ID: 1085171813

View in Genome Browser
Species Human (GRCh38)
Location 11:74456118-74456140
Sequence GTTTCACATGTTGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85684
Summary {0: 34, 1: 326, 2: 1368, 3: 11678, 4: 72278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085171813_1085171818 28 Left 1085171813 11:74456118-74456140 CCAGCCTGGGCAACATGTGAAAC 0: 34
1: 326
2: 1368
3: 11678
4: 72278
Right 1085171818 11:74456169-74456191 TATATATATATAAATTAACTGGG 0: 1
1: 46
2: 201
3: 984
4: 9915
1085171813_1085171817 27 Left 1085171813 11:74456118-74456140 CCAGCCTGGGCAACATGTGAAAC 0: 34
1: 326
2: 1368
3: 11678
4: 72278
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085171813 Original CRISPR GTTTCACATGTTGCCCAGGC TGG (reversed) Exonic