ID: 1085171814

View in Genome Browser
Species Human (GRCh38)
Location 11:74456122-74456144
Sequence CAGGGTTTCACATGTTGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5955
Summary {0: 12, 1: 131, 2: 393, 3: 1208, 4: 4211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085171814_1085171819 29 Left 1085171814 11:74456122-74456144 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1085171819 11:74456174-74456196 ATATATAAATTAACTGGGTGTGG 0: 1
1: 57
2: 1815
3: 24649
4: 61185
1085171814_1085171817 23 Left 1085171814 11:74456122-74456144 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403
1085171814_1085171818 24 Left 1085171814 11:74456122-74456144 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1085171818 11:74456169-74456191 TATATATATATAAATTAACTGGG 0: 1
1: 46
2: 201
3: 984
4: 9915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085171814 Original CRISPR CAGGGTTTCACATGTTGCCC AGG (reversed) Exonic