCATGTAGG + Intronic
921582495 1:216911635-216911657 CAAATGTACCACTCTGGTAGGGG + Intronic
921802620 1:219418592-219418614 CAAATGTACTACTCTGGTGGAGG - Intergenic
921826637 1:219679349-219679371 CAAATGTACCACTCTGGTAGGGG + Intergenic
922055221 1:222036218-222036240 CAAATGCACCATTCTCATGGAGG + Intergenic
923022902 1:230178718-230178740 CAAATGTACCACTCTGTTGGGGG - Intronic
923252377 1:232189531-232189553 CAAATGGACCACTCTGGTGGAGG + Intergenic
923417027 1:233772959-233772981 CAAATGTACCATTCTGGTGGGGG - Intergenic
923940756 1:238823114-238823136 CAAATGTATCACTCTAGTGGGGG + Intergenic
1063104616 10:2982085-2982107 CAAATGGACCGCTCTAGTGGGGG + Intergenic
1063631050 10:7734246-7734268 CAAATGCACCACTCTGATGTGGG + Intronic
1064667514 10:17671197-17671219 CATATGTACGTCTATATTGGAGG - Intronic
1065828550 10:29594458-29594480 CGTATGTACCACTCTAGTGGGGG + Intronic
1066626759 10:37415078-37415100 CAAATGCACCACTCTGGTGGGGG + Intergenic
1067865769 10:49904506-49904528 CAAATGAACCACTCTGGTGGGGG + Intronic
1067978866 10:51058481-51058503 CAAATGTACTACTCTGATAGTGG - Intronic
1068295270 10:55062779-55062801 CATATGTACCACTCTAGTGGAGG + Intronic
1068496387 10:57789592-57789614 ATTAAGTACCACTCTAATTGGGG - Intergenic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1070204299 10:74241325-74241347 CAAATGTACCACTCTGGTGGGGG - Intronic
1071046998 10:81392239-81392261 CGAATGTACCACCCTAATGGTGG - Intergenic
1072201134 10:93159854-93159876 AAAATGTACCTCTCTAGTGGGGG + Intergenic
1072528122 10:96292757-96292779 CAAATGTACCACTCTGGTGGGGG - Intergenic
1072942264 10:99776731-99776753 CAAATGTACCACTCTGGTGGGGG - Intergenic
1073638515 10:105224035-105224057 CAAATGTAACACTCTGGTGGAGG - Intronic
1073723926 10:106207984-106208006 CAAATGTACCACTCTCATGGGGG - Intergenic
1073781004 10:106838384-106838406 CAAATGTAACACTCTGAAGGAGG - Intronic
1074522956 10:114241170-114241192 CAAATGTACCACTGCAGTGGGGG - Intronic
1074557143 10:114501786-114501808 CAAATGCACCACTCTGTTGGGGG - Intronic
1074821258 10:117180599-117180621 CAAATGTACCACTCAAGTGTGGG - Intergenic
1075896974 10:126004872-126004894 CATATGTTGCAGTCTAATGCTGG + Exonic
1080338253 11:31224887-31224909 GAGATGTACCACTCTGCTGGTGG + Intronic
1080631649 11:34082604-34082626 CAAATGTACCACTCTGGTTGGGG - Intronic
1081261896 11:40971557-40971579 CATCTGTGCTACTCTAATAGAGG - Intronic
1081459538 11:43259203-43259225 CAAACGTACCACTCTAGTTGGGG + Intergenic
1083073629 11:60014045-60014067 CATATTTACCACTCTGTTTGGGG - Intergenic
1083093849 11:60229075-60229097 CAAATGTCCCACTCTGGTGGGGG + Intronic
1084406577 11:68977693-68977715 CAGATGTACAACTCTAAATGGGG - Intergenic
1084924200 11:72498854-72498876 CAAATGTACCACTCTGGTGGGGG - Intergenic
1084991261 11:72927430-72927452 CAAATGTGCCACTCTGATGGGGG + Intronic
1085113672 11:73911078-73911100 TAAATGTACCACTCTGGTGGGGG - Intronic
1085162155 11:74358201-74358223 CATATGTACCACTCTAATGGGGG + Intronic
1085918941 11:80928138-80928160 CATATGTACAACCTTTATGGGGG + Intergenic
1085938376 11:81178316-81178338 CAGATGTACCACTCTGGTAGGGG - Intergenic
1086066738 11:82753670-82753692 CAAATGCACCACTCTGGTGGGGG + Intergenic
1086361317 11:86062595-86062617 CAAATGTACCACTTTCGTGGGGG + Intronic
1087073132 11:94101554-94101576 CAAATGTACTACTCTGGTGGGGG - Intronic
1087097654 11:94335127-94335149 CAAATGTATCACTCTGGTGGGGG - Intergenic
1087173628 11:95075850-95075872 CAAATGCACCACTCTGGTGGAGG - Intergenic
1087450703 11:98318733-98318755 TATATGTACCCAACTAATGGTGG - Intergenic
1087987558 11:104703479-104703501 CAAATGGACCACTCTGGTGGGGG - Intergenic
1088704121 11:112446244-112446266 CAAATGTACCACTCTGGTGAGGG - Intergenic
1088929752 11:114339795-114339817 CAAATGCACCACTCTGGTGGGGG + Intergenic
1089394628 11:118128292-118128314 CCCATGTACCACTCTGGTGGGGG - Intergenic
1089438978 11:118498675-118498697 CAAATGCACCACTCTGGTGGGGG - Intronic
1090921730 11:131212485-131212507 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1091464613 12:673099-673121 CAAATGTACCACTCTGGTGTGGG - Intergenic
1093262426 12:16955391-16955413 CAAATGTACCACTTTGTTGGAGG + Intergenic
1094091055 12:26650484-26650506 TAAATGTACCCCTCTAGTGGAGG + Intronic
1095070203 12:37833441-37833463 CATATGTTCAACTCTGTTGGAGG - Intergenic
1095522000 12:43077663-43077685 CAAATGTACCACTCTGGTGGGGG + Intergenic
1095825737 12:46529583-46529605 CAAATGTACCACTCTGCTGGGGG + Intergenic
1095862464 12:46933292-46933314 CAAATGTACCACCCTGGTGGGGG + Intergenic
1096307211 12:50488224-50488246 TAAATGTACCACTCTGCTGGAGG + Intergenic
1096564344 12:52464947-52464969 CAAATGTACCACTCTGGTGGGGG + Intergenic
1097765242 12:63518866-63518888 CAAATGTTCCACTCTGATGTGGG - Intergenic
1097912389 12:64984456-64984478 CAAATGTACCTCTCTGGTGGGGG + Intergenic
1097925865 12:65125596-65125618 CAAATGTACCATTCTAATATAGG + Intergenic
1098285284 12:68900995-68901017 CAAATGTACCACTCTGGTGGGGG + Intronic
1098656398 12:73035708-73035730 CAAATGTACCACTCTAGTGGAGG - Intergenic
1099017315 12:77359365-77359387 GAAATGTACCACTCTGGTGGAGG - Intergenic
1099242398 12:80153500-80153522 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1099560047 12:84161426-84161448 CATATGTACCAATGTACTGGAGG - Intergenic
1100076430 12:90790168-90790190 CAGATGTACCACTCTGGTGGGGG + Intergenic
1100082819 12:90873983-90874005 CAAATGTACCACTCTGGTGGGGG + Intergenic
1100610950 12:96192161-96192183 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1101002043 12:100366432-100366454 TATAAGCCCCACTCTAATGGAGG + Intronic
1101279001 12:103231256-103231278 TAAATGTACCACTCTGGTGGGGG - Intergenic
1102480034 12:113216578-113216600 CAAATGCACCACTCTGGTGGGGG + Intronic
1103115737 12:118329564-118329586 CATATGTCCCATACTTATGGGGG + Intronic
1103295557 12:119883614-119883636 CAAATGTACCACCCTGGTGGAGG - Intergenic
1103364808 12:120374093-120374115 CAAATGTACCACTCTGGTGGGGG - Intergenic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1105654259 13:22418465-22418487 CAAATGTACCACTCTGATGGAGG + Intergenic
1106970156 13:35130105-35130127 CAAATGTACCACTCTGGTGAGGG + Intronic
1107961153 13:45560412-45560434 CAAATGTACCACTCTCAGGTGGG - Intronic
1108243226 13:48488595-48488617 CAAATGCACCACTCTGGTGGGGG + Intergenic
1108316124 13:49239335-49239357 CAAATGCACCACTCTGGTGGGGG + Intergenic
1108457164 13:50628034-50628056 CAAATGTACCACCCTCGTGGGGG + Intronic
1108552798 13:51563437-51563459 CAAATGTACCACTGTGGTGGGGG + Intergenic
1108910225 13:55540640-55540662 CAAATGCAGCACTCTTATGGGGG - Intergenic
1110314527 13:74090403-74090425 CATATGTACCACTCTGATATGGG - Intronic
1110314624 13:74091856-74091878 CATATGTACCACTCTGATAGGGG + Intronic
1110782284 13:79480702-79480724 CACATGTACCACTCTGAGGGGGG + Intergenic
1110956918 13:81564428-81564450 CACACGTACCACTCTCATGGGGG - Intergenic
1111386467 13:87535358-87535380 CAAATGTACTACTCTGGTGGAGG + Intergenic
1111599963 13:90460401-90460423 CAACTGTACCACTCTGGTGGGGG - Intergenic
1112085784 13:96031090-96031112 TATATGTACCACACTAGTGAGGG + Intronic
1112188214 13:97148501-97148523 CAAATGTACCAGTCTTTTGGGGG + Intergenic
1112407013 13:99130198-99130220 CAAATGTACCACTCTGGTAGGGG + Intergenic
1112681426 13:101769999-101770021 CAAATGCACCACTCTGGTGGGGG + Intronic
1112833330 13:103480219-103480241 TAAATGTACCACTCTGGTGGGGG + Intergenic
1112959741 13:105108841-105108863 CAAATGTACCACTTTGGTGGAGG - Intergenic
1113183651 13:107660817-107660839 CAAATGGACCACTCTGATGAGGG + Intronic
1113237593 13:108297764-108297786 CAAATGTATCACTCTGGTGGGGG - Intronic
1114358604 14:21943513-21943535 CAAATGTACCACTCTGGTGGTGG - Intergenic
1114752177 14:25217387-25217409 CATATGTACCACTCTGTTGGGGG + Intergenic
1114764833 14:25359106-25359128 CAAATGTACCACTCTGGTGGAGG - Intergenic
1114920557 14:27322560-27322582 CAAATCTACCACTCTGGTGGTGG - Intergenic
1115093856 14:29611188-29611210 CAAATGTACCACTGTGGTGGGGG + Intronic
1115733023 14:36292474-36292496 CACATGTACCACTCTGATGAGGG - Intergenic
1115833944 14:37376136-37376158 CAAATGTACCACTCTGGTGCAGG - Intronic
1116093174 14:40334718-40334740 CAAATGTACCACTCTAACTGGGG + Intergenic
1117226372 14:53664511-53664533 CAAATATACCACTCTGCTGGGGG + Intergenic
1117417484 14:55510562-55510584 CAAATGTACCACTCTGGTGATGG - Intergenic
1117505155 14:56394822-56394844 CCATTGTACCACTCTAGTGGGGG + Intergenic
1117801910 14:59453273-59453295 CAAATGTACCTCTCTGGTGGGGG + Intronic
1117943727 14:60996070-60996092 CAAATGTACCACTCTGGTGCAGG + Intronic
1118066165 14:62193078-62193100 CAAATGCACCACTCTGCTGGGGG - Intergenic
1118131722 14:62973050-62973072 CAGATGTACCACTCTGGTGTGGG + Intronic
1118177854 14:63460442-63460464 TATATGTACAACTCTAATGGGGG - Intronic
1118717017 14:68567432-68567454 CAAATGTACCACTCTGGTGTGGG - Intronic
1118749189 14:68794270-68794292 CATATGTTCCACTCCGGTGGGGG - Intronic
1119028948 14:71176434-71176456 CATATGTACCAGTCTGGTGGGGG - Intergenic
1119197737 14:72729964-72729986 CAAATGCACCACTCTAGTGGAGG + Intronic
1119303439 14:73589036-73589058 CAAATGTACCATTCTGGTGGGGG - Intergenic
1120554639 14:85914622-85914644 CAAGTGTACCACTCTGATGGGGG - Intergenic
1120658499 14:87224810-87224832 CAAATGTACCACCCTGGTGGGGG + Intergenic
1120837513 14:89054744-89054766 CAAATGTACCACTCTGGCGGGGG + Intergenic
1120952568 14:90055630-90055652 CAAATGTACCGCTCTGTTGGGGG + Intergenic
1121811732 14:96897385-96897407 CAAATGCACCACTCTGATAGGGG + Intronic
1124122472 15:26900652-26900674 CATATGTGCCACTCTGGTTGGGG - Intronic
1124166602 15:27331751-27331773 CAAATGGACCACTCTGGTGGGGG + Intronic
1124228612 15:27919821-27919843 CAACTGTACCACTGTGATGGAGG + Intronic
1124402802 15:29364868-29364890 CAAATGCACCACTCTGCTGGCGG - Intronic
1124530997 15:30506429-30506451 CAAATGTACCACTCTGGTGTGGG + Intergenic
1124767658 15:32501266-32501288 CAAATGTACCACTCTGGTGTGGG - Intergenic
1124787131 15:32692037-32692059 GATATGTCCCACACTGATGGGGG - Intronic
1125119913 15:36143537-36143559 CAAATGTACCACTCTGATATGGG + Intergenic
1125242306 15:37589381-37589403 CATATGTACCACTCTGATGCAGG - Intergenic
1125278519 15:38019580-38019602 ATAATGTACCACTCTAGTGGGGG - Intergenic
1126419192 15:48453694-48453716 CAAATGCACCACTCTGATGGAGG + Intronic
1126596258 15:50386984-50387006 CAAATGTACCGCTCTGGTGGGGG + Intergenic
1126632734 15:50754223-50754245 CAAATGTACCACTCTGCTGTGGG - Intronic
1127163115 15:56212545-56212567 CAACTGTACCACTCTAATGTAGG + Intronic
1127183972 15:56458400-56458422 CAAATGTACCAGTCTAATGGAGG - Intronic
1127641742 15:60922360-60922382 CAAATGTGCCACTCTGGTGGGGG + Intronic
1128023177 15:64411351-64411373 CAAATGTACCACTCTGGTGAGGG + Intronic
1128392650 15:67193051-67193073 CCTATGTAGCACTCTAAGGTGGG - Exonic
1128546119 15:68569088-68569110 CAAATGTACCACTTTGGTGGGGG - Intergenic
1128934612 15:71734686-71734708 CACATGTACCAGTCTGATGTGGG + Intronic
1129047986 15:72753954-72753976 CAAATGTACCACTCTGGTGCAGG + Intronic
1129094203 15:73185322-73185344 TAAATGTACCACTTTAGTGGGGG + Intronic
1130194657 15:81768161-81768183 CAAATGTACCATTCTGGTGGGGG + Intergenic
1130449838 15:84040275-84040297 CAAATGTACCATTCTGGTGGGGG - Intergenic
1131715084 15:95100680-95100702 CAAGTGTACCACTCCAGTGGAGG + Intergenic
1131790270 15:95957245-95957267 CAAATGTACCACTCTGATGAGGG + Intergenic
1134671863 16:16061635-16061657 CGTCTGTATCACTGTAATGGTGG + Intronic
1135529013 16:23236633-23236655 CTAATGTACCACTCTGGTGGGGG + Intergenic
1135778213 16:25275775-25275797 CAACTGTACCACTCTGGTGGGGG + Intergenic
1137238642 16:46636253-46636275 CAAATGTATCACTCTGGTGGGGG + Intergenic
1137575299 16:49595493-49595515 CATATTTAGCACTCAACTGGAGG + Intronic
1137692621 16:50440145-50440167 CAAATGTACCACTCTGGTGGGGG + Intergenic
1138398412 16:56725839-56725861 GAAATGTACCACTCTGGTGGGGG - Intronic
1138671912 16:58622316-58622338 AAAATGTACCACTCTAGTGGGGG + Intronic
1138897130 16:61220472-61220494 CAATTGTACCACTCTTGTGGGGG + Intergenic
1138978528 16:62238527-62238549 CAAATGTACCACTTTGATGAGGG + Intergenic
1139837480 16:69850912-69850934 CAAATGTACCACTCTGGTGGGGG - Intronic
1141284272 16:82656526-82656548 CAAATGTACCATTCTGATGTGGG - Intronic
1141336489 16:83160229-83160251 CAAATGTACCACTCTGGTGGGGG + Intronic
1144245295 17:13356805-13356827 CAAATGTACCACCCTGGTGGAGG - Intergenic
1145408540 17:22633551-22633573 CAGTTGTACCACTCTAGGGGAGG - Intergenic
1146281349 17:31546802-31546824 CAGATGTACCACTCTAGTGGAGG - Intergenic
1147506510 17:41023002-41023024 AAAATGTATCACTCTAGTGGGGG - Intergenic
1147897947 17:43763719-43763741 CAAATGCACCACTCTGGTGGCGG - Intergenic
1148034468 17:44648465-44648487 CATATGTACCATTCTAGTGCAGG + Intergenic
1148222663 17:45874901-45874923 GAAATGTACCACTCTGGTGGGGG - Intergenic
1148387791 17:47247394-47247416 CAAATGTACCACTCTGGTGGGGG + Intergenic
1148761397 17:50003545-50003567 CAAATGTATCACACTAATGTAGG + Intergenic
1149314286 17:55423670-55423692 CAGATGTACCACACTGTTGGGGG + Intergenic
1150543117 17:66124072-66124094 CACATGTACCACTCAAGGGGTGG + Intronic
1151080059 17:71319050-71319072 CAAATGTTCCACTCTGATGGAGG - Intergenic
1151516038 17:74596532-74596554 CAGATGTCCCACTCTGGTGGGGG - Intergenic
1151867477 17:76813735-76813757 TCTATGTGCCACTATAATGGTGG - Intergenic
1152383955 17:79957733-79957755 CATGTGTCCCACTCTGGTGGGGG + Intronic
1153169470 18:2299286-2299308 CAGATGTACCACTCTGGTGAGGG + Intergenic
1155383014 18:25245372-25245394 CAAATGTACCATTCTGGTGGGGG - Intronic
1155630199 18:27884105-27884127 CAAATATACCACTCTAGTGTGGG + Intergenic
1155641438 18:28020853-28020875 CAAATATACCACACTAATGCAGG + Intronic
1155764413 18:29609634-29609656 CAAATGTACCACTCTGATGGAGG - Intergenic
1156248555 18:35328227-35328249 CAAATATACCACTCTGGTGGGGG - Intergenic
1157037756 18:43996628-43996650 CAAATGTTCCACTCTAATGCAGG + Intergenic
1158937333 18:62376560-62376582 CAAATGTACCACTCTAGTGGGGG - Intronic
1159146829 18:64465426-64465448 CAAATGTACCACTCTGGTAGAGG - Intergenic
1159373102 18:67554916-67554938 CAAATATACCACTCTGATGTGGG - Intergenic
1159608283 18:70498011-70498033 CACATGTACCACTCTGCTGGTGG - Intergenic
1162075298 19:8182775-8182797 CCAATGCACCACTCTAGTGGCGG + Intronic
1162234891 19:9300986-9301008 CAAATTTACCACTCTGGTGGGGG + Intronic
1165613918 19:37182028-37182050 CAAATGTACCACTCTGAAGGGGG + Exonic
1165618750 19:37226304-37226326 TAAATGTACCACTCTGGTGGAGG - Intronic
1165877169 19:39016319-39016341 AACATGTACCACTCTGGTGGGGG + Intronic
1167189681 19:47976068-47976090 CAAATGTTCCACTCTGGTGGAGG - Intronic
1167728301 19:51234231-51234253 CAAATGTACCACTCTGATGGGGG - Intronic
1167977384 19:53240877-53240899 CAAATGTACCACTGTGATGGGGG + Intronic
925109819 2:1323971-1323993 CCTATGTACCAGCCTACTGGGGG - Intronic
925562984 2:5218285-5218307 CAAATGTACCACTCCAGTGCAGG - Intergenic
926053608 2:9760591-9760613 CAAATGTACAACTCTGGTGGGGG - Intergenic
926780868 2:16470751-16470773 TAAATGTACCACTCTGGTGGGGG + Intergenic
926900276 2:17743540-17743562 CACATGTACCACGCTGATAGTGG - Intronic
927259572 2:21073702-21073724 CAAATATACCACACTAATAGGGG - Intergenic
930177874 2:48318162-48318184 CAAATGTACCATTGTAATGTAGG - Intronic
930241764 2:48942849-48942871 CACATGTGCCACTCTGGTGGGGG - Intergenic
930331697 2:49993587-49993609 CAAATGCACTACTCTAGTGGAGG + Intronic
931900790 2:66785656-66785678 CAAATGTACCACTCTGGTGGTGG + Intergenic
932470725 2:71953621-71953643 CAAATGTACCGCTCTGTTGGGGG - Intergenic
933493136 2:83014123-83014145 TAAATGTACCACTCTGATGGAGG + Intergenic
933587154 2:84191651-84191673 CAGATGTGCCACACTAATGCAGG - Intergenic
933864561 2:86504292-86504314 CAAATGTACCACTCTGGTGTGGG + Exonic
933865562 2:86513542-86513564 CAAATGTACCACTCTTGTGTGGG + Intronic
934063024 2:88313874-88313896 CAAATGTACCATACTAATGTAGG + Intergenic
935257647 2:101326478-101326500 CAAATGTTCCACTCTGGTGGGGG + Intergenic
935853644 2:107250045-107250067 CAAATGTGCCACTCTGGTGGTGG - Intergenic
936238238 2:110764689-110764711 CAAATATACCACTCTGGTGGGGG + Intronic
936919408 2:117672193-117672215 CAAATGTACCACTCTGGTGGGGG + Intergenic
937598069 2:123694225-123694247 CAATTGTACCACTCTAGTGGGGG + Intergenic
939066599 2:137490568-137490590 AAAATGTAGCACTCTGATGGGGG - Intronic
939664375 2:144932671-144932693 CAAATGTACCACTCTGGTGGGGG - Intergenic
939857845 2:147382014-147382036 CAAATGTACCACTCTGGTGTGGG + Intergenic
941270766 2:163424972-163424994 CAAATGTACCATACTAATGTAGG + Intergenic
941816675 2:169802793-169802815 GAAATGTACCACTCTGGTGGGGG - Intronic
941837006 2:170034129-170034151 CAAATGTACCACACTGGTGGTGG - Intronic
942530884 2:176909110-176909132 CAGATGTACCCCTCTGATGGGGG + Intergenic
942761716 2:179406590-179406612 CAAAAGTACCACTCTGGTGGGGG - Intergenic
942819442 2:180094299-180094321 AATATGTACCACACTGTTGGTGG + Intergenic
943089075 2:183352619-183352641 CAAATGCACCACTCTGGTGGGGG + Intergenic
943329014 2:186536686-186536708 CATATGTACCACTCTGGTGCAGG - Intergenic
943902903 2:193464256-193464278 CATGTGTACCCCTCTAAGAGAGG + Intergenic
944461268 2:199953375-199953397 CAAATATACCACTCTAATGAGGG + Intronic
944482689 2:200174277-200174299 CAAATGTGCCACTCTGGTGGGGG - Intergenic
944870350 2:203904858-203904880 CAAATGTACCCCTCTGGTGGGGG - Intergenic
945061971 2:205917092-205917114 CAAATGTACCACTCTCATGGGGG + Intergenic
946671743 2:222112118-222112140 CAAATGTACAACTCTGGTGGAGG + Intergenic
946902002 2:224381726-224381748 CACATGTACCACTCTGATAAAGG + Intronic
947039285 2:225896824-225896846 CAGATGTACCACTCTACAAGGGG + Intergenic
1168867369 20:1099173-1099195 CAAATGTACCACTCTGGTGTGGG + Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1169292756 20:4366658-4366680 CAAATGTACCACTCTGGTAGGGG - Intergenic
1169326845 20:4683561-4683583 CTTATGAACCACTCCAAGGGTGG - Intergenic
1169833957 20:9856804-9856826 CAAATGTACCACTCTGGTGAGGG + Intergenic
1170417036 20:16155656-16155678 CAAATGTACCACTCTAGTGGAGG + Intergenic
1170689175 20:18596863-18596885 CAAATGCACCACTCTAGTGGTGG - Intronic
1171384518 20:24761137-24761159 CAAATGTATCACTCTAGTGTGGG + Intergenic
1172580124 20:36040836-36040858 CAAATGTACCACTCTGGTCGCGG + Intergenic
1172616365 20:36288096-36288118 CGAATGTACCACTCTGGTGGTGG - Intergenic
1173522638 20:43711088-43711110 CCTTTGTTCCACACTAATGGGGG - Intronic
1176903621 21:14473832-14473854 TTTATGTAGCACTCAAATGGGGG + Intergenic
1177001118 21:15614474-15614496 CAAATGTACCACTCTCATGGGGG + Intergenic
1177349654 21:19920580-19920602 CACATGTACCACTCTGATAGAGG + Intergenic
1177484458 21:21738919-21738941 CAAATATACCACTCTAGTGGGGG + Intergenic
1178036865 21:28594382-28594404 CAAATGTACCAAACTAATGTAGG + Intergenic
1178101702 21:29275875-29275897 CAAATGTACCACTCTGGTAGGGG - Intronic
1178381153 21:32110021-32110043 CAAATGTACTACTCTGATGGGGG + Intergenic
1178861054 21:36290090-36290112 CAAATGTACCACTCTGGTGCAGG + Intronic
1179300486 21:40104741-40104763 CAAATGCACCACTTTATTGGGGG + Intronic
1179348431 21:40583768-40583790 CAAATGTACCACTCTTGCGGGGG + Intronic
1182673877 22:32021945-32021967 CAAAGGTACCACGCTAATGTTGG + Intergenic
1183818274 22:40322316-40322338 CAAATGCACCACTCTGGTGGAGG - Intronic
949899998 3:8804867-8804889 CAAATGCACCACTCTGGTGGGGG + Intronic
951244802 3:20328290-20328312 TAAATGTACCACTCTGGTGGGGG - Intergenic
951348212 3:21572385-21572407 CATATTTACCAATTAAATGGTGG + Intronic
951361615 3:21731451-21731473 CAAATGTACCACTGTGGTGGAGG - Intronic
951367215 3:21798071-21798093 CAAATGTACCTCTCTGGTGGGGG + Intronic
951905149 3:27698924-27698946 CAAATGTACCACTGTGGTGGGGG + Intergenic
952635027 3:35518823-35518845 TAAATGTACCACTCTGGTGGGGG - Intergenic
952779582 3:37082471-37082493 GAAATGTACCACTCTATTGTGGG - Intronic
952893265 3:38058766-38058788 CAAATGTATCTCTCTAGTGGGGG + Intronic
952917277 3:38256483-38256505 CAAATGTACTACTCTAGTGGGGG - Intergenic
953753389 3:45626773-45626795 CAAGTGTACCACTCTGGTGGGGG + Intronic
953779817 3:45857831-45857853 CACATGTACCATTCTGGTGGGGG - Intronic
953782003 3:45879695-45879717 CAAATGTGCCACTCTGATGCAGG + Intronic
954489114 3:50884839-50884861 CAAATGTTCCACACTAATGCAGG - Intronic
954555236 3:51512489-51512511 CAAATGTACCACTCTGTTGTAGG + Intergenic
955169780 3:56551926-56551948 CAAATGTACTACTCTAGTCGGGG - Intergenic
955479350 3:59373798-59373820 CAAATGTACCACTCTGGTGGGGG + Intergenic
955528960 3:59852477-59852499 CAAATGTACCAGTCTGGTGGGGG - Intronic
955677966 3:61469225-61469247 CAAATGTACCACTCTAGTGCAGG - Intergenic
955930513 3:64051822-64051844 CATATGTACCATACTAATGTAGG + Intergenic
957005423 3:74940209-74940231 CAAATGTACCACTCTGATGTGGG + Intergenic
957628211 3:82682283-82682305 AAAATGTACCACTCTGATGCGGG - Intergenic
957664895 3:83215291-83215313 CAAATGCACCACTCTGGTGGGGG + Intergenic
957901762 3:86503353-86503375 TACATGTACCACTCTAATGGAGG - Intergenic
958146136 3:89628106-89628128 CAAATGTACCATTCTGGTGGGGG + Intergenic
958533603 3:95366585-95366607 CAAATGTACCACTCTGTTGGGGG - Intergenic
959112388 3:102137245-102137267 CATATGTACCACTCTGGTGTGGG - Intronic
959485124 3:106919847-106919869 CAAATGTACCACTTTGGTGGGGG + Intergenic
959771152 3:110098237-110098259 CAAATGTGCCACTCTGGTGGGGG - Intergenic
959778018 3:110192579-110192601 CAAATGTACCACTCTGGTAGGGG - Intergenic
960438154 3:117653060-117653082 CAAATGTACCACTTTGATGGTGG + Intergenic
962658768 3:137579197-137579219 CAAGTGTACCACTCTACTGAGGG + Intergenic
962718142 3:138146060-138146082 CAAATGTACTACTCTGGTGGAGG + Intergenic
963015183 3:140817217-140817239 CAAATATACCACTCTGGTGGGGG + Intergenic
963292615 3:143507529-143507551 CAAATGCACAACTCTAATGAGGG - Intronic
963824943 3:149943350-149943372 CAGATGGACCACTCTAGTGCAGG - Intronic
963824956 3:149943475-149943497 CAGATGTACCACTCTGGTGCAGG - Intronic
964205583 3:154171316-154171338 CAAATGTACCATTCTGATGTGGG - Intronic
965029494 3:163346497-163346519 CAAATGTACCACTCTGGTGTAGG + Intergenic
965181689 3:165412147-165412169 CAAATGTACCACTCTGATGTGGG + Intergenic
965426367 3:168528930-168528952 AAAATGTACCACTCTGGTGGAGG - Intergenic
965641524 3:170833760-170833782 CAAATGTACCACTCTGGTGGGGG - Intronic
965826368 3:172734980-172735002 TATATGTACCACTCTTTTAGGGG - Intergenic
966249394 3:177846151-177846173 CAAATGCACCACTCTGGTGGGGG + Intergenic
966497554 3:180598487-180598509 CAAATGTACCACTCAGGTGGGGG + Intergenic
967110910 3:186293074-186293096 CAAATGTACCACTCTGGTGGGGG - Intronic
968044420 3:195616051-195616073 CAAATGTGCCACTCTGGTGGGGG - Intergenic
968060209 3:195722102-195722124 CAAATGTGCCACTCTGGTGGGGG - Intronic
968227351 3:196981873-196981895 CAAATGTACCACTCTGGTGCAGG + Intergenic
970689364 4:18604400-18604422 CAAATGCACCATTCTGATGGGGG - Intergenic
970762388 4:19506687-19506709 CAAATGCACCACTCTGTTGGGGG - Intergenic
971639701 4:29116656-29116678 CAAATTTACCACTCTGGTGGGGG - Intergenic
971904668 4:32711002-32711024 CAAATGTACCAGTCTGGTGGGGG - Intergenic
971991723 4:33906739-33906761 CAAATGTACCACTCCGGTGGAGG + Intergenic
972332078 4:38073366-38073388 CATATTTACCACTCCAAAGGAGG - Intronic
972807263 4:42542067-42542089 CAAATGTACCACTCTGGTGGGGG + Intronic
973302086 4:48597450-48597472 CAAATGTATCACTCTGAAGGGGG + Intronic
974071731 4:57130149-57130171 CAAATGTACCACTTTGCTGGGGG - Intergenic
974365467 4:60942959-60942981 CATATGGTTGACTCTAATGGAGG + Intergenic
974394020 4:61311931-61311953 CAAATGTACCACTCTCATGTGGG + Intronic
974854967 4:67450295-67450317 CAAATGTACCACTCTCTTGGGGG + Intergenic
975666134 4:76736873-76736895 CAAATGTACTACTCTGGTGGGGG - Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976133406 4:81908994-81909016 CAAATGTACCACTCTGGTGCAGG + Intronic
976172646 4:82319937-82319959 CAAATGTACCATTCTAGTGCAGG + Intergenic
976818701 4:89180254-89180276 CAAATGTACCACTCTGGTGTGGG - Intergenic
977003835 4:91540183-91540205 CAAATGTACCACTGTGATGTGGG - Intronic
977763358 4:100767130-100767152 CAAATGTACCACTCTGGTGAAGG + Intronic
977940859 4:102857091-102857113 CAAATGTACCACACTAATGCAGG + Intronic
978033012 4:103958987-103959009 CAAATGTACCACTGTGGTGGGGG + Intergenic
978207377 4:106093947-106093969 CAAATGTACCACTCTGATGGGGG + Intronic
978243662 4:106547395-106547417 CATAGGTACCACTCTGGTGTGGG + Intergenic
978399990 4:108321262-108321284 CAAATGTACCCCTCTGCTGGGGG + Intergenic
978686153 4:111445993-111446015 CAAATGTACCACTCTGATTAGGG + Intergenic
978893771 4:113860369-113860391 CATATGTACCACTCTGGTGCTGG - Intergenic
978920048 4:114173191-114173213 CAAATGTACCACTCTGTTGGGGG - Intergenic
979560652 4:122097789-122097811 CAAAGGTACCACTCTGGTGGAGG - Intergenic
979706674 4:123727884-123727906 CAAATGTACCACTCTGGTGCAGG - Intergenic
979830373 4:125293209-125293231 CAAATTTACCACTCTGGTGGAGG + Intergenic
979991243 4:127378337-127378359 CAAATGTACCACTCTGGTGGGGG - Intergenic
980532322 4:134071331-134071353 CTTATGTACCAGTCTCTTGGTGG + Intergenic
980600029 4:135010943-135010965 CAAATGTACCACTCTGGTGGGGG - Intergenic
980748883 4:137061875-137061897 AAAAAGTACCACTCTGATGGGGG + Intergenic
981486397 4:145291121-145291143 CAAATGTACCACTCTGGTGTGGG - Intergenic
981509850 4:145544147-145544169 CAAATGTGCCACTCTGGTGGGGG + Intronic
981523063 4:145684643-145684665 CAAATGTACCACTGTGGTGGGGG + Intronic
981932184 4:150202022-150202044 CAAATGCAGCACTCTAATTGGGG - Intronic
982125640 4:152181711-152181733 CAAATGTGCCACTCCAGTGGGGG - Intergenic
982491247 4:156032148-156032170 CAGATGTACCACTCTGGTAGAGG - Intergenic
983110709 4:163745966-163745988 CAAATGTACCACTCTGGTGGGGG - Intronic
983580456 4:169304674-169304696 CAGATGTACCACTCTGTTGAAGG + Intergenic
984027723 4:174564554-174564576 CAAATGTATCACTCTAGTGTAGG - Intergenic
984100126 4:175474313-175474335 CAAATGTACCACTCTGGTGGGGG + Intergenic
984114640 4:175664380-175664402 CAAATGTACCACTCTGGTGAGGG + Intronic
985308093 4:188565759-188565781 CACATTTACCACTCTTGTGGGGG - Intergenic
987808359 5:22800505-22800527 CAAATGTACCACTCTTTTTGGGG - Intronic
987934697 5:24449188-24449210 CAAATGTACCACTCTGGTGTGGG - Intergenic
988372938 5:30395928-30395950 CAAATGTATCACTCTGAGGGGGG - Intergenic
989154488 5:38331203-38331225 CAAATGTACCACTCTGATAGGGG - Intronic
989209108 5:38842655-38842677 CATATGTATAACTATTATGGAGG - Intergenic
989905816 5:47253121-47253143 CATTTGTACCACTCTTTTTGTGG + Intergenic
991149856 5:63355126-63355148 CAAATGTGCCACTCTGGTGGGGG - Intergenic
991338464 5:65577837-65577859 CAAATGGACCACTCTGGTGGGGG - Intronic
991699603 5:69304931-69304953 AAAATGTACCACTCTGGTGGGGG + Intronic
991724532 5:69523054-69523076 CAAATGCACCACACTAATGTAGG - Intronic
992315945 5:75555096-75555118 CAAATGTACCCCTCTGGTGGGGG - Intronic
992495009 5:77283291-77283313 CAAATGTACCACTCTGGTGGGGG - Intronic
994306890 5:98215725-98215747 CGTATGTGCCACTCTAGTGTGGG + Intergenic
994793627 5:104264732-104264754 CATATATACTACTTTGATGGGGG + Intergenic
994961931 5:106616171-106616193 CAAATGTACCATACTAATGTCGG + Intergenic
995466488 5:112454565-112454587 CAAATGTACCACTCTGGTGGGGG - Intergenic
995709091 5:115016499-115016521 CAAATGTCCCACTCTGGTGGGGG + Intergenic
995821351 5:116236855-116236877 CAAATGTACTACTCTGGTGGGGG + Intronic
995886055 5:116895102-116895124 CAAATGTACCACTGCAGTGGGGG - Intergenic
996026715 5:118654540-118654562 CAAATGTACCACTCCGGTGGGGG - Intergenic
996248872 5:121302137-121302159 CAAATGTACCACTCTGATAATGG + Intergenic
997871774 5:137512234-137512256 CAAATGTACCACTCTGGTAGGGG + Intronic
998187097 5:139988827-139988849 TGTATGTACCACTCTCGTGGGGG + Intronic
998259701 5:140620569-140620591 CAAATGTACTACTCTGGTGGGGG + Intergenic
998311115 5:141133336-141133358 CAAATGAACCACTCTGGTGGAGG + Intronic
998361883 5:141595358-141595380 CAAATGTACCACGCTAGTGGGGG + Intronic
998675084 5:144398278-144398300 CATATTTACCATTAAAATGGTGG + Intronic
999845439 5:155474464-155474486 CAAATCTACCACTCTTTTGGGGG - Intergenic
999846140 5:155482664-155482686 CAAATGTACCATTCTGGTGGTGG + Intergenic
1000224770 5:159249904-159249926 CAAACGTACCACTCCAATGGGGG - Intergenic
1001373719 5:171233928-171233950 CAAATGCACCACTCTAGTGGGGG + Intronic
1003237247 6:4306597-4306619 CAAATGTGCCACTCTGGTGGAGG - Intergenic
1003358374 6:5397486-5397508 CAAGTGTACCACTCTGGTGGAGG + Intronic
1003843157 6:10143538-10143560 CAAATGTGCCACTCTGGTGGGGG + Intronic
1004952010 6:20683666-20683688 CAAATGTACCATTCTGATGGGGG - Intronic
1005271008 6:24163668-24163690 CATATGTCCTACTGTAATAGAGG + Intergenic
1005823168 6:29614868-29614890 CAAATGTACCACTCTGGCGGAGG + Intronic
1006421575 6:33937466-33937488 CACATGTACCACTCTGGTGCAGG - Intergenic
1006873144 6:37271465-37271487 CAAATGTACCACTGTGGTGGCGG + Intronic
1006992629 6:38228451-38228473 CAAATGTACCACTCTGGTGGAGG + Intronic
1007830571 6:44635199-44635221 CAAATGTAGCACTCCAGTGGGGG - Intergenic
1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG + Intergenic
1009903011 6:69832051-69832073 CATATTTTCAACTTTAATGGTGG + Intergenic
1011169274 6:84487987-84488009 CAAATGTACCACTCTGATGGGGG + Intergenic
1011350508 6:86417915-86417937 CAAATGTACCACTTTGGTGGAGG - Intergenic
1011658295 6:89571720-89571742 CAAATGTATCACTCTGGTGGCGG - Intronic
1011880309 6:92015816-92015838 CAAATGTACTACTCTGGTGGGGG - Intergenic
1012328246 6:97951157-97951179 CAAATGTACCATTCTAGTGTGGG - Intergenic
1012385587 6:98678323-98678345 TAAATGTACCACTCTGGTGGGGG + Intergenic
1012418311 6:99034060-99034082 CAAATGTACCACTCTGGTGGGGG + Intergenic
1012686187 6:102252729-102252751 CAGATTAACCTCTCTAATGGGGG - Intergenic
1013306739 6:108854688-108854710 CCAATGTACCACTCTGGTGGGGG - Intronic
1013544637 6:111144025-111144047 CAAATGTACTACTCTGGTGGGGG + Intronic
1013566607 6:111370818-111370840 CACATGTACCACTCTGGTAGGGG - Intronic
1014156275 6:118113431-118113453 TAAATGTACCACTCTGGTGGTGG + Intronic
1014324287 6:119972529-119972551 CATATGTACCACTCTGGTGGTGG + Intergenic
1014333803 6:120105688-120105710 CAGGTGTATCACTCTGATGGAGG - Intergenic
1014404393 6:121031473-121031495 CATATGTACCTCACTAATGGAGG + Intergenic
1014701047 6:124688429-124688451 CAAATGTATCACTCTGGTGGAGG - Intronic
1014784784 6:125606562-125606584 CGAATGTGCCACTCTGATGGGGG + Intergenic
1015038436 6:128686579-128686601 CATATGTACCACTTTAATGAAGG + Intergenic
1015049475 6:128821884-128821906 CAAATGTACCATTCTAGTGAAGG + Intergenic
1015069787 6:129078048-129078070 CAAATGTACTACTCTACTGGGGG + Intronic
1015694200 6:135962033-135962055 CAAATGGACCACTCTGATGGGGG + Intronic
1015767456 6:136733746-136733768 AAAATGTACCACTCTGGTGGGGG - Intronic
1016101401 6:140105644-140105666 CAAATGTACCACTCTGGTGGGGG - Intergenic
1016125583 6:140398825-140398847 CACATGTCCCACTCTGGTGGGGG - Intergenic
1016222644 6:141693783-141693805 CAAATGTACCACTCTGGTGGGGG + Intergenic
1016430300 6:143977124-143977146 CAAATGTACCACTCTAGTGGGGG - Intronic
1016678456 6:146799669-146799691 TATATGTACCACTCTGGTAGGGG + Intronic
1017024662 6:150171049-150171071 CCAATGTACCGCTCCAATGGAGG - Intronic
1017478752 6:154827967-154827989 TATACGTACCACTCTGGTGGAGG - Intronic
1017828411 6:158100888-158100910 CAAATGTACCAGTCTGGTGGGGG - Intergenic
1018130434 6:160725985-160726007 GATATCTCCCACTCTAATTGTGG - Intronic
1020770364 7:12384539-12384561 CAAATGTAGCACTCTGGTGGGGG + Intronic
1020874974 7:13681799-13681821 GAAATGTACCACTCTGATGGGGG + Intergenic
1021029478 7:15712945-15712967 CAAACGTACCACTCTCATGCTGG - Intergenic
1021757759 7:23871184-23871206 AATATGTCACACTCTAATGGAGG + Intergenic
1022480059 7:30737179-30737201 CAAATGTACCACTCTGGTGGGGG - Intronic
1022658237 7:32341042-32341064 CACATGTACCACTCCAGTGGGGG + Intergenic
1022689097 7:32628402-32628424 CAAATGTACCACTCTGGTGCGGG + Intergenic
1022856571 7:34320842-34320864 TATATGTCTCACTATAATGGAGG - Intergenic
1022916675 7:34962803-34962825 CAAATGTACCACTCTGGTGCGGG + Intronic
1023379430 7:39591629-39591651 CATATGTACCAATCCGGTGGTGG - Intronic
1023642853 7:42278252-42278274 CAAATGCACCACTCTGGTGGGGG + Intergenic
1024035964 7:45507646-45507668 CAAATGTACCATTCTGGTGGGGG - Intergenic
1024453113 7:49571450-49571472 CATATGTAATACTCTAACGGTGG + Intergenic
1027334872 7:77139559-77139581 CAAATGTGCCACTCTGGTGGAGG + Intronic
1027393656 7:77730351-77730373 CAAATGTACCACTCTGATAGGGG - Intronic
1027714150 7:81648239-81648261 CAAATGTACCACTCTGTGGGAGG + Intergenic
1027731065 7:81873237-81873259 CATATCTACAACTCTAAGTGAGG + Intergenic
1027982830 7:85249021-85249043 CAAATGTACCACTCTGATAGGGG + Intergenic
1028194652 7:87892045-87892067 CAAATGTACCACTCTGGTGTGGG - Intronic
1028586175 7:92454064-92454086 CAAGTGTACCACTCTAGTGGTGG + Intronic
1028599587 7:92587855-92587877 CAAATGTACCACTCTGGTGAAGG + Intronic
1028770182 7:94610399-94610421 CAAATATACCACTCTGGTGGGGG + Intronic
1029000641 7:97151090-97151112 CAAATGTACTACTCCAGTGGGGG - Intronic
1029846118 7:103413930-103413952 CAGATGTGCCACTCTGGTGGGGG - Intronic
1030011843 7:105177592-105177614 CAAATGTACTACTCTGAAGGAGG + Intronic
1030290524 7:107867657-107867679 AACATGTACCACTCTTGTGGGGG + Intergenic
1030491958 7:110248156-110248178 CATATGTGGCACACTACTGGTGG - Intergenic
1030723945 7:112902672-112902694 CAAATGTACCACTCTAGTGCTGG + Intronic
1031225329 7:119029847-119029869 CTAATGTACCACTCTAGTGGGGG + Intergenic
1031447069 7:121867928-121867950 CAAATGTACCACTTTGATGTGGG + Intergenic
1031639973 7:124150596-124150618 CAAATTTACCACTCTAGTGGGGG - Intergenic
1031668238 7:124512071-124512093 CGAATGTACCACTCTAGTGTGGG + Intergenic
1032142659 7:129347329-129347351 CAGATGTACCACTCTGGTGCAGG + Intronic
1032178452 7:129653398-129653420 CAAATGTACCACTCTGGTGCAGG - Intronic
1032948571 7:136880742-136880764 CAAATGTATCACTCTGGTGGGGG - Intronic
1032957654 7:136990171-136990193 CAAATGTACCACTCTGATAGAGG - Intronic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1034609209 7:152349827-152349849 CAAATGTACCACTCTAGTATAGG + Intronic
1035993016 8:4513191-4513213 TAAATGTACCATTCTTATGGGGG + Intronic
1036204565 8:6795497-6795519 CAAATGCACCACTCTGGTGGGGG - Intergenic
1036622587 8:10434620-10434642 CAAATGCACCACTCTGGTGGGGG - Intergenic
1036667662 8:10758097-10758119 CAAATGTACCACTCTGGTGGGGG - Intronic
1037449372 8:19001427-19001449 CAAATGTACCGCTCTGGTGGGGG - Intronic
1038031108 8:23641232-23641254 CAAATGGACCACTCTGGTGGGGG - Intergenic
1038044477 8:23754474-23754496 CAAATGCTCCACTCTAGTGGGGG - Intergenic
1038084911 8:24185369-24185391 CAAATGTACCCCTCTGGTGGGGG + Intergenic
1038473884 8:27848243-27848265 CAAATGCACCACTCTGGTGGGGG - Intergenic
1038569991 8:28652971-28652993 TAGATGTACCACTCTGATGAGGG - Intronic
1039163109 8:34644722-34644744 CAGATATACCACTCTGGTGGGGG - Intergenic
1039291848 8:36104271-36104293 CAAATGTACCACACTGGTGGAGG + Intergenic
1039312890 8:36338102-36338124 CAAATGTACCACTCTGATGAGGG + Intergenic
1039642220 8:39236613-39236635 CAAATGTACCACGCTGATGTAGG - Intronic
1039722907 8:40184180-40184202 CAAGTGTACCACTCTGGTGGGGG + Intergenic
1040406210 8:47105732-47105754 CAACTGTACCACTCTAGTGAGGG + Intergenic
1040591982 8:48801836-48801858 CAAATGTGCCACTCTGTTGGAGG + Intergenic
1041093282 8:54324911-54324933 CAGATGTACCACTCTGTTGGGGG + Intergenic
1041299864 8:56399725-56399747 CAAATGGACCACTCTGGTGGGGG - Intergenic
1042208877 8:66357566-66357588 CAAATATACCACTCTAGTGTGGG - Intergenic
1042253762 8:66782431-66782453 CATATGTACCACTCTGGTGGGGG - Intronic
1042474476 8:69231671-69231693 CAAATGTACTACTCTGATGTGGG + Intergenic
1042477996 8:69271405-69271427 TATATGTACCACTCTTGTGGGGG + Intergenic
1042501249 8:69511662-69511684 CAAATGCACCACCCTAGTGGTGG - Intronic
1042905649 8:73769131-73769153 CAAGTGTACCACACTGATGGAGG - Intronic
1043987693 8:86713969-86713991 CAAAGGTACCACTCTCTTGGGGG - Intronic
1044050342 8:87494429-87494451 CAAATGCACCACTCTGATGGAGG - Intronic
1044956881 8:97490418-97490440 CAAGTGCACCACTCTCATGGGGG + Intergenic
1045037614 8:98188158-98188180 CAAATGTACCACTCTGGTGGGGG + Intergenic
1045139211 8:99261077-99261099 CAAATGTATCACTCTGATAGGGG - Intronic
1045271924 8:100669499-100669521 CAAAAGTACCACTCTGGTGGGGG - Intergenic
1046227457 8:111302716-111302738 CAAATGTACCACTCTGGTGGAGG + Intergenic
1046536809 8:115524882-115524904 TATATGTAACACTATAATAGTGG + Intronic
1046552614 8:115735389-115735411 CAAATATACCACTTTACTGGTGG + Intronic
1046983554 8:120362640-120362662 CAAATGTACCACTCTGATGGAGG + Intronic
1047980905 8:130181008-130181030 CAATTGTACCACTCTGGTGGGGG + Intronic
1048778704 8:137977660-137977682 CAAATGCACCACTCTGGTGGAGG + Intergenic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1050777348 9:9282267-9282289 CAAATGTACCATTCTGTTGGGGG + Intronic
1050919491 9:11183876-11183898 CAAATGTACCACTCTGACTGGGG - Intergenic
1051746714 9:20301695-20301717 CAAATGTACCACGCTGGTGGGGG - Intergenic
1051797817 9:20893819-20893841 CAAATATACCACTCTGGTGGGGG - Intronic
1052234603 9:26194824-26194846 CAAATGTACCACTCTGATGAAGG - Intergenic
1052523810 9:29586181-29586203 CAAATGTACTACTCTACTGGGGG + Intergenic
1052582542 9:30377482-30377504 CAAATTTACCACTCTGGTGGAGG + Intergenic
1052783872 9:32810817-32810839 CAAATGTACCACTCTGGTGGGGG + Intergenic
1053238048 9:36473629-36473651 CTGATGTACCACTCTGATGCAGG + Intronic
1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG + Intergenic
1053624766 9:39857839-39857861 CAAATGCACCACTCTGGTGGGGG - Intergenic
1053838124 9:42162798-42162820 CAAATGCACCACTCTGGTGGGGG - Intergenic
1053880104 9:42585389-42585411 CAAATGCACCACTCTGGTGGGGG + Intergenic
1053892557 9:42708920-42708942 CAAATGCACCACTCTGGTGGGGG - Intergenic
1054219129 9:62392859-62392881 CAAATGCACCACTCTGGTGGGGG + Intergenic
1054231584 9:62516314-62516336 CAAATGCACCACTCTGGTGGGGG - Intergenic
1055296161 9:74835905-74835927 CAGATGTACCAGTCTCCTGGGGG - Intronic
1055538632 9:77277380-77277402 CAAATGTACCACTCTAGTGGAGG - Intronic
1055781507 9:79826259-79826281 CACATGTACTACTCTGGTGGAGG + Intergenic
1055863536 9:80784674-80784696 CAAATGTACTACTCTGGTGGTGG - Intergenic
1055972252 9:81923269-81923291 CAAATGTACCACTCTAGTATGGG + Intergenic
1055974005 9:81938341-81938363 CAAATGTACCACTCTAGTATGGG + Intergenic
1055981036 9:82001000-82001022 CAAATGTACCATTCTGGTGGAGG - Intergenic
1057462453 9:95275535-95275557 CAAATGTACCACTCTGGTGGGGG + Intronic
1058654216 9:107205087-107205109 CAAATGGACCACTCTGGTGGGGG + Intergenic
1058772720 9:108252619-108252641 CAAATGTACCACTCTGGTGAGGG + Intergenic
1059203961 9:112445933-112445955 CAAATGTACCACTCTGGTAGAGG - Intronic
1060769058 9:126317687-126317709 CAAATGTACCACTCTGGTGGTGG + Intergenic
1061581810 9:131542180-131542202 CAAATGTACCACTCTGGTGTGGG - Intergenic
1185814110 X:3138194-3138216 CAAATGCGCCACTCTAGTGGGGG - Intergenic
1185949516 X:4415995-4416017 AAAATGTACCACTCTGGTGGGGG - Intergenic
1185957526 X:4507794-4507816 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1186135830 X:6519438-6519460 CAAATGCACCACTCTAAAAGGGG - Intergenic
1186347245 X:8706589-8706611 CAAATGTCCCACTCTGGTGGGGG + Intronic
1186533391 X:10320464-10320486 CAAATGTTCCACTCTAGTGGGGG - Intergenic
1186699542 X:12075298-12075320 CAAATGTACCACTCTGGTGAAGG + Intergenic
1187783281 X:22854239-22854261 TATATATACCACTCTGATGAGGG + Intergenic
1188043758 X:25401961-25401983 CAAATGTACTACTCTGGTGGGGG - Intergenic
1188088576 X:25934083-25934105 CAAATGTACCACTTTGGTGGGGG + Intergenic
1188269056 X:28116111-28116133 CAAGTGTACCACTCTGGTGGGGG - Intergenic
1188622170 X:32239475-32239497 CAAATGTACCACTCTGGTGTGGG - Intronic
1188859603 X:35241886-35241908 CAAATGTACCACTCTGGTGTGGG - Intergenic
1189058446 X:37726161-37726183 AAAATGTACCACTCTGGTGGGGG + Intronic
1189212748 X:39298516-39298538 CATATGTACCTCTCAATTGTTGG - Intergenic
1189411662 X:40778247-40778269 CAAATATACCACTCTGGTGGGGG - Intergenic
1189464963 X:41271619-41271641 CAAATATACCACTCTGGTGGGGG + Intergenic
1189727234 X:43979818-43979840 CAAATGTACCACTCTGGTGCAGG + Intergenic
1189775359 X:44465471-44465493 CAAATGTACCACTCTGGTAGGGG - Intergenic
1190365056 X:49684889-49684911 CAAATGTACCACTCCTTTGGGGG - Intergenic
1192540418 X:71964948-71964970 CAAATGTACCACTCTGGTGCAGG + Intergenic
1192903646 X:75525689-75525711 CAAATGTACTACTCTGGTGGGGG - Intergenic
1194053600 X:89103180-89103202 CATATGTCCCACACTAATAAGGG - Intergenic
1194184438 X:90756491-90756513 CAAATGTACCACTCTGGTGGGGG + Intergenic
1194280277 X:91943301-91943323 CAAATGTACCACTTTGGTGGGGG + Intronic
1194359566 X:92932738-92932760 CAAATGTACCACTGTGATGGGGG + Intergenic
1194890985 X:99378388-99378410 CAAATGTACCACTTTGGTGGGGG - Intergenic
1194908162 X:99605018-99605040 CATTTGTACCACACTACTGGAGG - Intergenic
1195003424 X:100664383-100664405 AAAATGTACCACTCTGGTGGGGG - Intronic
1195587477 X:106581793-106581815 CAGATGTACCACTCTGGTGGAGG + Intergenic
1198134724 X:133737398-133737420 CAAATGTACCACTCTGGTGAGGG + Intronic
1198199315 X:134399435-134399457 CAAATGTACCACTCTGGTGTAGG + Intronic
1198550169 X:137736843-137736865 CAAATGTACCACTGTAGTGGAGG - Intergenic
1198786481 X:140294256-140294278 CAAATGTACTACTCTGGTGGGGG - Intergenic
1199999478 X:153050627-153050649 CAAATGTACCACTCTGGTGCAGG + Intergenic
1200021105 X:153209881-153209903 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1200531027 Y:4338404-4338426 CAAATGTACCACTCTGGCGGGGG + Intergenic
1200597754 Y:5166795-5166817 CAAATGTACCACTTTGGTGGGGG + Intronic
1200667766 Y:6048570-6048592 CAAATGTACCACTGTGATGGGGG + Intergenic
1201267597 Y:12223287-12223309 CAAATGCACCACTCTAGTAGGGG + Intergenic