ID: 1085171817

View in Genome Browser
Species Human (GRCh38)
Location 11:74456168-74456190
Sequence ATATATATATATAAATTAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6895
Summary {0: 2, 1: 68, 2: 219, 3: 1203, 4: 5403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085171814_1085171817 23 Left 1085171814 11:74456122-74456144 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403
1085171813_1085171817 27 Left 1085171813 11:74456118-74456140 CCAGCCTGGGCAACATGTGAAAC 0: 34
1: 326
2: 1368
3: 11678
4: 72278
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403
1085171815_1085171817 5 Left 1085171815 11:74456140-74456162 CCCTGTCTCTACTTAAATATATA 0: 1
1: 14
2: 455
3: 7440
4: 22355
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403
1085171816_1085171817 4 Left 1085171816 11:74456141-74456163 CCTGTCTCTACTTAAATATATAT 0: 2
1: 16
2: 135
3: 1461
4: 18583
Right 1085171817 11:74456168-74456190 ATATATATATATAAATTAACTGG 0: 2
1: 68
2: 219
3: 1203
4: 5403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085171817 Original CRISPR ATATATATATATAAATTAAC TGG Exonic