ID: 1085171819

View in Genome Browser
Species Human (GRCh38)
Location 11:74456174-74456196
Sequence ATATATAAATTAACTGGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87707
Summary {0: 1, 1: 57, 2: 1815, 3: 24649, 4: 61185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085171814_1085171819 29 Left 1085171814 11:74456122-74456144 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1085171819 11:74456174-74456196 ATATATAAATTAACTGGGTGTGG 0: 1
1: 57
2: 1815
3: 24649
4: 61185
1085171816_1085171819 10 Left 1085171816 11:74456141-74456163 CCTGTCTCTACTTAAATATATAT 0: 2
1: 16
2: 135
3: 1461
4: 18583
Right 1085171819 11:74456174-74456196 ATATATAAATTAACTGGGTGTGG 0: 1
1: 57
2: 1815
3: 24649
4: 61185
1085171815_1085171819 11 Left 1085171815 11:74456140-74456162 CCCTGTCTCTACTTAAATATATA 0: 1
1: 14
2: 455
3: 7440
4: 22355
Right 1085171819 11:74456174-74456196 ATATATAAATTAACTGGGTGTGG 0: 1
1: 57
2: 1815
3: 24649
4: 61185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085171819 Original CRISPR ATATATAAATTAACTGGGTG TGG Exonic