ID: 1085163678

View in Genome Browser
Species Human (GRCh38)
Location 11:74374756-74374778
Sequence AAGGAGAAAGGGCCTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085163671_1085163678 -5 Left 1085163671 11:74374738-74374760 CCATTCACTGAGTCCCCAAAGGA 0: 1
1: 0
2: 2
3: 32
4: 324
Right 1085163678 11:74374756-74374778 AAGGAGAAAGGGCCTGTTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 306
1085163669_1085163678 -1 Left 1085163669 11:74374734-74374756 CCTGCCATTCACTGAGTCCCCAA 0: 1
1: 0
2: 1
3: 40
4: 270
Right 1085163678 11:74374756-74374778 AAGGAGAAAGGGCCTGTTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085163678 Original CRISPR AAGGAGAAAGGGCCTGTTGA GGG Intronic
901762115 1:11478474-11478496 AAGGAGAAAGAGCCTGGGGGAGG - Intergenic
902701482 1:18175430-18175452 AACGAGAAAGAGCCATTTGAAGG + Intronic
904379448 1:30101239-30101261 AAGGAGGAAGGGCCTGGGGAGGG + Intergenic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
907926952 1:58964345-58964367 AAGGAGACAGGGCTGGGTGAGGG - Intergenic
907980479 1:59475670-59475692 AAGCAGAAAGTACTTGTTGATGG - Intronic
908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG + Intronic
908125594 1:61027069-61027091 GAGGAGAATGAGCCTGTTGTAGG - Intronic
908470362 1:64438227-64438249 AAAGAGAAAGGGCCAGGTGCAGG - Intergenic
909141284 1:71868920-71868942 AAGAGGAAAGAGCCTGATGAAGG - Intronic
909985015 1:82150828-82150850 AAGGGGCAAGGCCATGTTGATGG - Intergenic
910662206 1:89685901-89685923 AAGAAGAAAGGTCTTATTGATGG - Intronic
911511800 1:98816230-98816252 ATTGAGAAAGGTCCTGTTTATGG + Intergenic
911746261 1:101445046-101445068 AGGGAGACAGGGACTGCTGACGG - Intergenic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
915581640 1:156816464-156816486 AAGGTGACAGGGTTTGTTGAGGG - Intronic
916281176 1:163053130-163053152 TAGGAGGAAGGGCCTTTTGGAGG - Intergenic
917925299 1:179784535-179784557 AAGCAGGAAGGGACTATTGAAGG - Intronic
918550180 1:185733831-185733853 AAGAGGAAAGGGGCTGCTGAGGG - Intergenic
919760595 1:201095726-201095748 TCTGTGAAAGGGCCTGTTGATGG + Intronic
920258103 1:204670210-204670232 AGGTAGACAGGGCCTGGTGATGG + Intronic
920534535 1:206729098-206729120 AGGTAGAAAGGGTCTGTTGTGGG + Exonic
922361801 1:224829393-224829415 TAGGAGAAAGGGTCTGGTGTAGG + Intergenic
923375275 1:233355873-233355895 AAGGAGAAGGGGACAGATGAGGG - Intronic
923390447 1:233509958-233509980 TTGGAGAAAGGGCCAGCTGATGG - Intergenic
923552449 1:234974879-234974901 AAGGAGAAGGAGCCTCTTGCAGG + Intergenic
923822421 1:237459897-237459919 AACGAGAAAGGAGCTCTTGAAGG + Intronic
924479914 1:244420404-244420426 AAGTAGAAAAGGGCTGGTGACGG + Intronic
924598361 1:245466369-245466391 AAGAAGAAAGGATCTGGTGAAGG + Intronic
1063048563 10:2419823-2419845 AAGGAGCGATTGCCTGTTGAGGG + Intergenic
1063649393 10:7918210-7918232 AAGGAGAAGGGGCGTGATGAAGG + Intronic
1064006882 10:11705869-11705891 AAAGAGAAAGCGGGTGTTGAGGG - Intergenic
1065212643 10:23419214-23419236 AAAGAGACAGGGCCTATTTAGGG + Intergenic
1066421113 10:35265732-35265754 AAGGAGAAGGGGGCTTTTCAGGG + Intronic
1066987874 10:42484198-42484220 AAGGGGATAGGGACTGCTGAGGG + Intergenic
1067152223 10:43746153-43746175 AGGGAGCTAGCGCCTGTTGAGGG + Intergenic
1067530901 10:47072041-47072063 AGGGAGAAAGGGGAAGTTGAGGG - Intergenic
1067941147 10:50658536-50658558 AAGCAGCAAGGGGCTGTTGCTGG - Intergenic
1068004051 10:51371763-51371785 AAGAAGAAAGGGGTTGATGATGG - Intronic
1068610912 10:59058971-59058993 AAGGAGAAATTGCCTGGAGAAGG - Intergenic
1069519995 10:69111384-69111406 ATGTTGGAAGGGCCTGTTGAGGG + Intergenic
1069564349 10:69453158-69453180 ATGGAGCAAGGACCTGTTGGTGG + Intronic
1069920191 10:71811682-71811704 AAGCAGAGAGGGGCTGGTGAGGG - Intronic
1071673845 10:87636887-87636909 AAGGAGAAATGGCCAGATGTGGG - Intergenic
1071841699 10:89478202-89478224 ACGTAGAAAGTCCCTGTTGAAGG + Intronic
1072333501 10:94376346-94376368 AAGGAAAAATGGCCTGGTCAAGG + Intergenic
1074898994 10:117800906-117800928 AGAGATTAAGGGCCTGTTGAGGG + Intergenic
1076810490 10:132884125-132884147 AAGCAGGAAGGGCCTGAGGAGGG - Intronic
1078710661 11:13787688-13787710 AAAGGGAAAGGGCCAGATGATGG + Intergenic
1078872566 11:15362706-15362728 AAGCAGACAGGGACTGGTGAGGG - Intergenic
1079157979 11:17966388-17966410 AAGCAGAAGGGACCTGTTCAAGG - Intronic
1080608440 11:33884194-33884216 GAGGAGAAAGAGCCTGGTGCTGG + Intronic
1080760088 11:35240323-35240345 AAGGAGAAAGGGAAGGTTGTGGG + Intergenic
1083320093 11:61840497-61840519 AAGGACAAAGGCCGTGATGAGGG - Exonic
1083609172 11:63997015-63997037 AGGGAGAAAGGGCAAGATGACGG - Intronic
1084972120 11:72777705-72777727 AAAGAGAAAGGGGCTGTTGGAGG - Intronic
1084978458 11:72815837-72815859 AAAGAGGAAGTGACTGTTGATGG + Intronic
1085163678 11:74374756-74374778 AAGGAGAAAGGGCCTGTTGAGGG + Intronic
1085529016 11:77180707-77180729 AACTAGAAAGGGGCTGCTGAGGG - Intronic
1085942281 11:81219548-81219570 ATGGGGAAAGGGCATGTAGAAGG - Intergenic
1088587090 11:111368881-111368903 AAGGAGAAAGGGCTATTTGTTGG - Intronic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1090768899 11:129901883-129901905 AAGGAGAAGGGGCATTTTGTGGG - Exonic
1092040368 12:5378932-5378954 AAGGAGAATGGGCAAGTTGGTGG - Intergenic
1092143438 12:6199652-6199674 AGGGAAAAAGGGTCTGTAGACGG - Intergenic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1095856175 12:46863160-46863182 AAGGAGAAATGGCCAGATGTAGG - Intergenic
1096774596 12:53956239-53956261 AAGGTGAAAGGGTCTGGGGAAGG + Intronic
1097086072 12:56469362-56469384 AACGAGAAAGCCCCAGTTGAGGG + Exonic
1098050638 12:66448924-66448946 CAGGAGAAAGGAACTGATGAAGG - Intronic
1098524141 12:71467358-71467380 GATGAGAAAGTGCCTGTGGAGGG + Intronic
1101970200 12:109307474-109307496 AAGGGGAAAGGGCTTGTCCAAGG - Intronic
1102500309 12:113347568-113347590 AAGGAGAAAGGGGCTGGTCATGG + Intronic
1102893234 12:116578352-116578374 ATGGAGCAGGAGCCTGTTGAAGG - Intergenic
1109893456 13:68650895-68650917 ACGGGGAAATGGCCCGTTGAGGG - Intergenic
1112869730 13:103955348-103955370 AAGGCAAAAGGGCCGGTGGAAGG - Intergenic
1114460655 14:22884268-22884290 GAGGAGGAAGGGCCTCTTGATGG + Intronic
1116865850 14:50031019-50031041 AAGGAAAGAGGGCTTGTTCAAGG + Intergenic
1117074253 14:52085728-52085750 AAACAGAAATGGCCTGTTGGTGG + Intergenic
1117160513 14:52984920-52984942 AAGGAGGAAGGCCCTGTGGTAGG + Intergenic
1117412289 14:55461383-55461405 AAGGAGATAGGGCATGCAGAGGG - Intergenic
1117796234 14:59397138-59397160 AAAGAGAAAAGGCCAGGTGAAGG - Intergenic
1118482433 14:66180667-66180689 CAGGAGAAAGGTCCTGGTCAAGG - Intergenic
1119271402 14:73308223-73308245 AAGCAGACAGGAACTGTTGATGG + Intronic
1121060897 14:90908636-90908658 GAGGAGAAAGGGCCTATAGCAGG + Intronic
1121628161 14:95402000-95402022 AAGGAGAAAGGGATTTATGATGG - Intergenic
1122715668 14:103695607-103695629 AAGGAAAAAGGGCATTTAGAAGG + Intergenic
1124348391 15:28937520-28937542 CAGGAGAAAGGGCCTCCTGGTGG + Intronic
1125436735 15:39653723-39653745 AAAGAGAAAGGGCTTGTGCAAGG - Intronic
1125723038 15:41854212-41854234 GAGGAGAAAGGACCTGCTCAGGG + Intronic
1128376528 15:67080468-67080490 AAAGGGACAGGGCCTGATGATGG - Intronic
1130508469 15:84569606-84569628 AATGAAAACGGGCTTGTTGATGG - Intergenic
1130567394 15:85008417-85008439 ATGGAGGAAGGGTCTGGTGAGGG - Intronic
1130924446 15:88374754-88374776 AAGGAAGGAGGGCCTGATGAGGG + Intergenic
1134090766 16:11390543-11390565 GAGGAGATAGGGCCTGTTCCTGG + Intronic
1134776072 16:16854783-16854805 ATGGAGAAAGGACCTTTAGAAGG + Intergenic
1136147627 16:28324654-28324676 AAGCTGAAAGGGCCGGTTGTGGG + Intergenic
1137709937 16:50559627-50559649 AAGGAGACAAGGCCTCATGACGG - Intronic
1137802460 16:51273790-51273812 AGGGAGCAAGGTCATGTTGATGG + Intergenic
1138272024 16:55702255-55702277 AAGGAGCAAGGGCCAGCTGGCGG - Intronic
1140142210 16:72269168-72269190 AAGGAGAAAGTACATTTTGAGGG + Intergenic
1140151925 16:72376195-72376217 GAGGAGAAAGGGCCTGAACAGGG + Intergenic
1141758308 16:86009851-86009873 AAGGAGAAGGGGCTTGGTGAAGG + Intergenic
1144023558 17:11258192-11258214 AAAGAGAAAGGGCATGATTAGGG + Intronic
1144033443 17:11342358-11342380 CAGGAGAGAGGGCGTGTTGGAGG + Intronic
1144185596 17:12792242-12792264 GGGGAGGAAGGGCCTCTTGAAGG - Intronic
1144708933 17:17387896-17387918 AAGGTCAAAGGGCCAGCTGAGGG + Intergenic
1146245895 17:31282488-31282510 AAGGGGAGAGTGACTGTTGATGG - Intronic
1147119166 17:38325532-38325554 AAAGAGAGAGGTCCTGTTGATGG + Intronic
1147918232 17:43901063-43901085 AAGGAAACAGGGCCTGGAGAGGG - Intronic
1148527610 17:48355928-48355950 AATGGGAAAGGCCCTGATGATGG - Intronic
1148803835 17:50253358-50253380 ATGGAGAAATGGCTGGTTGACGG + Intergenic
1148992020 17:51674372-51674394 AAGGATAAAGTGCTTGTTCAAGG - Intronic
1150703336 17:67466522-67466544 AAAGAGAAAGGGCCAGGTGTTGG + Intronic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1153021889 18:636915-636937 AAGGAGAAAGGGGCTGGGCATGG - Intronic
1153308516 18:3654790-3654812 GAGGAGAAAGTGCATGTTGCAGG - Intronic
1153815053 18:8784331-8784353 AAGCGGGAAGGGCCTGTTGGCGG + Exonic
1158488976 18:57893178-57893200 AAGGAGCAAGGGGCTGGAGATGG + Intergenic
1158555646 18:58472555-58472577 AAGGATAAAGAGCCTGGGGAGGG + Intergenic
1159278619 18:66253689-66253711 AGGGAGAAAGAGCCTGTTAAAGG - Intergenic
1160383653 18:78479783-78479805 AAGGAGAAAGGAACTTTTCATGG - Intergenic
1161153344 19:2720800-2720822 ATGGAGAAAGGGCCTGCTCTAGG + Intronic
1161776999 19:6269071-6269093 AAGGAAAGAGGGCCTGGTGCAGG + Intronic
1161907933 19:7171194-7171216 AAGGAGAAAGGAGCCATTGAAGG + Intronic
1161971990 19:7587305-7587327 AAGGACAAAGGCCCTGGGGAAGG - Intergenic
1162546020 19:11330201-11330223 AAGGGGAAAGGGACTGGTTATGG + Intronic
1162583554 19:11545412-11545434 AAGGAGAAAGGGGGAGTTGGGGG + Intronic
1163902603 19:20118180-20118202 AAGGTGTGAGGACCTGTTGAAGG - Exonic
1165108030 19:33486030-33486052 AAGGAGAGATGGTCTGTTGGGGG - Intronic
1165818846 19:38661501-38661523 AGGTAGAAATGGCCTCTTGATGG - Intronic
1166560178 19:43727619-43727641 AAGGAGAAACGCCCTGCTGCAGG - Intergenic
1167906447 19:52664734-52664756 AAGGACAAGGGGCCTGGTGTGGG + Intronic
1202651396 1_KI270707v1_random:7938-7960 AAAGAGAAATGGCCCGTTGGTGG - Intergenic
925575157 2:5352514-5352536 AAGGAGAAAGGGCCCTCTGAGGG + Intergenic
925975889 2:9141862-9141884 AAGGGGGAAGGGCCTCTAGATGG - Intergenic
926053573 2:9760345-9760367 AAGTAGAGAGAGGCTGTTGAAGG + Intergenic
926954041 2:18273859-18273881 AAGGAGAAGGGGCCTTTAGTGGG - Intronic
927102457 2:19798677-19798699 AAGGAGGAAGGGACTCTTGAAGG - Intergenic
927433540 2:23047581-23047603 AAGTGGAAAGGGCCTGGGGAAGG + Intergenic
929626617 2:43415412-43415434 AGGGAAAAAGGGACTGTTAATGG + Intronic
931351579 2:61494645-61494667 AAGGAGAAAGTGACTGTTTTAGG + Intronic
931577073 2:63729478-63729500 TAGGAGAAGTAGCCTGTTGAAGG + Intronic
932115778 2:69045583-69045605 AAGGAGGAAGGGCCAGTACAGGG + Intronic
932616835 2:73237368-73237390 GAGGTGAAAGAACCTGTTGAAGG + Intronic
932851833 2:75195037-75195059 TAGGGGAACGGGGCTGTTGAGGG + Intronic
933354961 2:81198654-81198676 AAGGACACAGGGGCTGCTGACGG - Intergenic
934674185 2:96238040-96238062 GAGAAGAAATGGGCTGTTGAAGG + Intergenic
934765950 2:96880134-96880156 AAGGAGAAAGGGCCCTTCCAGGG + Intronic
935292887 2:101624931-101624953 AAGGAGAAAGAGCCTGTGCTGGG + Intergenic
936783460 2:116062894-116062916 AAGCAGAAAATGCCTGTTCAGGG - Intergenic
937692206 2:124769275-124769297 AAAAAGAAAGGGCATGTTTAGGG - Intronic
939333800 2:140799236-140799258 AAGGAGATGGGGCCTTTGGAAGG + Intronic
939818270 2:146922981-146923003 GAGGAGCAAGGTCCTGTTGGAGG - Intergenic
939835841 2:147128521-147128543 ATGGAGAAAGTGCTTGTTAATGG - Intergenic
939915446 2:148036587-148036609 ATGGAGAAAAAGCCAGTTGATGG - Intronic
940824434 2:158394733-158394755 AAGGAGAGAGGCCCTATTGAGGG - Intronic
942247683 2:174023072-174023094 AAGGAGACAGGTCCAGTTGATGG + Intergenic
942828257 2:180206894-180206916 AAGAGGAAAAGGCCTGCTGATGG + Intergenic
943747548 2:191477981-191478003 AAGTGGAAGGGGCCTGCTGATGG - Intergenic
944821498 2:203436978-203437000 AAAGGGAAATGGCCTGTTGTCGG + Exonic
945956396 2:216090225-216090247 AAGGGGAAAGAGCCAGTAGAAGG + Intronic
946161792 2:217840047-217840069 AAGGAGGGAGGGGCGGTTGAAGG + Intronic
947642642 2:231715528-231715550 AGGGAGAAAGGTCTTGTTGCGGG - Intergenic
1169572992 20:6926858-6926880 AAGGAGACAGGGAATGTAGAGGG + Intergenic
1169943363 20:10962083-10962105 AAAGAGAAAGGGCAGTTTGATGG - Intergenic
1170393025 20:15895625-15895647 CAGGAGAGAGGGCCTGGTGGCGG + Intronic
1170547208 20:17444699-17444721 AAAGAGACAGGGCCAGTTAAGGG + Intronic
1171216416 20:23355901-23355923 AAGAAAGAAGGGTCTGTTGAAGG - Intergenic
1172628977 20:36365798-36365820 AAGGAGAAAGGGACAGTCGCTGG - Intronic
1176600746 21:8791707-8791729 AAAGAGAAATGGCCCGTTGGTGG + Intergenic
1176675381 21:9772444-9772466 AAAGAGAAAGGGGCCTTTGAGGG + Intergenic
1178299190 21:31437593-31437615 TTGGAGAAAGGGCCTGTGGGAGG + Intronic
1178424558 21:32469014-32469036 GAGGAGAAAGAGCCTGTGCATGG - Intronic
1179270689 21:39848226-39848248 AAGGAGACAGGGCTGGTTCATGG - Intergenic
1180343032 22:11683244-11683266 AAAGAGAAATGGCCCGTTGGTGG + Intergenic
1180417610 22:12782838-12782860 AAAGAGAAATGGCCCGTTGGTGG - Intergenic
1180850406 22:19016471-19016493 ATGGAAAAATGGCCTGTGGATGG - Intergenic
1181688573 22:24545503-24545525 AAGGAGACAGCACCTGTTGAGGG + Intronic
1183764570 22:39859977-39859999 AATGAGAGAGGGCCTTTTGGAGG - Intronic
1184687357 22:46102651-46102673 AAGGAAAACGGGCCTCCTGATGG + Intronic
1184970941 22:48019412-48019434 AAGGAGAAAGGGGCTTTAGTGGG + Intergenic
951417195 3:22439422-22439444 AAGGAGAAGGTGCCTGTCCATGG + Intergenic
953025478 3:39142503-39142525 AAGGCAAAAGGGGCTCTTGAGGG + Exonic
953598245 3:44338121-44338143 AAGGGGAAAGGGACTGCTGGAGG - Intronic
953840074 3:46382944-46382966 AATGAGAAATTGCATGTTGAGGG + Intergenic
954798977 3:53176099-53176121 AGGGAGAGAGGGCCAGTTGGGGG - Intronic
955069461 3:55560089-55560111 AAGAAGCAAGGGGCTGCTGAGGG - Intronic
956062473 3:65361560-65361582 AAGCAGTAAGGGCATGTTAATGG + Intronic
956250261 3:67228093-67228115 AAAGAGACAGGGTCTATTGAGGG + Intergenic
957093562 3:75756271-75756293 AAAGAGAAATGGCCCGTTGGTGG - Intronic
958105045 3:89061097-89061119 AAGGACAAAGAGAGTGTTGATGG - Intergenic
958602858 3:96321036-96321058 AAGTAGAAAGGGACTGTTGATGG + Intergenic
959905694 3:111708890-111708912 AGGAAGGAAGAGCCTGTTGAAGG + Intronic
959923915 3:111900499-111900521 ACAGGGAAATGGCCTGTTGATGG + Intronic
960713126 3:120550804-120550826 AAGTAGATAGTGTCTGTTGAAGG - Intergenic
961004414 3:123395315-123395337 AAGGAGGATGGGCATGTTTAGGG - Intronic
961198870 3:125028052-125028074 AAAGTGATAGGACCTGTTGATGG - Intronic
961318412 3:126056223-126056245 AAGCAGCAAGGGCAGGTTGAGGG + Intronic
962326943 3:134442255-134442277 AAGGAGACAGAGACTGCTGATGG - Intergenic
962338413 3:134559800-134559822 AAGGAGAAAGGGAGTGTGGAGGG + Intronic
963130055 3:141849612-141849634 AAGTAGAAAGTGGATGTTGAGGG + Intergenic
963842881 3:150125766-150125788 AAGGATAAAGGTCCTTTAGAGGG - Intergenic
966316751 3:178655993-178656015 AAGGAGAAAAGGCCTTTTGTGGG - Intronic
966504032 3:180679241-180679263 AAGCAGAGAGAGCCTGTTGGGGG - Intronic
967247908 3:187506302-187506324 AGGGTGACAGGGCCTCTTGATGG + Intergenic
968006803 3:195248613-195248635 AAGGAAAAAGGGCATTTTAATGG - Intronic
968159702 3:196416046-196416068 AAGCAGAAAGAACATGTTGATGG + Intronic
969061404 4:4438143-4438165 CGGGAGAAAGGGCCTGCTGGAGG - Intronic
969129053 4:4977602-4977624 AAGGAGAAAGGGTGTGTTCAGGG - Intergenic
969226264 4:5800520-5800542 AAGGATGGAGGGCCTGGTGAAGG + Intronic
969275178 4:6129918-6129940 CAGGAGAAGGAGGCTGTTGAGGG - Intronic
969932658 4:10646449-10646471 AAAGAGAAATGGCCTGATAACGG + Intronic
971264024 4:25082436-25082458 AAGGAGAACAGGCCTGCAGAAGG + Intergenic
973289186 4:48453553-48453575 AGGCTGAAAAGGCCTGTTGAGGG - Intergenic
973364185 4:49194455-49194477 AAAGAGAAATGGCCCGTTGATGG + Intergenic
974285770 4:59865122-59865144 AAGGAAAAAGGGACTGAAGAGGG - Intergenic
975512713 4:75211335-75211357 AAGGAGAAAAGGGCTAGTGAGGG + Intergenic
976089463 4:81441253-81441275 AAGGTCAACGGGCCCGTTGATGG + Intronic
977984136 4:103361705-103361727 AGGGAGAAAGAGCTTGTTGTAGG + Intergenic
981240562 4:142471843-142471865 ATGGAGGAAGGGGCTGGTGAAGG - Intronic
982153747 4:152494329-152494351 AAAGAGAAAGGGCATGTTGGAGG + Intronic
986814573 5:11394398-11394420 AAGAAGAAGGGGTCTGTGGAGGG + Intronic
987236589 5:15948654-15948676 AAGGGGAAAAGGACTGTTCATGG + Intergenic
987690487 5:21260050-21260072 TAGGAGACAGGGCCTTTGGAAGG - Intergenic
988622682 5:32839729-32839751 AAGGAAACAGGGACTGTTGTGGG - Intergenic
988780007 5:34512039-34512061 AAAGCAAGAGGGCCTGTTGATGG - Intergenic
989107522 5:37877747-37877769 AAGCAGAAAGGGGCTTTTGAAGG + Intergenic
990669739 5:58114727-58114749 AAGGACAAAGAGCTTGCTGAAGG - Intergenic
992536309 5:77707498-77707520 AAGAAGAAAGGGCATGTTCAGGG + Intronic
994881645 5:105505726-105505748 ATGATGAAATGGCCTGTTGATGG - Intergenic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
995825667 5:116295954-116295976 AAGGAAGAAGGGGCTGCTGAAGG - Intronic
997612395 5:135224364-135224386 CAGGAGAAAGGACGTGTTCATGG + Intronic
998183913 5:139964547-139964569 TAGTAGAAAGGGCATGTTTATGG - Intronic
998515868 5:142753531-142753553 AAGGAGAAAGAGACTGTTCTAGG + Intergenic
998604388 5:143618697-143618719 AAGGAGAAGGGGGCTGATGGTGG + Intergenic
998918606 5:147042894-147042916 AAGTAGAAAGGCCCTGGAGAGGG + Intronic
999310541 5:150548957-150548979 AAGGAGACTGGGCGTGGTGATGG + Intronic
999977035 5:156922074-156922096 AAGGAGGGAGGGCCAGGTGATGG - Intronic
1000207353 5:159075286-159075308 AAGGAGGAAGGGACTGAAGAGGG - Intronic
1000214877 5:159145792-159145814 AGGGAGTAAGTGCCTGTTAAAGG + Intergenic
1001192376 5:169643081-169643103 AAGGAGAAAGTGCCTATTAAAGG - Intronic
1002436978 5:179237688-179237710 AAGGAGACGGGGCCTGATGAGGG + Intronic
1002663276 5:180804965-180804987 AAAAAGAAAGGGCCTGGTTAGGG + Intronic
1003271034 6:4608091-4608113 AAGGAGAAATGGCTTGTCGAAGG - Intergenic
1003791299 6:9550560-9550582 AAGGAGAAATGGCCAGATGTAGG + Intergenic
1005279872 6:24262065-24262087 AAGGAGAAAGGCACTGAAGATGG + Intronic
1006170624 6:32089933-32089955 AAGGAGAAAGTGCAACTTGAAGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008403683 6:51094894-51094916 AAGGAGAAATGGGAAGTTGATGG - Intergenic
1010584766 6:77644068-77644090 AAGTAGAAAGGGCATGTTTCTGG + Intergenic
1010657186 6:78525476-78525498 AAGGAGACAGGTCCTGATGATGG - Intergenic
1011525754 6:88263007-88263029 AATGAAAAAGAGCTTGTTGATGG - Intergenic
1011561369 6:88620169-88620191 AAGGAGAAACTTCCTGTTGCTGG - Intronic
1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG + Intergenic
1012529673 6:100220474-100220496 AAGGAGAAAGGACTTGTTAGAGG + Intergenic
1014157967 6:118134153-118134175 AAGGAGAAACTGCCTGTGCAGGG + Intronic
1014710018 6:124795835-124795857 AAGGAGGTAGGGCCTGTAGGAGG - Intronic
1015207338 6:130654985-130655007 AATGAGAAAGAGCGTGTGGAAGG + Intergenic
1015476324 6:133662206-133662228 AAGGAGAAAGAGCTTGTGCAGGG - Intergenic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1016355726 6:143216179-143216201 AGGGAGAAAGGGTCTACTGAAGG - Intronic
1017743527 6:157427184-157427206 AAGGAGGAAGGGCGGGTGGAGGG + Intronic
1019221907 6:170479694-170479716 AAGTAGGAAAGGGCTGTTGAAGG - Intergenic
1019695860 7:2445849-2445871 TGTGAGAAAAGGCCTGTTGATGG + Intergenic
1020435564 7:8158724-8158746 AAAGAGAAAAGGCCTGCTGTTGG - Intronic
1022528047 7:31051090-31051112 AAGAGGAAAGGACCTGTGGATGG - Intergenic
1022902541 7:34825155-34825177 AAGGAGAAAAGGCCTGGAGGTGG - Intronic
1024127507 7:46315269-46315291 AAGGAGAAAGGGCTTGTAAACGG - Intergenic
1024624235 7:51190619-51190641 AAGGATAAAGGACATGTTCAGGG + Intronic
1025147247 7:56515446-56515468 AAGGTGAAAGGGCCTATGCAAGG + Intergenic
1026180306 7:68033678-68033700 AAGGAGGAAGTGCCTGGTGCAGG + Intergenic
1027580033 7:79981314-79981336 AATAAGAAAGGGCATTTTGAGGG - Intergenic
1027665425 7:81038562-81038584 TAGAAGAAAGGGTCTTTTGATGG + Intergenic
1030319518 7:108149965-108149987 AAAGAGAAAGAGCCGGCTGAAGG - Exonic
1031186082 7:118481661-118481683 AAGAAGAAAGGCCCTGTGGCTGG + Intergenic
1031882653 7:127214606-127214628 CAGGAGAAGGAGCGTGTTGAAGG + Intronic
1033960188 7:146904924-146904946 AAGGACAAAGGGACTTTTCAAGG - Intronic
1035397987 7:158547598-158547620 AAGGGAAAGGGGCCTGTTGGAGG + Intronic
1036077847 8:5521220-5521242 AAGGAAAAAGGGGCTGTGAATGG + Intergenic
1036634192 8:10537802-10537824 GAGGAGAAAGGGCTTGCTGAGGG - Intronic
1037948095 8:23001821-23001843 AAGGACAAGGGGACTGCTGAAGG + Intronic
1037967537 8:23145938-23145960 AGGGAGACAGGGACTCTTGATGG + Intronic
1038699187 8:29834244-29834266 AGGGGAACAGGGCCTGTTGAGGG - Intergenic
1038916581 8:32031201-32031223 ATGGAGACAGAGCCTGGTGATGG - Intronic
1039056588 8:33541799-33541821 AATGGGAAAAGCCCTGTTGAGGG + Intergenic
1039235502 8:35498150-35498172 AAGGAAAAAGGAACTGTTAAAGG + Intronic
1039977926 8:42383122-42383144 GATGAGAAGGGGCATGTTGATGG + Intergenic
1041447373 8:57967091-57967113 AAGGAGATAGGGCATTTGGAAGG + Intergenic
1042816471 8:72882969-72882991 AAGTGGAAAGGGCCTGGAGAAGG - Intronic
1042822959 8:72952016-72952038 AAGGAGAAAGGGCTGGTTGTAGG + Intergenic
1043805432 8:84666799-84666821 TGGGATAAAGGGCCAGTTGATGG + Intronic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1046278857 8:111998157-111998179 AAGGCGAAAGGGCCCATTGATGG - Intergenic
1046288231 8:112124493-112124515 AAGGAGATAAGGCATGGTGAAGG - Intergenic
1046616928 8:116488118-116488140 AAGGAGAAAGGGGCCCTTGCAGG + Intergenic
1046864387 8:119129613-119129635 AAGGAGAAAGGTGAAGTTGAGGG + Intergenic
1047026323 8:120828333-120828355 AAGTTTAAAGGGCCTCTTGAGGG + Intergenic
1047117787 8:121864178-121864200 AAGGAGAAATGGCCTATTCTGGG - Intergenic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1048541856 8:135349260-135349282 AAGGAAAAAGGCCCTGCTGAGGG - Intergenic
1049629732 8:143647109-143647131 CAGGAGAGAGGGCATGCTGAGGG + Intronic
1050292201 9:4166581-4166603 AAGGAGAAGGGGCCTTTCCAAGG - Intronic
1050772219 9:9216467-9216489 AAGAAGAAAGGGCATATAGAAGG - Intronic
1051235920 9:14998751-14998773 AAGGAGAAAGAAACTGTTAATGG + Intergenic
1051907010 9:22106706-22106728 AAGGAGAAGGGGCCAGTTTGTGG + Intergenic
1052195043 9:25701808-25701830 AAGGCAGAAGGGCCCGTTGAAGG + Intergenic
1052790791 9:32873906-32873928 AAGGAGAAATGGGCTGTGCAGGG - Intergenic
1053141821 9:35687435-35687457 AAGGAGAGAGGACCTGTGTAGGG + Intronic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1056766420 9:89447215-89447237 AAGGAGCAAGGGCATTCTGAGGG + Intronic
1058285379 9:103170181-103170203 AAGGAGAGAGGCCCTGAAGAAGG - Intergenic
1058878526 9:109265980-109266002 AAGGAGATCGGGCGTGCTGAAGG + Intronic
1059336956 9:113575049-113575071 GAGGAGAAGGGACCTGGTGAGGG + Intronic
1059366289 9:113789045-113789067 AAGGAGAAAGCGTGTGTGGAAGG + Intergenic
1060825125 9:126683364-126683386 GACAAAAAAGGGCCTGTTGATGG - Intronic
1203483873 Un_GL000224v1:33446-33468 AAAGAGAAATGGCCCGTTGGTGG + Intergenic
1186662994 X:11687886-11687908 AAGCAGAAAGGGAATTTTGAGGG - Intergenic
1187348310 X:18488103-18488125 AAGGAAAAAGTACCTCTTGAAGG + Intronic
1187981437 X:24761939-24761961 CAAGAGAAAGGACCTGTTGTAGG + Intronic
1188662156 X:32774125-32774147 TAGGAGAAATGGCCTGCTAAAGG + Intronic
1190363431 X:49670010-49670032 ACGGAGAAAAGCCCTGTAGAGGG - Intergenic
1190996684 X:55616969-55616991 AAGGAGAAATGGCCAGATGTGGG - Intergenic
1191934964 X:66417589-66417611 AAGAAGACAGGGCCTGTTAGGGG + Intergenic
1192208510 X:69111590-69111612 GAGTAGAAAGGGCTTGTTCAAGG + Intergenic
1194039046 X:88917037-88917059 CAGGAGAAAGGGCTTATAGAAGG - Intergenic
1194614752 X:96087063-96087085 AAGCTGCCAGGGCCTGTTGAGGG - Intergenic
1194773278 X:97930921-97930943 ATGGAGAAAGGGCCTTGTCAGGG - Intergenic
1195332861 X:103819950-103819972 AAGGAGATGGGGCCTTTGGAAGG + Intergenic
1195997925 X:110750052-110750074 AAGGGAGAGGGGCCTGTTGAAGG - Intronic
1196027865 X:111061606-111061628 CATGAAAAAGGGCCTGTTTATGG - Intronic
1196157742 X:112449457-112449479 AAACAGAAAGGACCTTTTGAGGG + Intergenic
1196181055 X:112690140-112690162 AAGGATAATGGACCAGTTGAGGG + Intergenic
1196722002 X:118863232-118863254 ATGGAGGAAGTGCCTGCTGAAGG + Intergenic
1196920658 X:120582170-120582192 AAGGAGAAAGGGCCTCTTCCAGG - Intergenic
1198920928 X:141725899-141725921 ATGGACAAATGGCCTGTTAAAGG + Intergenic
1199454225 X:148009711-148009733 AAAGACAAGGTGCCTGTTGAAGG + Intronic
1200945688 Y:8834021-8834043 ATGGACAAATGGCCTGTTAAAGG + Intergenic