ID: 1085166831

View in Genome Browser
Species Human (GRCh38)
Location 11:74409194-74409216
Sequence TGGTAAGTCTTGAACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085166825_1085166831 28 Left 1085166825 11:74409143-74409165 CCAGACTGGGAGGGGCATAAAAG No data
Right 1085166831 11:74409194-74409216 TGGTAAGTCTTGAACTTGGGTGG No data
1085166827_1085166831 1 Left 1085166827 11:74409170-74409192 CCTTGAAGAAATCATAGCTAAAC No data
Right 1085166831 11:74409194-74409216 TGGTAAGTCTTGAACTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085166831 Original CRISPR TGGTAAGTCTTGAACTTGGG TGG Intergenic
No off target data available for this crispr