ID: 1085178163

View in Genome Browser
Species Human (GRCh38)
Location 11:74508729-74508751
Sequence GTGGAGAACAGGCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 587}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085178158_1085178163 10 Left 1085178158 11:74508696-74508718 CCATTTTTGTTTTAAGATCAAGC 0: 1
1: 0
2: 3
3: 27
4: 440
Right 1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG 0: 1
1: 0
2: 3
3: 53
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085178163 Original CRISPR GTGGAGAACAGGCTTGAGGA AGG Intronic
900395827 1:2452884-2452906 GAGGAGGACAGCCTGGAGGAAGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
904584404 1:31571965-31571987 ATGCAGGACAGGCTGGAGGAAGG - Intergenic
904824580 1:33266039-33266061 GGGAAGAACAGACTTCAGGAAGG - Intronic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905473733 1:38211490-38211512 GTGGGGAACAGGTTTGCAGAGGG - Intergenic
905780046 1:40700906-40700928 GTGGAGAATAAGCTGGAGAAGGG - Intronic
906096534 1:43228054-43228076 GTGGAGACCAGACTGGAGGCTGG - Intronic
906867787 1:49441240-49441262 CTGGAGAACAGGCATGGGAATGG + Intronic
906879390 1:49574197-49574219 CTGGAGAACAGGCATAAGAATGG + Intronic
907571405 1:55487495-55487517 GTGGTGAATAGGCTTGGGGGAGG + Intergenic
908258052 1:62318769-62318791 GTGGAGAACACTGGTGAGGAGGG - Intronic
908737266 1:67289822-67289844 CTGGAGAACAGGCATGGGAATGG + Intergenic
908880991 1:68733109-68733131 GTGGAGAAAATGCTTCAAGATGG - Intergenic
909576607 1:77183586-77183608 CTGGAGAACAGGCATGGGAATGG + Intronic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910831456 1:91465983-91466005 CTGGAGAACAGGCATGGGAATGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911763227 1:101640683-101640705 TTGGAGAACATACCTGAGGATGG + Intergenic
912050963 1:105527216-105527238 CTGGAGAACAGGCATGGGGATGG - Intergenic
912066730 1:105754323-105754345 CTGGAGAACAGGTATGAGAAAGG + Intergenic
912252133 1:108022080-108022102 CTGGAGAACAGGCATGGGAATGG - Intergenic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912944123 1:114070449-114070471 CTGGAGAACAGGCATGAGAATGG - Intergenic
913481674 1:119294774-119294796 TTGGAGAACAGGCAGGAGGGTGG - Intergenic
913963606 1:143357115-143357137 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
914057966 1:144182704-144182726 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
914121180 1:144783661-144783683 GTGGAGGGAAGGCTAGAGGAAGG + Intergenic
915492926 1:156261453-156261475 GTGGAGAACAGCAGTGAGCAAGG + Intronic
915972649 1:160365452-160365474 GGGGAAAGGAGGCTTGAGGAGGG - Intergenic
917454074 1:175170788-175170810 GGGGAGAACAGGCCGGAGGGAGG - Intronic
917494351 1:175526551-175526573 GTACAGAACAGGCTTGAAGCTGG + Intronic
917737656 1:177935113-177935135 GTGGAGATCAGGGTGGAGCATGG - Intronic
917764405 1:178201119-178201141 CTGGAGAACAGGCATGGGAATGG + Intronic
918348507 1:183628932-183628954 GTGGAGAACAGATTTGAAGGAGG + Intronic
918814810 1:189168980-189169002 CTGGAGAACAGGCATGGGAATGG + Intergenic
919124949 1:193382415-193382437 TTGGAGAACAGGCATGGGAATGG - Intergenic
919230306 1:194764830-194764852 CTGGAGAATAGGCATGGGGATGG - Intergenic
919241508 1:194922233-194922255 CTGGAGAACAGGCATGAGAATGG + Intergenic
920110616 1:203584592-203584614 GTGTGGAACAGGCTTGGAGAAGG - Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920197123 1:204236089-204236111 CTGGAGAACAGGCATGGGAATGG + Intronic
920541236 1:206779567-206779589 GTGGAGAACGGTCTAGAGAATGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921914838 1:220595732-220595754 GTGGATAACAGGTTGGAGGATGG + Intronic
922029234 1:221781992-221782014 CTGGAGAAGAGGCTAGAGGTGGG - Intergenic
922074957 1:222234597-222234619 TTGGAGACCAGGCCTGAGGGTGG - Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922322605 1:224501940-224501962 GTGGTGAGGAGGCTGGAGGAAGG + Intronic
922988134 1:229882633-229882655 GTGGAGAGCATGCCAGAGGAGGG - Intergenic
923032713 1:230262821-230262843 GAGGAGAACAGGGTTGGGGCAGG - Intronic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923981427 1:239328362-239328384 GAGGACAGCAGGCTTGAGAAAGG - Intergenic
1062770782 10:98946-98968 CTGGAGAACAGGCATGGGAATGG - Intergenic
1062866695 10:861728-861750 GTGAAGATCTGTCTTGAGGATGG - Intronic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1064012400 10:11744951-11744973 GTGGAGGACAGAATTCAGGATGG + Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064517947 10:16170509-16170531 CTGGAGAACAGGCATGGGAATGG - Intergenic
1064545949 10:16450077-16450099 CTGGAGAACAGGCATGGGAATGG - Intronic
1065342048 10:24716713-24716735 GTGGAGAACAGGCTTTAGGCTGG + Intronic
1065852760 10:29804640-29804662 GTGGAGAACAGGCTGGATTTAGG + Intergenic
1065882360 10:30047664-30047686 CTGCAGAACGGGCATGAGGATGG - Exonic
1066067896 10:31775497-31775519 GAGGAGAACAGGGGAGAGGAAGG + Intergenic
1066372039 10:34825390-34825412 GTGGAAAACAGGCTTGAAGGTGG - Intergenic
1067012589 10:42728348-42728370 GTGGAGAAGAGGGTGGAGGGAGG + Intergenic
1067073990 10:43162385-43162407 GTGGAGACCAGGCTTAAGCTGGG - Intronic
1067332852 10:45337946-45337968 CTGGAGAACAGGCATGAGAATGG + Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1067698904 10:48554713-48554735 GTGCAGAACAGGCTTCAGAGGGG - Intronic
1067848591 10:49741013-49741035 GTGGGGGACAGGCTGCAGGAGGG - Intronic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068225645 10:54103877-54103899 CTGGAGAACAGGCATGGGAATGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068837539 10:61570870-61570892 CTGGAGAACAGGCATGGGAATGG - Intergenic
1069873413 10:71547070-71547092 GTGGAGAGCAGACTTGGGCATGG + Intronic
1071541812 10:86492025-86492047 GTGGATACCAGGGATGAGGAGGG - Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1071937404 10:90547049-90547071 CTGGAGAACAGGCATGGGAATGG + Intergenic
1071943076 10:90610052-90610074 CTGGAGAACAGGCATGGGAATGG - Intergenic
1072356284 10:94614819-94614841 GTGGCAAACAGACTTGAAGATGG - Intergenic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073402012 10:103265526-103265548 GTGGAGAACAGCCTTTAGGAGGG + Intergenic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1073557033 10:104463631-104463653 CTGGAGAACAGGCATGGGAATGG + Intergenic
1074184019 10:111085854-111085876 TTGGGGAACAGGCTGGAGGGAGG + Intergenic
1074213326 10:111359252-111359274 TGGGAAAACAGGCTTAAGGAAGG + Intergenic
1074485001 10:113867563-113867585 GGCTAGAACAGCCTTGAGGAAGG - Intronic
1074944581 10:118269169-118269191 CTGAAAAACAGGCTTGACGAAGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075700584 10:124467179-124467201 GTGGAGAACAGGCTGGCAGTAGG + Intronic
1076927718 10:133501503-133501525 CTGGAGAACAGGCATGGGAATGG - Intergenic
1076988135 11:253988-254010 ATGGAGGACAGGTTTGAGGCTGG - Intergenic
1077018265 11:406465-406487 GTGCAGTACAGGCCTGTGGAAGG - Exonic
1077222094 11:1422310-1422332 GTGGAGGAGCGGCTGGAGGAGGG - Intronic
1077503136 11:2918165-2918187 GTGGGGCACAGGCCAGAGGAAGG - Intronic
1079244526 11:18742951-18742973 GAGGAGGACAGCCTTGAGGTTGG + Intronic
1080104768 11:28500402-28500424 ATTAAGAACAGGCTTGAGGGTGG + Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080778662 11:35410036-35410058 CTGGAGAACAGGATTGGGGCCGG + Intronic
1081072492 11:38628821-38628843 CTGGAGAGCAGGCATGAGAATGG + Intergenic
1081608734 11:44545561-44545583 CTGGAGAACAGGCATGGGAATGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082657990 11:55874350-55874372 GTGGAGAACGTCCTGGAGGAGGG - Intergenic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083712598 11:64558443-64558465 GTGGAGGACGGACTTGGGGATGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085242598 11:75071220-75071242 GTTGAGAACAGGTGTGAGAATGG + Intergenic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085747276 11:79125952-79125974 CTGGAGAACAGGCATGGGAACGG + Intronic
1085848875 11:80097313-80097335 GGAGAGAACAGGGTTGCGGAAGG + Intergenic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1086392030 11:86375060-86375082 GTGGAGAAGGGGCTGGAGGGTGG + Exonic
1086833828 11:91598102-91598124 CTGGAGAACAGGCATGGGAATGG + Intergenic
1087194811 11:95294650-95294672 GAAGAGCAGAGGCTTGAGGAAGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088264849 11:107979259-107979281 GTGGAGAACAGGCATGGGAATGG + Intergenic
1088326559 11:108606705-108606727 GAGGAGAGGAGGCTTGAGGGAGG - Intergenic
1088469707 11:110179053-110179075 GTGGAGCACAATTTTGAGGAGGG + Intronic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1088972713 11:114787792-114787814 GTTGAGGAGAGGCTTGAGAAAGG - Intergenic
1089097829 11:115934233-115934255 GGGGAGAACTGGCAGGAGGAAGG - Intergenic
1089231405 11:116980332-116980354 GCGGAAAAGAGGGTTGAGGAAGG - Intronic
1091138276 11:133212469-133212491 ATGGAGCAAAGACTTGAGGAAGG - Intronic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091829930 12:3542380-3542402 GTGGAGAGCAGGGTCAAGGAAGG - Intronic
1093032201 12:14298500-14298522 CTGGAGAACAGGCATGGGAATGG - Intergenic
1093049219 12:14487247-14487269 CTAGAGAACAGGCATGGGGATGG - Intronic
1093049957 12:14493245-14493267 CTGAAGAACAGGCATGGGGATGG - Intronic
1093511188 12:19930309-19930331 GTGGAGAAGAGGCATAAGAAAGG - Intergenic
1095603784 12:44043810-44043832 CTGGAGAACAGGCATGGGAATGG + Intronic
1095844767 12:46732776-46732798 CTGGAGAACAGGCATGGGAATGG - Intergenic
1096867135 12:54571321-54571343 TTGCAGAACAGGCTTCCGGAAGG - Intronic
1097054096 12:56239749-56239771 GGGGAGAAGAGGCTGGAGGTGGG - Exonic
1097624879 12:61988038-61988060 GTGGATAACAGCCAGGAGGAAGG + Intronic
1098715751 12:73827162-73827184 CTGGAGAACAGGCATGGGAATGG + Intergenic
1099365642 12:81763167-81763189 CTGGAGAACAGGCATGGGAATGG + Intergenic
1100083025 12:90875943-90875965 CTGGAGAACAGGCTTGGGAATGG + Intergenic
1100601220 12:96113118-96113140 GGAGAGGACAGGGTTGAGGATGG - Intergenic
1101263823 12:103063820-103063842 CTGGAGAACAGGCATGGGAATGG + Intergenic
1101344961 12:103878500-103878522 GGGAAGAAGAGGCTTGAGGAGGG - Intergenic
1101542781 12:105680363-105680385 CTGGAGAACAGGCATGGGAATGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1103396207 12:120609160-120609182 CTGGAGAACAGGCATGGGAATGG + Intergenic
1104998603 12:132674500-132674522 GTAGAGAAGGGGCTTGAGGCAGG - Intronic
1106541486 13:30694633-30694655 CTGCAGAGCAGGCTTGAGGAGGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107424704 13:40281485-40281507 CTGGAGAACAGGCATGGGAATGG - Intergenic
1107490173 13:40874054-40874076 CTGGAGAACAGGCATGGGAATGG + Intergenic
1107652868 13:42562044-42562066 GTGGAGAATAGGTTTCAGGGAGG - Intergenic
1107767819 13:43756435-43756457 GGAGAGAAGAGGGTTGAGGAGGG + Intronic
1107983871 13:45758258-45758280 CTGGAGAACAGGCATGGGAATGG - Intergenic
1108260019 13:48646810-48646832 TTGGAAAATAGGCATGAGGAAGG - Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1109515986 13:63443011-63443033 CTGGAGAACATGCATGAGAATGG + Intergenic
1109951310 13:69504450-69504472 CTGGAGAACAGGCATGGGAATGG - Intergenic
1110080999 13:71311622-71311644 GTGGAGAAAAGGGTGAAGGAGGG + Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1111576043 13:90155056-90155078 CTGGAGAACAGGCATGGGAATGG - Intergenic
1111814556 13:93134344-93134366 GTGGAGAACATGTTTCAAGATGG + Intergenic
1112250231 13:97772508-97772530 CTGGAGAACAGGCATGGGAATGG - Intergenic
1112331204 13:98478270-98478292 GGGGAGGACAGGCTCGGGGAGGG - Intronic
1112907634 13:104444169-104444191 GTGGAGAATAGGCTGGAAAAAGG + Intergenic
1114032378 14:18588289-18588311 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114077159 14:19167315-19167337 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114085005 14:19232249-19232271 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1114158633 14:20136667-20136689 GTGGAGAATGGGTTTGAGGGAGG - Intergenic
1114840313 14:26255389-26255411 GTGGAGAAGAGACTGGAAGAGGG + Intergenic
1115425530 14:33254513-33254535 GGAGATAAAAGGCTTGAGGAAGG - Intronic
1115573168 14:34686236-34686258 GTGGAGAACAAGCAGGAGGTGGG + Intergenic
1116058616 14:39894648-39894670 CTGGAGAACAGGCATGGGAATGG + Intergenic
1116158686 14:41238964-41238986 CTGGAGAACAGGCATGGGAATGG - Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116926966 14:50649162-50649184 TTTGAGAAGAGGCTTGAAGAGGG - Intronic
1117077497 14:52118904-52118926 GAGGAGGACAGGCATGGGGAGGG + Intergenic
1117216525 14:53557816-53557838 CTGGAGAACAGGCATGGGAATGG + Intergenic
1117366976 14:55038767-55038789 GTGGAGAACAGGGTGGAACATGG - Intronic
1118293688 14:64549577-64549599 GGGGAGAGCAGGGTTGAGGTGGG - Intergenic
1120556295 14:85932731-85932753 CTGGAGAACAGGCATGGGAATGG - Intergenic
1121016258 14:90551155-90551177 GAGGAGAACAGCCTTGCTGAAGG + Intronic
1121057254 14:90867860-90867882 GTGGACAACAGCCTTGTGTAGGG + Exonic
1121266013 14:92603100-92603122 GTGGAGACCAGGGCTAAGGAGGG + Intronic
1121371069 14:93359002-93359024 CTGGAGAACAGGCATGGGAATGG + Intronic
1122077813 14:99246816-99246838 GAGGAGGCCAAGCTTGAGGAGGG + Intronic
1122290309 14:100677359-100677381 GCGCAGAGCAGGCTTGAGGAGGG - Intergenic
1122503967 14:102219850-102219872 GAGGAGGACAGGTTTGAGGGCGG + Intronic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1123118999 14:105908420-105908442 GGGGAGAAAGGGCTGGAGGAGGG + Intergenic
1123143741 14:106108363-106108385 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123191841 14:106579133-106579155 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123987177 15:25656255-25656277 GGGGAGAGGGGGCTTGAGGAAGG + Intergenic
1124135840 15:27035710-27035732 GTGGACAGCAGGATTGGGGAAGG + Intronic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1127242919 15:57138092-57138114 GGAGAGAACTGGCTTAAGGATGG - Intronic
1127848364 15:62891392-62891414 GTGGAGAACAGGGCTGTGGTGGG - Intergenic
1127981751 15:64040405-64040427 GGTGAGAAAAGGCTTGAGCAGGG - Intronic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1128971858 15:72115220-72115242 GAGGAGAAAAGGTTTTAGGATGG - Intronic
1129198503 15:73984878-73984900 GTGGCCAACAGGGTTGGGGAAGG + Intronic
1129961692 15:79692349-79692371 CTGGAGAACAGGCATGGGAATGG - Intergenic
1131225798 15:90623649-90623671 GTGGCTAACAGACTTGGGGAAGG - Intronic
1131286592 15:91064198-91064220 GAGGAGGGCAGGCTTGATGAAGG - Intergenic
1132148318 15:99441816-99441838 GTAGAGAAAAAGCTTGGGGATGG - Intergenic
1132375996 15:101328540-101328562 GAGGAGGACAGCCTTGGGGAGGG + Intronic
1133713107 16:8420519-8420541 GTGGAGAACAGATTAGAAGAGGG + Intergenic
1133958228 16:10466021-10466043 TAGGAGAACAGGCATGAGGCAGG - Intronic
1134505353 16:14801483-14801505 CTGGAGCACAGGCTTGACAATGG - Intronic
1134575225 16:15327427-15327449 CTGGAGCACAGGCTTGACAATGG + Intergenic
1134727221 16:16429065-16429087 CTGGAGCACAGGCTTGACAATGG - Intergenic
1134940216 16:18282790-18282812 CTGGAGCACAGGCTTGACAATGG + Intergenic
1135994364 16:27237249-27237271 CTGGAGAGCAGGCATCAGGAGGG + Intronic
1137893561 16:52186959-52186981 CTGGAGAATCGGCTTCAGGATGG - Intergenic
1138356277 16:56383542-56383564 GGGAGGAACAGGCATGAGGATGG - Intronic
1138868098 16:60848490-60848512 CTGGAGAACAGGCATGGGAATGG + Intergenic
1139574290 16:67831519-67831541 GTGGAGGAGAGACTTGGGGAGGG - Intronic
1140930186 16:79620319-79620341 GGGGAAAAAAGGCTTGTGGATGG - Intergenic
1141677793 16:85526610-85526632 GTGGAGAGCAGGGATGGGGAGGG + Intergenic
1141786044 16:86201498-86201520 CTGGAGGCCAGGCTTGAGAAGGG + Intergenic
1142364790 16:89644564-89644586 GTGGGTAACAGCCTTGGGGAGGG - Exonic
1142751291 17:1989486-1989508 CTGGATCACAGGCTTGAGAAGGG + Intronic
1143097754 17:4487563-4487585 GTTGAGAACAGACTGTAGGAGGG + Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1146475904 17:33162600-33162622 GAGGAGAAGTGGCTGGAGGAGGG - Intronic
1146758534 17:35454867-35454889 CTGGAGAACAGGCATGGGAATGG + Intergenic
1146836201 17:36112882-36112904 CTGGAGAACAGGCATGGGAATGG + Intergenic
1147338607 17:39740943-39740965 TTGGAGAACAGGCTGGGGGCTGG + Intronic
1147941780 17:44053872-44053894 GCAGAGAACAGGCTTGGGGTGGG - Intronic
1148152127 17:45403114-45403136 ATGGGGAACAGTCTTGAGGGTGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1150848259 17:68680773-68680795 GTGGAGAATAGACTTTAGGATGG + Intergenic
1151445312 17:74159813-74159835 GTGGAGAACAGACTCCAGGTGGG - Intergenic
1151598769 17:75093806-75093828 GTGGAGCACAGCCGTGAGGATGG - Exonic
1152133581 17:78491558-78491580 GTGGAGAACAGGCCTGGGGGAGG + Exonic
1152748066 17:82050307-82050329 GTGGAAAGCTGGCTTGAGAAGGG - Intronic
1153131568 18:1859980-1860002 CTGGAGAACAGGCATGGGAATGG - Intergenic
1153364140 18:4235110-4235132 CTGGAAAACAGGTTTGAGTAGGG - Intronic
1154068169 18:11128845-11128867 CTGGAGAACAGGCCTGGGAATGG + Intronic
1155337796 18:24783202-24783224 GTGGAGATCTGGCAGGAGGAGGG - Intergenic
1155573544 18:27220917-27220939 CTGGAGAACAGGCATGGGAATGG + Intergenic
1156192345 18:34734003-34734025 CTGGAGAACAGGCATGGGAATGG - Intronic
1157078264 18:44492526-44492548 GTGGAGAATGGGCTGGAGGGTGG + Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157518152 18:48325791-48325813 GTGAAGAAAGGGCTTGTGGAGGG + Intronic
1157584560 18:48792782-48792804 GTGGGGAAGATGCTTCAGGAGGG + Intronic
1157909512 18:51602291-51602313 TTGGAGAACAGGCATGAGAAGGG - Intergenic
1158212975 18:55070724-55070746 GAAGAGAACAGGCATGGGGAGGG - Intergenic
1159467526 18:68803993-68804015 GTGGAGAACATACTGGAGTAGGG + Intronic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159559386 18:69977453-69977475 CTGGAGAACAGGCATGGGAATGG - Intergenic
1159773556 18:72577468-72577490 GTGGAGAACAGGGGTCAGCATGG - Intronic
1159943420 18:74426139-74426161 GTCGAGAACAGGCCTGGGGGAGG - Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1160905835 19:1451425-1451447 GTGGGGATCAGGCTTGGGGTTGG - Exonic
1161676752 19:5655108-5655130 GTGGAGAGCAGGCTAGAGGGAGG - Intronic
1163655329 19:18542520-18542542 TTGGAGAAGAGGCTGGAGGTGGG - Intronic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165737061 19:38183513-38183535 GTGGGGAGCAGGCTTGGGGAAGG + Intronic
1166427516 19:42692706-42692728 GTGGAGGTCAGGCTGGAGGTGGG + Intronic
1166505049 19:43365732-43365754 GTGCAGACCAGGCTTATGGATGG - Intergenic
1166505490 19:43369182-43369204 GTGCAGACCAGGCTTATGGATGG + Intergenic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1167105289 19:47426855-47426877 GATGAGAACAGGTTTGTGGAAGG - Intergenic
1167721041 19:51180671-51180693 GTGGAGAACAGATTGGAGGTGGG - Intergenic
1168241155 19:55089508-55089530 ATGGAGAACAGGCTGGGGGTTGG - Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168434219 19:56304571-56304593 GAGGAGAACTGGCTGGAAGATGG + Intronic
1168469778 19:56630566-56630588 GTGGAGAACAGGCTGGGGGCAGG + Intergenic
1168644031 19:58048441-58048463 TTGGAGACCAGGCTGGACGATGG + Intronic
1202697449 1_KI270712v1_random:135372-135394 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
925051575 2:819648-819670 GAGGAGATCAGGCTCGTGGAGGG + Intergenic
925404742 2:3598726-3598748 GTGGAGAGGAGGCTGGAGGCGGG + Intronic
925460426 2:4058183-4058205 CTGGAGAACAGGCATGGGAATGG + Intergenic
926758514 2:16254942-16254964 ATGGAGTGAAGGCTTGAGGAAGG + Intergenic
927008606 2:18878817-18878839 CTGGAGAACAGGCATGGGCATGG + Intergenic
927241876 2:20926333-20926355 GTGGAGAACAGGATTGTGATGGG + Intergenic
928100207 2:28432377-28432399 GTGGAGTAGAGGCTGGAGGTAGG - Intergenic
929575471 2:43049335-43049357 GTGGAGCACAGAGTTGAGCAGGG - Intergenic
930122764 2:47773265-47773287 GTGGAGGACAGATTAGAGGAGGG + Intronic
930559188 2:52938820-52938842 GTAGGGATCAGGCTTGGGGATGG + Intergenic
930999137 2:57760138-57760160 GTGGACAAAAGGCCCGAGGAGGG - Intergenic
931951565 2:67369226-67369248 GTAGTGAACAGACTTGAAGATGG + Intergenic
932735068 2:74248612-74248634 ATGGAGAACAGGATTTAGGGAGG - Intronic
932870778 2:75395684-75395706 CTGGAGAACAGGCATGGGAATGG - Intergenic
934050577 2:88207189-88207211 TTGGAGAAAAGGTTTGTGGATGG + Intergenic
934278619 2:91592396-91592418 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
936786651 2:116101380-116101402 TTGGAGAAAAAGCTTGAGGTAGG - Intergenic
937800036 2:126072456-126072478 CTGGAGAACAGGCTTGGGAATGG + Intergenic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
939213524 2:139209622-139209644 CTGGAGAACAGGCATGGGAATGG + Intergenic
939638626 2:144612551-144612573 GTAGAGAAGAGACTTGGGGATGG + Intergenic
940033092 2:149285671-149285693 GTGGAGGTCAGGATAGAGGAGGG - Intergenic
940055422 2:149507921-149507943 GTTGGGAACAGGGGTGAGGAGGG - Intergenic
940171624 2:150835016-150835038 CTGGAGAACAGGCATGGGAAAGG - Intergenic
940606215 2:155926654-155926676 CTGGAGAACAGGCATGGGAATGG - Intergenic
940829458 2:158452257-158452279 GTGGAGAACAGGGGTGAGGGGGG + Intronic
941166725 2:162090805-162090827 GTGGTGACCAGGTTTGGGGATGG + Intergenic
941330972 2:164176872-164176894 CTGGAGAACAGGCATGGGAATGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941580902 2:167294023-167294045 CTGGAGCGCAGACTTGAGGATGG + Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942171883 2:173297556-173297578 GGGGAGTGCAGGCTTGAAGATGG + Intergenic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943256323 2:185598075-185598097 GTTGAGAATAGTATTGAGGAGGG + Intergenic
943392202 2:187284095-187284117 CTGGAGAACAGGCATGGGGATGG - Intergenic
943561912 2:189473820-189473842 CTGGAGAGCAGGCTGAAGGATGG - Intronic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
945164208 2:206924806-206924828 GTGGAGAACAGATTAGAGCAGGG + Intergenic
945205637 2:207329024-207329046 GTTGATAACAGGGTGGAGGAGGG + Intergenic
945405337 2:209440860-209440882 CTGGGTAACAGGCTTCAGGAGGG - Intronic
945726111 2:213473762-213473784 CTGGAGAACAGGCATGGGAATGG - Intronic
945985840 2:216352770-216352792 TGGGAGGGCAGGCTTGAGGAGGG - Intronic
946447813 2:219754727-219754749 CAGGAGAACAGGCTGGAAGAGGG - Intergenic
946479794 2:220043810-220043832 GTTGAGAACAGTCTGGAGCAGGG + Intergenic
948607725 2:239146729-239146751 GTGGAGCAGAGGCCTGTGGAAGG - Intronic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1169047120 20:2542278-2542300 GTGGAGAAGAAGCTTGACAAAGG + Intronic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1171019217 20:21569944-21569966 GACAAGAACAGGCTGGAGGAGGG + Intergenic
1171296597 20:24022326-24022348 GAGGAGAACAACCTTGAGGTGGG + Intergenic
1172031351 20:31984332-31984354 GTGAAGACAAGGCTTGAAGAGGG + Intronic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1173465341 20:43276450-43276472 ATGGAGAACAGATTGGAGGAAGG + Intergenic
1173890997 20:46510232-46510254 GTGAAGAACAGCCTTGAGGTGGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174295840 20:49544436-49544458 GTGGAGAAGAGTCCTGAGGCAGG + Exonic
1174324899 20:49771373-49771395 TAGGGGAACAGGTTTGAGGAGGG - Intergenic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1176708862 21:10133679-10133701 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1176948180 21:15009949-15009971 TTGGAGGACAGGCTAGAAGATGG + Intronic
1176997858 21:15577933-15577955 CTGGAGAACAGGCATGAGAATGG + Intergenic
1177265853 21:18782767-18782789 GTGGTGAAGAGGCTTGATAAAGG - Intergenic
1178536088 21:33411454-33411476 ATGGTGAACAGGCGTGTGGAGGG + Intronic
1178764124 21:35433227-35433249 CTGGAGAACAGGCATGGGAATGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179137938 21:38697035-38697057 GTGGAGGACTGGCTTGTGCAGGG - Intergenic
1180292965 22:10860944-10860966 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180456489 22:15515346-15515368 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180495771 22:15890366-15890388 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180898438 22:19353898-19353920 GTGGAGACCAGGCCTGGGCAGGG + Intronic
1181164414 22:20975793-20975815 GTGGGAAACAGGCCCGAGGAGGG + Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1182269657 22:29145438-29145460 GCGGGGAACAGGGGTGAGGATGG - Intronic
1183026288 22:35067953-35067975 ATCGAGAGCTGGCTTGAGGAAGG + Intronic
1183924218 22:41194308-41194330 GTGGAGAATAGGTTTTAGGGTGG + Intergenic
1184129396 22:42508815-42508837 GGGGAGAACAGACTTGGAGAGGG + Intergenic
1184603868 22:45560688-45560710 CTGGAGAACGGGCATGAGAATGG - Intronic
1185302186 22:50087662-50087684 GTGGAGAGCAGGCTGGGGGGTGG + Intergenic
949407656 3:3731739-3731761 GTGGATAACAGTCATGAGCAAGG + Intronic
949417954 3:3833482-3833504 CTGGAGAACAGGTTTGGGAATGG - Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949638485 3:6010225-6010247 CTGGAGAACAGGCATGGGAATGG + Intergenic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950414113 3:12858577-12858599 GTGGATGCCAGGCCTGAGGAAGG - Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
951384242 3:22025462-22025484 CTGGAGAACAGGCATGGGAATGG + Intronic
951992107 3:28686972-28686994 GTGAAGAACAGACTGGATGATGG + Intergenic
952261242 3:31742579-31742601 CTGTAAAACAGGCTTGGGGAAGG - Intronic
954053814 3:48005403-48005425 CTGGAGAACAGGCATGGGAATGG + Intronic
954615798 3:51968049-51968071 GCGCAGGACAGGCTGGAGGAGGG + Intronic
954636081 3:52071591-52071613 GGAGAGCACAGGCTTGAGGGTGG - Intergenic
954965260 3:54604770-54604792 GTGGAGAATAGGCTGGATGCTGG - Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955604995 3:60692087-60692109 GTGGAAAACCTGCTAGAGGATGG - Intronic
955873037 3:63460064-63460086 GTGGAGAATAGCTTGGAGGAAGG - Intronic
956509347 3:69978068-69978090 CTGGAGAACAGGCATGGGAATGG + Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957247830 3:77735625-77735647 CTGGAGAACAGGCATGGGAATGG - Intergenic
957342895 3:78923655-78923677 CTGGAGAGGTGGCTTGAGGAAGG - Intronic
958789140 3:98630881-98630903 CTGGAGAACAGGCATGGGAATGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
960148384 3:114227300-114227322 GGGGAGAAGAGGGTTGAAGAGGG + Intergenic
960456118 3:117874417-117874439 GTGGAGAACAGCTTGGGGGAGGG - Intergenic
960632319 3:119744501-119744523 GTGGAGCACAGGCTGGAGGGAGG + Intronic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
961110283 3:124277694-124277716 GTGGAGAACAGAATGGAGGAAGG + Intronic
962006677 3:131356730-131356752 GTGGAGAGCAGGTTTGAAAAGGG + Intergenic
962770946 3:138609323-138609345 GTCGCGAACAGGCCGGAGGAGGG - Intronic
963432652 3:145229638-145229660 CTGGAGAACAGGCATGGGAATGG - Intergenic
963453434 3:145514802-145514824 CTGGAGAACAGGCATGGGAATGG + Intergenic
963738398 3:149048535-149048557 ATGGCAAACAGGTTTGAGGATGG + Intronic
963890905 3:150635100-150635122 GCTGAAAACAGTCTTGAGGAAGG + Intergenic
964814687 3:160704183-160704205 GTGTACAACAGGCTGGAGAAAGG + Intergenic
965251773 3:166351934-166351956 CTGGAGAACAGGCATGGGAATGG - Intergenic
965709502 3:171543154-171543176 GTGGAGATCAGGTTTCAGGGAGG - Intergenic
967144788 3:186597479-186597501 GCGGAGGACAGGCTGGAGCACGG - Intergenic
967831467 3:193923690-193923712 CTGGAGAACAGGCATGGGAATGG + Intergenic
968906562 4:3455330-3455352 CTGGAGAACAGGCATGGGAATGG + Intergenic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
971685256 4:29757289-29757311 CTGGAGAACAGGCATGAGAATGG + Intergenic
971938382 4:33183806-33183828 TTGTGGTACAGGCTTGAGGAAGG - Intergenic
972192614 4:36612982-36613004 CTGGAGAACAGGCATGGGAATGG + Intergenic
972456087 4:39256797-39256819 ATGGAGAACAGGATGGATGAAGG - Intronic
972885739 4:43484767-43484789 GTGGAGAACAGTGTTGTGGATGG + Intergenic
974289302 4:59910472-59910494 CTGGAGAACAGGCATGGGAATGG + Intergenic
974644908 4:64677070-64677092 CTGGAGAACAGGCATGGGAATGG - Intergenic
974726788 4:65809170-65809192 CTGGAAAACAGGCATGAGAAAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975201673 4:71597581-71597603 GTGGATGACAGGTTAGAGGAAGG - Intergenic
975733997 4:77364313-77364335 CTGGAGAACAGGCATGGGGATGG - Intronic
976361948 4:84190118-84190140 GAGGAGATGGGGCTTGAGGAAGG + Intergenic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
977430466 4:96925928-96925950 CTGGAGAACAGGCATGGGAATGG + Intergenic
977490381 4:97702351-97702373 CTGGAGAACAGGCATGGGAATGG - Intronic
977626895 4:99197618-99197640 CTGGAGAACAGGCATGGGAATGG - Intergenic
977702034 4:100032182-100032204 CTGGAGAACAGGCATGGGAATGG - Intergenic
978295628 4:107201529-107201551 CTGAAGAACAGGCTTGAGATAGG + Intronic
978350144 4:107812729-107812751 GTAGAGAACAGGGCTGAGAAGGG - Intergenic
978542267 4:109830596-109830618 GGGAAGAACAGGTTTGAGGCAGG + Intronic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
980388207 4:132113403-132113425 CTGGAGAACAGGCATGGGAATGG - Intergenic
980957472 4:139444078-139444100 CTGGAGAACAGGCATGGGAATGG + Intergenic
981051720 4:140315815-140315837 GTGGAAAAAAGGCCTGAGGCAGG - Intronic
981350875 4:143728272-143728294 GTGGAGAACAGACTAGACGAGGG - Intergenic
981834559 4:149040164-149040186 CTGGAGAACAGGCATGGGAATGG + Intergenic
983922089 4:173357110-173357132 GTGGAGATTAGGATTGAGGAAGG + Intergenic
984061361 4:174992102-174992124 CTGGAGAACAGGCATGGGAATGG - Intergenic
984400847 4:179261864-179261886 CTGGAGAACAGGCATGGGAATGG + Intergenic
984846337 4:184111102-184111124 GTGGAAAACAGGCTTAGGTAGGG - Intronic
986616544 5:9623296-9623318 GTTTGGAACAGGCTAGAGGAAGG - Intergenic
986736915 5:10674772-10674794 GTGAATGGCAGGCTTGAGGAAGG - Intergenic
987134100 5:14884911-14884933 GTGGAGAAGAGGCTGGGGAAGGG + Intergenic
987152876 5:15059382-15059404 CTGGAGAACAGGCATGGGAATGG + Intergenic
987578650 5:19760628-19760650 CTGGAGGACAGGCATGGGGATGG - Intronic
987712144 5:21514208-21514230 GTGGGGAAGAGACTGGAGGAAGG - Intergenic
987885329 5:23805583-23805605 CTGGAGAACAGGCATCAGAATGG + Intergenic
988267781 5:28973650-28973672 CTGGAGAACAGGCCTGGGAATGG - Intergenic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991762506 5:69933344-69933366 GTGGGGAAGAGACTGGAGGAAGG - Intergenic
991784819 5:70184762-70184784 GTGGGGAAGAGACTGGAGGAAGG + Intergenic
991841734 5:70808394-70808416 GTGGGGAAGAGACTGGAGGAAGG - Intergenic
991877266 5:71185155-71185177 GTGGGGAAGAGACTGGAGGAAGG + Intergenic
991945843 5:71897842-71897864 CTGGAGAACAGGCATGGGAATGG + Intergenic
991955261 5:71987870-71987892 GTGGGGTAGAGGCTTGTGGATGG + Intergenic
992265833 5:75017586-75017608 GTTGAGAAGATGCTTTAGGAAGG + Intergenic
992795711 5:80253701-80253723 GTGGTAAGCAGCCTTGAGGAGGG - Intronic
993232190 5:85249837-85249859 CTAGAGAACAGGCATGAGAATGG - Intergenic
993394333 5:87364706-87364728 GTAGGGAACTGGTTTGAGGAAGG - Intronic
994042009 5:95269548-95269570 TTGGAGAGAAGGCTAGAGGAAGG - Intronic
994543638 5:101132673-101132695 GGGCAGGACAGACTTGAGGAAGG - Intergenic
994984712 5:106918020-106918042 CAGGAGAACAGGCATGAGAATGG - Intergenic
995259383 5:110084046-110084068 GTGGAGAGCAGGATGGAGAATGG - Intergenic
995269846 5:110207761-110207783 CTGGAGAACAGGCATGGGAATGG - Intergenic
996084643 5:119292117-119292139 GTGAAGCAGAGGCTTTAGGATGG + Intronic
996266272 5:121544284-121544306 CTGGAGAACAGGCATGGGAATGG + Intergenic
996825261 5:127675522-127675544 ATGGAGAACAGGCATGGGAATGG + Intergenic
998011631 5:138699886-138699908 GTGGAGAACAGCCAGGAGAAAGG + Intronic
1000010650 5:157228541-157228563 CTGGAGAAAAGGCTTGGGGTAGG + Intronic
1000518769 5:162273935-162273957 GTGAAGAAATGGCTTGAAGAAGG - Intergenic
1001286736 5:170429183-170429205 GTGGAGAACAGGGTTGCTGAAGG - Intronic
1002898499 6:1392671-1392693 GGCGAGAGCAGCCTTGAGGAAGG - Intronic
1003003330 6:2357883-2357905 GTGGAGGAGAGGTTGGAGGAAGG - Intergenic
1003696202 6:8408396-8408418 CTGGAGAACAGGCATGGGAATGG - Intergenic
1003758301 6:9147750-9147772 CTGGAGAACAGGCATGGGAATGG + Intergenic
1004005296 6:11632531-11632553 GGGGAGAACATGAATGAGGATGG - Intergenic
1004060971 6:12197777-12197799 GTAGAGAACAGACAAGAGGAAGG + Intergenic
1005622761 6:27635289-27635311 CTGGAGAACAGGCATGGGGATGG - Intergenic
1006001198 6:30966477-30966499 CTGGAGAACAGGCATTAGAATGG + Intergenic
1006062047 6:31430862-31430884 GTGGAGAACAGGCATGGGAATGG + Intergenic
1006081949 6:31572902-31572924 GGGGAGAACAGAGTTGAGGGGGG - Intronic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1007153289 6:39717077-39717099 GTGGAAAACAGGCTGGAAGGGGG - Intronic
1007384900 6:41513887-41513909 GTGGAGGACAGCCTAGAGGAAGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007645873 6:43380643-43380665 GTGGATAACAGGCAGTAGGAGGG - Intergenic
1007731009 6:43946442-43946464 GGGGAAAACAGACTTCAGGAGGG - Intergenic
1007848747 6:44782962-44782984 GTGGAGAATAGACTGCAGGAGGG - Intergenic
1009005561 6:57782487-57782509 GTGGGGAAGAGACTGGAGGAAGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009349126 6:62652664-62652686 GTGGACTGCAGGCTTGAAGATGG + Intergenic
1009349957 6:62661658-62661680 GTGGTTTCCAGGCTTGAGGATGG + Intergenic
1010325612 6:74558893-74558915 CTGGAGAACAGGCATGGGAATGG - Intergenic
1010581016 6:77596039-77596061 CTGGAGAACAGGCATGGGAATGG - Intergenic
1010622860 6:78099135-78099157 CTGGAGAACAGGCGTGGGAATGG - Intergenic
1010710709 6:79171194-79171216 GTGTAGTACAGGCTTGAGATCGG - Intergenic
1011142658 6:84177183-84177205 GAGGAGATGAGGCTGGAGGATGG - Intronic
1011396829 6:86919142-86919164 GAGGAGAAAACACTTGAGGAGGG - Intergenic
1011694119 6:89896628-89896650 GTGGAAAACAGTCCAGAGGAGGG + Intergenic
1012921094 6:105221784-105221806 CTGGAGAACAGGCATGGGAATGG - Intergenic
1012945252 6:105459075-105459097 GGTGAGAACAGGCTTGGGCAGGG + Intergenic
1013249574 6:108320884-108320906 GAGGAGAACAGGATTGTGGGAGG + Intronic
1013625908 6:111936747-111936769 GTGGGTAACAGGCTGGAGGCAGG + Intergenic
1014255835 6:119159483-119159505 AAGCAGAACAGGCTTCAGGATGG + Intergenic
1014416706 6:121193085-121193107 CTGGAGAACAGGCATGGGAATGG + Intronic
1014456139 6:121636854-121636876 CTGGAGAACAGGCATGGGAATGG - Intergenic
1014534505 6:122598933-122598955 CTGGAGAACAGGCATGGGAATGG - Intronic
1014969958 6:127801915-127801937 CTGGAGAACAGGCATGGGAATGG + Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015467228 6:133560532-133560554 TTGGAGAACAGGCATGGGAATGG - Intergenic
1016120201 6:140334950-140334972 CTGGAGAACAGGCATAAGAATGG - Intergenic
1016420283 6:143875586-143875608 CTGGAGAACAGGCATGGGAATGG - Intronic
1016662799 6:146600388-146600410 GTGGAGAGAAGGCTAGTGGAAGG - Intronic
1017228118 6:152043386-152043408 CTGGAGAACAGGCATGGGAATGG - Intronic
1017404739 6:154107143-154107165 TTGGATGACTGGCTTGAGGATGG + Intronic
1018107635 6:160504101-160504123 ATGGAGAACAGGCATGGGAATGG - Intergenic
1018123275 6:160657828-160657850 CTGGAGAACAGGCATGGGAATGG - Intronic
1018599572 6:165525222-165525244 CTGGAGAACAGGCATGGGAATGG + Intronic
1019455417 7:1124309-1124331 GTGGGGATCTGGCTGGAGGAGGG + Intronic
1019535905 7:1529908-1529930 GTGGAGGACAGGCTGGAGAGGGG - Intergenic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1021946273 7:25730852-25730874 GTGGATAACAGGTTGGAAGATGG + Intergenic
1022140518 7:27489174-27489196 GGAGAGATGAGGCTTGAGGAAGG - Intergenic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1023849456 7:44141959-44141981 GTTGAGATGAGGCTTGAGGAAGG - Intergenic
1023889607 7:44382772-44382794 GTGGAGAGCAGATTTGAGGTGGG + Exonic
1024392905 7:48835700-48835722 GTGGCGAGCAGCCTTGAAGAAGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024911879 7:54455990-54456012 GTGAAGATCAGGCTTGAGTGTGG + Intergenic
1025936410 7:66041276-66041298 GTGGAGAACAGAATGGAGGCTGG + Intergenic
1025947770 7:66117644-66117666 GTGGAGAACAGAATGGAGGCTGG - Intronic
1026940340 7:74284099-74284121 GTGGAGGACGGTCTTGAGGCTGG + Intergenic
1028049037 7:86159257-86159279 GTGCAGAACTGGATGGAGGATGG + Intergenic
1028136743 7:87230520-87230542 GTGGACAACATGATTGATGAAGG + Intergenic
1028141442 7:87279684-87279706 CTGGAGAACAGGCATGGGAATGG + Intergenic
1028146774 7:87328300-87328322 GGGGAGTGCAGGCTTGAAGATGG + Intergenic
1028547769 7:92023631-92023653 GTTGAGAACAGACTTTAGGGGGG - Intronic
1030368254 7:108670655-108670677 CTGGAGAACAGGCATGGGAATGG + Intergenic
1030617878 7:111757152-111757174 GTGGAGATGAGGCTTCTGGAGGG + Intronic
1030726813 7:112936497-112936519 GTGATGAACAGGCTTGGGGTGGG - Intronic
1031736377 7:125367453-125367475 GTGGAAAACATATTTGAGGATGG - Intergenic
1031797799 7:126198645-126198667 GTGGAGAATAGACTTTAGAAAGG - Intergenic
1031889921 7:127282111-127282133 GAGGAGAACAGGATGGATGAAGG - Intergenic
1031959488 7:127976023-127976045 AAGGAGAACAGGGTGGAGGAGGG - Intronic
1032153418 7:129449231-129449253 CTGGAGAACAGGCATGGGAATGG - Intronic
1032206903 7:129873820-129873842 GTTGAGAACAGGATTCTGGAGGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032875216 7:136031486-136031508 GTGGAGAATAGGCATGCGGGGGG - Intergenic
1032923721 7:136578094-136578116 CTGGAGAACAGGCATGGGAATGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033716954 7:144011968-144011990 GTGAAGAACAGGCTTGCATAAGG + Intergenic
1034169642 7:149053067-149053089 CTGGAGAACAGGCATGGGAATGG + Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1035861107 8:3028452-3028474 CTGGAAAACAGGCTTCAGGCAGG + Intronic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1038064979 8:23954509-23954531 CTGGAGAGCAGGCTTGGGTAGGG + Intergenic
1038198863 8:25393201-25393223 GAAGAGAACAGGCTTTGGGAGGG - Intronic
1038971905 8:32646242-32646264 GCTGAGTACAGGCTGGAGGAAGG - Intronic
1038986020 8:32811298-32811320 GTGCAGAGCAGTCTTGTGGAAGG - Intergenic
1041173247 8:55166950-55166972 GTTGAGAACAGACTTCAAGAAGG + Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042801431 8:72722237-72722259 GTGGAGAACAGACTGGAAGGGGG - Intronic
1043503674 8:80881570-80881592 GAGGTGAACAGGCTTCAGGGAGG + Intergenic
1044150512 8:88770825-88770847 ATGGAGAACAGGCATGGGAATGG + Intergenic
1044202100 8:89450186-89450208 CTGGAGAACAGGCATGGGAATGG + Intergenic
1044290673 8:90465336-90465358 GTGGAGAACAGGTTGGAACAGGG + Intergenic
1044487456 8:92769441-92769463 CTGGAGAACAGGCATGGGAATGG - Intergenic
1044633726 8:94302085-94302107 CTGGAGAACAGGCATGGGAATGG - Intergenic
1045049458 8:98309593-98309615 CTAGAGAGCAAGCTTGAGGAGGG + Intergenic
1045221469 8:100204376-100204398 CTGGAGAACAGGCATGGGAATGG + Intronic
1045378536 8:101600169-101600191 ATGTAGAACAGGCCTGAGAAAGG + Intronic
1045542513 8:103100295-103100317 GTGGAGAACAGGGGTGGGGTGGG + Intergenic
1046578205 8:116058363-116058385 GAGGAGAATAGGCAGGAGGAAGG - Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047768315 8:128008495-128008517 GTAGGGAACAGGCATGAGAAGGG - Intergenic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1047974189 8:130113059-130113081 GTGGAGAATGGACTGGAGGAAGG - Intronic
1048084181 8:131159446-131159468 CTGGAGAACAGGCATGAGAAAGG - Intergenic
1051881832 9:21848342-21848364 CTGGAGAACAGGCATGGGAATGG + Intronic
1052197570 9:25736193-25736215 GTGGAGACCAGGTTGCAGGATGG - Intergenic
1052368338 9:27638535-27638557 CTGGAGAACAGGCATGGGAATGG + Intergenic
1052703826 9:31970186-31970208 TGGGAGAAGAGGCTGGAGGATGG - Intergenic
1052841902 9:33298812-33298834 GTGGAGAATAGGCTCTAAGAAGG + Intronic
1053423330 9:37995120-37995142 CTCGAGAACAGGCTGGGGGAAGG + Intronic
1053604231 9:39640557-39640579 GGGCAGAACAGGTTTGAGGGAGG - Intergenic
1053645838 9:40119176-40119198 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053645844 9:40119203-40119225 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053759874 9:41344333-41344355 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054249309 9:62701857-62701879 GGGCAGAACAGGTTTGAGGGAGG + Intergenic
1054326850 9:63717077-63717099 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054326856 9:63717104-63717126 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054538727 9:66256769-66256791 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054538733 9:66256796-66256818 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054563421 9:66736389-66736411 GGGCAGAACAGGTTTGAGGGAGG + Intergenic
1054936952 9:70698250-70698272 ATGGAGAATCGGCTTGAAGAAGG - Intronic
1055326360 9:75134746-75134768 GAGGAGAACAGGCTTGGTGCTGG - Intronic
1056719089 9:89058214-89058236 GTGGAGGACATGGTGGAGGATGG + Intronic
1056719113 9:89058315-89058337 GTGGAGGACATGGTGGAGGACGG + Intronic
1056719332 9:89059285-89059307 GTGGAGGACATGGTGGAGGACGG + Intronic
1056719432 9:89059696-89059718 GTGGAGGACATGGTGGAGGATGG + Intronic
1056847643 9:90054704-90054726 GTGGAGAACAGGATAGTGGGAGG - Intergenic
1057316285 9:93970834-93970856 CTGGAGAACAGGCATGGGGATGG + Intergenic
1057428734 9:94975721-94975743 GCGGAGAAGAGGCTGGAGGCAGG - Intronic
1057829491 9:98395835-98395857 GGGAAGAGCAGGCTTGAGAATGG + Intronic
1058177124 9:101748818-101748840 GTGGTGAATAGACTTCAGGATGG - Intergenic
1058259536 9:102811971-102811993 CTGGAGAACAGGCATGGGAATGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058775578 9:108280075-108280097 GTTAAGAACAGGCTGAAGGAGGG + Intergenic
1058894213 9:109385888-109385910 TTCGAGAAGAGGCTTCAGGAAGG + Intronic
1059444078 9:114327524-114327546 GTGGGGACCAGGCTGGAGGCAGG + Intergenic
1059445285 9:114334303-114334325 GTGGGGACCAGGCTGGAGGCAGG + Exonic
1059708774 9:116848191-116848213 ATGGAAAACAGGCTTGGAGAGGG + Intronic
1202793623 9_KI270719v1_random:102649-102671 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1186796277 X:13049754-13049776 GTGGAGGAAAGGCTTCACGAAGG + Intergenic
1186820200 X:13280242-13280264 ATGGAGAACATGTTTAAGGATGG - Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1189300171 X:39946846-39946868 GAGGAGTGCAGGCTTGAGCAGGG + Intergenic
1189655747 X:43243669-43243691 GTTGAGAACAGGATTCAAGATGG - Intergenic
1191719544 X:64217958-64217980 CTGGAGAACAGGCATGGGAATGG - Intergenic
1191741516 X:64440216-64440238 GTGGAGAATAGGCTGGTGGTGGG - Intergenic
1191742823 X:64453601-64453623 CTGGAGAACAGGCATGGGAATGG - Intergenic
1191946079 X:66536712-66536734 CTGGAGAACAGGCATGGGAATGG + Intergenic
1191966969 X:66769276-66769298 CTGGAGAACAAGCTAGAGAAAGG - Intergenic
1192057123 X:67784505-67784527 GTGGAGGACTGGCTGGAGGAGGG - Intergenic
1192175293 X:68881242-68881264 ATGGAGAACAGGCTGGGGGAGGG + Intergenic
1192557409 X:72101557-72101579 GGGGAGAAAAGGCTGGGGGAGGG - Intergenic
1193904301 X:87224261-87224283 CTGGAGAACAGGCATGGGAATGG + Intergenic
1194032294 X:88832157-88832179 CTGGAGAACAGGCATGAGAATGG - Intergenic
1194343024 X:92728808-92728830 CTGGAGAACAGGCATGGGAATGG + Intergenic
1195006024 X:100686817-100686839 GTGAAAAGCAGGCTTGAGAAAGG - Intronic
1195749147 X:108146978-108147000 CTGGAGAACAGGCATGGGAACGG - Intronic
1195782672 X:108482171-108482193 CTGGAGAACAGGCATGAGAATGG - Intronic
1195809957 X:108818129-108818151 CTGGAGAACAGGCATGGGAACGG - Intergenic
1197002005 X:121450750-121450772 CTGGAGAACAGGCATGGGAACGG + Intergenic
1197084485 X:122455808-122455830 CTGGAGAACAGGCATGGGAATGG - Intergenic
1197097177 X:122610540-122610562 ATGGAGAACAGGCATGGGAATGG + Intergenic
1197100151 X:122643789-122643811 GTGAGGAACAGGATTTAGGAGGG - Intergenic
1197245404 X:124161617-124161639 CTGGAGAACAGGCATGGGAATGG - Intronic
1197426031 X:126297913-126297935 CTGGAGAACAGGCATGGGAATGG - Intergenic
1197497762 X:127207273-127207295 CTGGAGAACAGGCCTGGGAATGG - Intergenic
1197591559 X:128417040-128417062 CTGGAGAACAGGCATGGGAATGG + Intergenic
1198933671 X:141885234-141885256 CTGGAGAACAGGCATGGGAATGG + Intronic
1199627374 X:149752896-149752918 CTGGAGAACAGGCATGAGAATGG - Intergenic
1199973631 X:152878350-152878372 GCTGAGAACAGGAGTGAGGAAGG + Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200242998 X:154507541-154507563 TTGGAGAACGGGCTTGTGGGAGG - Intronic
1200286893 X:154831590-154831612 CTGGAGAAGAGGCTTAAGGGAGG - Intronic
1200340593 X:155391387-155391409 CTGGAGAACAGGCATGGGAATGG - Intergenic
1200651385 Y:5845474-5845496 CTGGAGAACAGGCATGGGAATGG + Intergenic
1201424630 Y:13834475-13834497 GTGGATGGCAGGCTGGAGGAGGG - Intergenic
1201945435 Y:19505057-19505079 GTGGGGAACAGGGGTGAAGAAGG + Intergenic
1202341346 Y:23872180-23872202 CTGGAGAACAGGCATGGGGATGG - Intergenic
1202529420 Y:25797906-25797928 CTGGAGAACAGGCATGGGGATGG + Intergenic