ID: 1085171815

View in Genome Browser
Species Human (GRCh38)
Location 11:74456140-74456162
Sequence TATATATTTAAGTAGAGACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30265
Summary {0: 1, 1: 14, 2: 455, 3: 7440, 4: 22355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085171815_1085171820 18 Left 1085171815 11:74456140-74456162 CCCTGTCTCTACTTAAATATATA 0: 1
1: 14
2: 455
3: 7440
4: 22355
Right 1085171820 11:74456181-74456203 AATTAACTGGGTGTGGTGACAGG 0: 5
1: 303
2: 7448
3: 27788
4: 60818
1085171815_1085171818 6 Left 1085171815 11:74456140-74456162 CCCTGTCTCTACTTAAATATATA 0: 1
1: 14
2: 455
3: 7440
4: 22355
Right 1085171818 11:74456169-74456191 TATATATATATAAATTAACTGGG 0: 1
1: 46
2: 201
3: 984
4: 9915
1085171815_1085171819 11 Left 1085171815 11:74456140-74456162 CCCTGTCTCTACTTAAATATATA 0: 1
1: 14
2: 455
3: 7440
4: 22355
Right 1085171819 11:74456174-74456196 ATATATAAATTAACTGGGTGTGG 0: 1
1: 57
2: 1815
3: 24649
4: 61185
1085171815_1085171817 5 Left 1085171815 11:74456140-74456162 CCCTGTCTCTACTTAAATATATA 0: 1
1: 14
2: 455
3: 7440
4: 22355
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085171815 Original CRISPR TATATATTTAAGTAGAGACA GGG (reversed) Exonic