ID: 1085171816

View in Genome Browser
Species Human (GRCh38)
Location 11:74456141-74456163
Sequence ATATATATTTAAGTAGAGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20197
Summary {0: 2, 1: 16, 2: 135, 3: 1461, 4: 18583}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085171816_1085171819 10 Left 1085171816 11:74456141-74456163 CCTGTCTCTACTTAAATATATAT 0: 2
1: 16
2: 135
3: 1461
4: 18583
Right 1085171819 11:74456174-74456196 ATATATAAATTAACTGGGTGTGG 0: 1
1: 57
2: 1815
3: 24649
4: 61185
1085171816_1085171818 5 Left 1085171816 11:74456141-74456163 CCTGTCTCTACTTAAATATATAT 0: 2
1: 16
2: 135
3: 1461
4: 18583
Right 1085171818 11:74456169-74456191 TATATATATATAAATTAACTGGG 0: 1
1: 46
2: 201
3: 984
4: 9915
1085171816_1085171820 17 Left 1085171816 11:74456141-74456163 CCTGTCTCTACTTAAATATATAT 0: 2
1: 16
2: 135
3: 1461
4: 18583
Right 1085171820 11:74456181-74456203 AATTAACTGGGTGTGGTGACAGG 0: 5
1: 303
2: 7448
3: 27788
4: 60818
1085171816_1085171817 4 Left 1085171816 11:74456141-74456163 CCTGTCTCTACTTAAATATATAT 0: 2
1: 16
2: 135
3: 1461
4: 18583
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085171816 Original CRISPR ATATATATTTAAGTAGAGAC AGG (reversed) Exonic