ID: 1085179415

View in Genome Browser
Species Human (GRCh38)
Location 11:74521020-74521042
Sequence ATGGCCAAGAGGCAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 385}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085179399_1085179415 19 Left 1085179399 11:74520978-74521000 CCTCCTCCCTTCTGGATTTCTCT 0: 1
1: 0
2: 8
3: 77
4: 691
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385
1085179409_1085179415 -7 Left 1085179409 11:74521004-74521026 CCTGGGTTCCAGGGCCATGGCCA 0: 1
1: 0
2: 0
3: 24
4: 300
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385
1085179407_1085179415 -4 Left 1085179407 11:74521001-74521023 CCACCTGGGTTCCAGGGCCATGG 0: 1
1: 0
2: 0
3: 26
4: 328
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385
1085179400_1085179415 16 Left 1085179400 11:74520981-74521003 CCTCCCTTCTGGATTTCTCTCCA 0: 1
1: 0
2: 4
3: 25
4: 416
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385
1085179402_1085179415 12 Left 1085179402 11:74520985-74521007 CCTTCTGGATTTCTCTCCACCTG 0: 1
1: 0
2: 0
3: 28
4: 316
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385
1085179401_1085179415 13 Left 1085179401 11:74520984-74521006 CCCTTCTGGATTTCTCTCCACCT 0: 1
1: 0
2: 1
3: 29
4: 431
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385
1085179398_1085179415 23 Left 1085179398 11:74520974-74520996 CCTTCCTCCTCCCTTCTGGATTT 0: 1
1: 0
2: 5
3: 83
4: 748
Right 1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG 0: 1
1: 0
2: 2
3: 28
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085179415 Original CRISPR ATGGCCAAGAGGCAGGATGA GGG Intronic
900876937 1:5349543-5349565 ATGTGCAAGAAGCAGGATGAGGG + Intergenic
901003611 1:6161094-6161116 GTGGCCAGGAGGGAGGATGAAGG + Intronic
901137425 1:7007097-7007119 AGGGCCAAGGGGATGGATGATGG + Intronic
901383841 1:8893509-8893531 ATGCCCAAGAGAAAGGCTGAAGG + Intergenic
901646769 1:10721019-10721041 CGGGCGAGGAGGCAGGATGAGGG - Intronic
903383453 1:22912141-22912163 ATGGCCAAGAGGCTGGACCTCGG - Intronic
904501062 1:30913141-30913163 TTGCCCAAGAGTCAGGATGGAGG + Intergenic
904875248 1:33649874-33649896 CTGGCTAAGAGACAGGATGGGGG + Intronic
905256841 1:36690235-36690257 ATGGCCATGAGCCAAGAGGAAGG + Intergenic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905734263 1:40315254-40315276 ATGTGCCAGAGGCAGGGTGAGGG + Intronic
906522446 1:46475440-46475462 GTGGCCAGGAGGAGGGATGAGGG - Intergenic
906789606 1:48647122-48647144 AAGGCCAAGAGACATAATGATGG + Intronic
907186387 1:52612559-52612581 ATGCCCAGGAGGCAGGTGGATGG - Intergenic
909227236 1:73041508-73041530 TGGGGCAAGAGGCAGGAGGATGG - Intergenic
910093802 1:83496653-83496675 ATTGACAAGAGGCTGCATGATGG + Intergenic
911024337 1:93421156-93421178 TTGGACAACAGGCGGGATGAAGG + Intergenic
911636575 1:100242688-100242710 TTGACCAAGAGTCAGGATTATGG - Intronic
913139799 1:115929644-115929666 ATAGCCAAGTGGCACGATAATGG + Intergenic
913366616 1:118046642-118046664 AGGGCCAAGAGGCAAAATCAAGG + Intronic
915082557 1:153361961-153361983 ATAGCCAAAGGGCAGGAAGATGG - Intergenic
915167768 1:153958178-153958200 AGGGCCGAGGGGCAGGAAGAAGG - Intronic
916075800 1:161199437-161199459 AGGGCCAAAGGGCAGCATGAGGG - Exonic
916142189 1:161709713-161709735 ATGGCCATGAGGCTGGAGGAGGG + Intronic
916714530 1:167438294-167438316 ATGGCCAAGGAGCAGTTTGAGGG + Intronic
917410661 1:174757010-174757032 ATGGACAAGAAGCTGGAGGAAGG - Intronic
918056431 1:181025510-181025532 ATGGTCCAGAGGAGGGATGAGGG + Intergenic
918345540 1:183604322-183604344 ATGTCAGAGAGGCAGGAGGAAGG + Intergenic
919879347 1:201891773-201891795 AAGCCAAAGAGACAGGATGAGGG - Intronic
920220155 1:204391276-204391298 AGGGACACGAGGCAGGAGGACGG + Intergenic
920231836 1:204475824-204475846 CTGGCCCAGAGCCAGGAGGATGG - Intronic
920286263 1:204882027-204882049 ATAGCCAAGAAGCAGGGTGGGGG - Intronic
921586592 1:216953565-216953587 AGGGCCAAGAGGGAGGATGAAGG - Intronic
922036800 1:221856686-221856708 ATGGGCAAGAGGGAGCAGGATGG - Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
923152697 1:231247841-231247863 ATGGTCATGAGGCAGGAGGTGGG + Intronic
1063330683 10:5155932-5155954 ATGGAGAAGAGGCAGAATGAAGG - Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064094924 10:12417190-12417212 ATTACCTAGACGCAGGATGATGG + Intronic
1065570326 10:27064969-27064991 ATGACCAAGAAGCAGGAAGCGGG - Intronic
1067344109 10:45425751-45425773 ATGGGGAAGAGGCAGGCTGATGG - Intronic
1067549986 10:47227442-47227464 ATGGCTAAGAGGTGGGGTGAGGG - Intergenic
1069358250 10:67612689-67612711 ATGGTGGAGAGGCAGGTTGATGG - Intronic
1069838416 10:71324145-71324167 ATAGCCAAGGAGCAGCATGAGGG + Intronic
1069963159 10:72090656-72090678 GAGGCCAAGAGGCAGGAGGATGG + Intergenic
1070398896 10:76035772-76035794 ATTGCCAACATGAAGGATGAGGG - Intronic
1073735010 10:106335921-106335943 ATGGACAGGAGGCAGGAGGGCGG + Intergenic
1074377451 10:112951482-112951504 GCGGCCAAGAGGCAAGATGGAGG + Exonic
1075001971 10:118805313-118805335 CTTGCCTGGAGGCAGGATGAGGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075815687 10:125263358-125263380 AAGTCCAAGAGCCAGGATGACGG + Intergenic
1075931810 10:126303545-126303567 ATGCCCAAGAGCCAGGAATAGGG - Intronic
1078552551 11:12290472-12290494 ATGGCAGAGAGGGAGAATGAGGG + Intronic
1081866802 11:46364753-46364775 TTGGGCAGGAGGAAGGATGAAGG - Intronic
1083180455 11:60981792-60981814 GAGGCCAGGAGGCAGGATGCAGG + Intronic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1083629083 11:64086560-64086582 AAGGCCCGGAGGCAGGAGGAAGG - Intronic
1083971249 11:66077177-66077199 AAGGTCAAGAGGCAGGGTGCAGG - Intronic
1084975915 11:72798218-72798240 ATGTCCTAGAGGCAGGAAGAAGG - Intergenic
1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG + Intronic
1085305504 11:75483365-75483387 ATGGAGCAGAGGCAGGATGCTGG + Intronic
1085529821 11:77184588-77184610 GTGACCAAGAGGCTGCATGACGG + Exonic
1087083310 11:94193014-94193036 ATAACCAAGAAGCAGGATGGGGG + Intergenic
1087196451 11:95308770-95308792 ATAGCCAAGAGGCAGAAGGATGG - Intergenic
1087642296 11:100768266-100768288 ATTGCCAAGGAGCAGGATGTGGG + Intronic
1087907004 11:103709955-103709977 ATGGCCAAGGGTCAGGAGGTGGG - Intergenic
1088645497 11:111913404-111913426 GAAGGCAAGAGGCAGGATGAGGG - Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088833062 11:113554630-113554652 CTGGCAAAGAGACAGGAAGATGG - Intergenic
1089214106 11:116825356-116825378 GTGGGCCAGAGGCAGGGTGATGG + Intergenic
1089786688 11:120912426-120912448 ATGTTCAAGAGGGAGGAAGACGG + Intronic
1090576100 11:128105630-128105652 ATAGCCAAGGAACAGGATGAGGG + Intergenic
1091637159 12:2205837-2205859 ATGTCCACGAGCCAGGAAGAAGG - Intronic
1091998299 12:5012783-5012805 AGGGCCCAGAGGCAGAAGGAAGG - Intergenic
1092534406 12:9374824-9374846 AAGGCCAGGAGGCAGGCTGCTGG - Intergenic
1095158578 12:38888817-38888839 ATTGTAAAAAGGCAGGATGAAGG - Intronic
1095982486 12:47981246-47981268 AGGGCCACCAGGCAGCATGAGGG + Intronic
1096803336 12:54126145-54126167 ATGGCGAAAAGGGAGGGTGAAGG - Intergenic
1097387215 12:58963813-58963835 ATAGCCAAGGAGCAGGGTGAGGG - Intergenic
1098296807 12:69012294-69012316 ATAGCCAAGGGGCAGAGTGAGGG - Intergenic
1099741973 12:86649652-86649674 CTGGCCAAGAGCCAGATTGAAGG + Intronic
1100312823 12:93413474-93413496 AGAGGCAAGAGGCACGATGAGGG - Intronic
1101588597 12:106107071-106107093 TTGGGCAAGAGGAAGGATGTAGG - Intronic
1103481770 12:121254722-121254744 TTTGCCAAGTGGCAGGAAGAAGG + Intronic
1103513412 12:121490638-121490660 ATGACCAACGGGCAGGATGGTGG - Intronic
1104616757 12:130276920-130276942 ATGACCAAGAGGCTGGATTTGGG - Intergenic
1106126916 13:26908157-26908179 TTGGCAAAGAGGCAGCAAGATGG + Intergenic
1106562726 13:30860590-30860612 ATAGCCAAGGGGCAGAGTGAGGG - Intergenic
1106615836 13:31326672-31326694 ATCCCAAACAGGCAGGATGAGGG - Intronic
1106744480 13:32685317-32685339 AGGGCCAAAAGGCATGAAGAGGG + Intronic
1106942601 13:34794588-34794610 ATAGCCAAGAAGCAGGATGAGGG - Intergenic
1107018095 13:35724607-35724629 GAGGCCGAGAGGCAGGAAGAGGG + Intergenic
1107377796 13:39823233-39823255 ATGGCAAAGTGGCAGGAAGTGGG - Intergenic
1107472097 13:40700402-40700424 ATGGCCCTGAGGCAAGAAGATGG - Intergenic
1108818444 13:54317798-54317820 ATGGCGTAGTGGCAGGCTGAAGG - Intergenic
1108873677 13:55018536-55018558 ATGGCCAAGAAGCACTTTGATGG - Intergenic
1109219366 13:59625871-59625893 ATGGCCAAGCAGCAGGATCAGGG + Intergenic
1110172779 13:72522424-72522446 ATGGCCCAGAGACAGGAAGCAGG - Intergenic
1110797081 13:79652137-79652159 GTTGCCAAGAGGCAGTGTGATGG - Intergenic
1112065151 13:95784868-95784890 ATGGGCCTGAGGCAGGAGGATGG + Intronic
1113115392 13:106869636-106869658 ATTGGCAAGAGGCAGGAGAAAGG + Intergenic
1113316334 13:109183385-109183407 ATGGCCTGAAGGCAGAATGATGG + Intronic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1114566828 14:23639267-23639289 ATGGCCAAGCTGCAGGGGGAGGG + Exonic
1114604949 14:23988873-23988895 AGGGCGAAGGGGCAGGACGAAGG - Exonic
1114610398 14:24036427-24036449 AGGGCGAAGGGGCAGGACGAAGG - Intergenic
1114756623 14:25267314-25267336 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
1116751410 14:48890065-48890087 ATAGCCAACAAGCAGAATGAGGG - Intergenic
1117022932 14:51590233-51590255 ACTGCAAAGAGGCAGAATGATGG + Intronic
1117145947 14:52837000-52837022 ATGGCCAGGAAGCAGAGTGAGGG + Intergenic
1120132346 14:80822524-80822546 ATGCCCAAGAGAAAGGCTGAAGG + Intronic
1120382304 14:83796260-83796282 AGGGTGAAGAGGCAGGATTATGG - Intergenic
1120517667 14:85489809-85489831 ATAGCGAAGAAGCAGGGTGAGGG - Intergenic
1121260889 14:92565291-92565313 AGGGCCAGGAGGCAGGTAGAGGG + Intronic
1121419578 14:93803443-93803465 CAGGCCAAGAGGCAGAATCAAGG - Intergenic
1122126596 14:99581730-99581752 AAGGCCACGAAGCAGGATGGGGG + Intronic
1122635571 14:103128117-103128139 CAGGCCAGGAGGCAGGAGGAGGG + Intronic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124445786 15:29730713-29730735 ATGCCCAAGAGAAAGGCTGAAGG + Intronic
1126128869 15:45321364-45321386 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
1126845559 15:52757610-52757632 CTGGACAAGTGGCAGGACGAGGG - Exonic
1126940755 15:53762639-53762661 CTGCTCAAGAGGTAGGATGAAGG - Exonic
1127916351 15:63458857-63458879 CTGGCCAAGGAGCAGGGTGAGGG - Intergenic
1128041994 15:64583236-64583258 TTGGCCAGGAGGCAGGAGAATGG + Intronic
1128639216 15:69323464-69323486 CTGGGCCAGAGGCAGGATGGGGG + Intronic
1129632643 15:77278465-77278487 ATGCCCAAGAGAAAGGCTGAAGG + Intronic
1129667766 15:77588969-77588991 AAGGCCAAGAGGCTGGGTAATGG + Intergenic
1129775478 15:78233715-78233737 CTGGCCAGAAGGCAGGAAGAAGG - Intronic
1129801448 15:78418100-78418122 AAGGCCAAGAGGCTGGGGGAGGG + Intergenic
1130104202 15:80917285-80917307 ATGGGCAGGAGGCAGGAGGCAGG + Intronic
1130962872 15:88675735-88675757 ATTGCCCAGTGGCAGGATCATGG + Intergenic
1132457884 16:34103-34125 ATGGCCATGCTGGAGGATGACGG - Intergenic
1132702359 16:1227256-1227278 ATGGGCCAGAGGGAGGAAGAAGG + Intronic
1134111920 16:11520710-11520732 GTGACCAAGAGGAAGTATGAAGG + Intronic
1134594407 16:15484306-15484328 GTGGTCAAGAGGCAGGAGAAGGG - Intronic
1135037438 16:19089829-19089851 ATGGCCTGGAGACAGGAAGACGG + Intergenic
1135491159 16:22910907-22910929 ATGGAGGAGAGGCAGGTTGAAGG + Intronic
1135858368 16:26032789-26032811 ATGCCCAAGAGAAAGGCTGAAGG - Intronic
1137062403 16:35803155-35803177 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
1137489890 16:48923586-48923608 ATGGCCCAGAGGCAGGGCCATGG + Intergenic
1137811673 16:51358622-51358644 AGGGCCAAGAAAGAGGATGAAGG + Intergenic
1137814373 16:51384261-51384283 ATAGCCAAGGAACAGGATGAGGG - Intergenic
1138609996 16:58115351-58115373 ATGCCCATGCGGCTGGATGACGG - Exonic
1138622707 16:58224608-58224630 ATGGCCACGGGGAAGGATGCTGG - Intergenic
1138761564 16:59550174-59550196 ATAGCCAAGGAGCAGGGTGAGGG + Intergenic
1139477927 16:67212178-67212200 ATGGGCAAGAGGTAGGGAGATGG - Intronic
1139546186 16:67650784-67650806 TTGGTCTAGAGGCAGGACGAAGG - Intronic
1140461690 16:75145384-75145406 ATGGACAGGAGGCAGGAGGGCGG + Intergenic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1141155320 16:81593150-81593172 ACGGTCAAGAGGCAGGACGTGGG - Intronic
1141238679 16:82244323-82244345 AAAGCCAACAGGCAGGGTGAGGG + Intergenic
1141927625 16:87179462-87179484 AAGGCCAGCAGGGAGGATGAGGG - Intronic
1142200814 16:88760309-88760331 TTGTCCATGAGGCAGGAAGAGGG - Intronic
1143551411 17:7632647-7632669 ATAGCGAAGAGGCAGAATTAAGG + Intronic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146134940 17:30311112-30311134 AGGACCAAAAGGCAGGGTGATGG + Intergenic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146657582 17:34644098-34644120 CTGTCCAAGAGGATGGATGAAGG - Intergenic
1147333043 17:39710060-39710082 TTGGGCAAAGGGCAGGATGAGGG - Intronic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1148452740 17:47790416-47790438 ATAGCAAAGATGCAGGTTGAGGG - Intergenic
1148781274 17:50123481-50123503 ATGGCCCAGAGTCAGGAGCAAGG - Intronic
1149896898 17:60435416-60435438 ATGACCAAGAGAAAGGCTGAAGG - Intergenic
1150206292 17:63411107-63411129 ATGACCAAGAGTGAGGATGCAGG + Intronic
1151112192 17:71691303-71691325 ATGACCAAGAGGCAAAAAGAAGG + Intergenic
1151795945 17:76345838-76345860 ATGCCCAAGAGAAAGGCTGAAGG + Intronic
1151939287 17:77282537-77282559 ATGGCCCAAAGGCAGGGGGATGG - Intronic
1152296463 17:79470003-79470025 GTGACCAAGAGCCAGGGTGAGGG + Intronic
1152443760 17:80327756-80327778 ACGGCAAAGAGGCAGGAGGTGGG + Intronic
1153055330 18:940136-940158 ATGGCAAAGACTCAGGGTGATGG - Intergenic
1155076683 18:22363444-22363466 ATGGTCCAGAGGAAAGATGATGG - Intergenic
1155172558 18:23277716-23277738 CTAGCCAACAGGCAGGGTGAAGG + Intronic
1155362281 18:25015601-25015623 ATAGGAAAGAGGCAGGCTGAGGG + Intergenic
1155494898 18:26433116-26433138 AAGGCCAAGGAGCAGGCTGAGGG - Intergenic
1156460299 18:37317998-37318020 TTGGCCAGGGGGCAGGAGGAAGG - Intronic
1156504747 18:37582698-37582720 ATGGTGCAGAAGCAGGATGAAGG - Intergenic
1156543882 18:37944606-37944628 TTGGCTTAGAGGGAGGATGATGG + Intergenic
1156834278 18:41533817-41533839 ATAACAAAGAGGCAGAATGAAGG - Intergenic
1156960462 18:43022476-43022498 ATGGTCAATACGCAGGATGATGG + Intronic
1157400068 18:47379808-47379830 AAGGCCCAGAGGCAGGATAGTGG - Intergenic
1157443891 18:47730652-47730674 CTGGGCAGGAGGCATGATGAGGG - Intergenic
1157580302 18:48770290-48770312 GTGGCAAAGAGGCAGGAAGCTGG - Intronic
1158401746 18:57127477-57127499 ATGGACAGCAGGCAGGATTAGGG - Intergenic
1160399528 18:78599955-78599977 TGGGACAAGAGGGAGGATGATGG - Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160915604 19:1495115-1495137 AGGGCCTAGAGGCACGATGGGGG + Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161965492 19:7545609-7545631 CTGGACAAGAGGCAGGAAAATGG + Intronic
1162768120 19:12932611-12932633 ATGGCCATCAGCCAGGATTATGG + Intronic
1163083799 19:14964223-14964245 AAGGGCAAGAGGCGGGAGGAAGG - Intronic
1163391101 19:17030339-17030361 ATGGACAAGGGGCAAGGTGATGG + Intergenic
1163405418 19:17119048-17119070 ATGGCCAGGAAGCAAGATGTGGG + Intronic
1164289630 19:23855761-23855783 ATGGCAAAGTGACTGGATGAGGG + Intergenic
1165372965 19:35421421-35421443 ATGGCCAAGAGGCTGGCAGAGGG - Intergenic
1165763058 19:38333790-38333812 GGGGCCAAGAGGTAGGATGAGGG + Intergenic
1166518323 19:43463451-43463473 GGGGCCAAGAGGCAGCAGGAGGG - Intronic
1167983152 19:53293111-53293133 ATGTCCAGTAGGCAGGAAGAAGG - Intergenic
925184728 2:1839266-1839288 GCGGCCAAGAGGCAGAAAGACGG - Exonic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927423840 2:22959188-22959210 ATGGCCAAGAAGAAGGCTGAAGG - Intergenic
927466332 2:23339568-23339590 ATAGCTATGAGGCTGGATGATGG - Intergenic
927588281 2:24330402-24330424 ATGCCCAAGAGAAAGGGTGAAGG + Intronic
927674932 2:25098308-25098330 AGGGTCAGCAGGCAGGATGAGGG - Intronic
927689208 2:25195790-25195812 AAGGCCCAGAGGCAGGAGGGTGG - Intergenic
928212361 2:29332997-29333019 TTGGCCAGGAGGTAGTATGAGGG - Intronic
928241474 2:29590694-29590716 ATAGCCAAGAAGCAGGATGGGGG - Intronic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
929989919 2:46778244-46778266 AGGGCACAGAGGCAGGAAGATGG + Intergenic
932046600 2:68356575-68356597 AGGACCAACAGGAAGGATGAGGG + Intergenic
933881133 2:86671069-86671091 ATGGGCAAGAGGCTGGGTGCGGG + Intronic
934038683 2:88109896-88109918 ATGGACATGTGGGAGGATGAGGG + Intronic
934771935 2:96912761-96912783 AGGAACAAGAGGCAAGATGAAGG - Intronic
935670990 2:105557098-105557120 ATGGAAAAGAGGCAGGATTCTGG + Intergenic
937339627 2:121082769-121082791 ATGGACAAGAGGGAGGCTGGAGG + Intergenic
937997587 2:127706729-127706751 ATGGCCATGAGCCAGGAAGGGGG - Intronic
938814688 2:134888856-134888878 ATGACCAAGAAGGAGCATGAGGG + Intronic
939569950 2:143829345-143829367 ATTGCCTGGAGGCAGGGTGATGG - Intergenic
940939208 2:159538455-159538477 TTTGCCAAGAAGCAGGAGGAAGG - Intronic
941189960 2:162369183-162369205 ATAGCCAACAGGGGGGATGATGG + Intronic
941199458 2:162491094-162491116 CTGGCCAACAGGCTGCATGAGGG - Intronic
941892642 2:170597510-170597532 ATGGACAATAGGCAGGATCCAGG - Intronic
942854187 2:180526159-180526181 AAGGCCCAGAGGCAGGAGCAAGG + Intergenic
944547827 2:200815063-200815085 AAAGCCAAGAGGCAGTAGGAGGG + Intronic
945272993 2:207960542-207960564 TATGCCAAGAGGCAGGAAGATGG - Intronic
946197150 2:218040548-218040570 ATGGTCATAAGGCAGGAGGAGGG - Intronic
946537501 2:220647445-220647467 TTGGACAAGAGCCAGGAGGATGG + Intergenic
948230947 2:236349002-236349024 ACGGGCAGGAGGCAGGATGGAGG - Intronic
948864651 2:240769161-240769183 GTGGCCATGAGGGAGGATGGCGG - Exonic
949055573 2:241926508-241926530 ATTGCCAAGAGGGAGGAAAAGGG + Intergenic
1169366558 20:4997358-4997380 AAGGCCCTGAGGCAGGAGGAGGG - Intronic
1169789531 20:9394853-9394875 ATGGCCAACAGCCAGCATTAAGG - Intronic
1170233984 20:14081274-14081296 ATAGCCAAGGAGCAGGATGGAGG - Intronic
1171472350 20:25382275-25382297 GGGGCCAAGAGCCAGGATGCCGG - Intronic
1171956548 20:31468236-31468258 AAGGCCCTGAGGCAGGGTGATGG - Intronic
1172689987 20:36783609-36783631 AAGGCAGAGAGGCAGGAGGAAGG + Exonic
1172786401 20:37471677-37471699 AGGGCGAACATGCAGGATGAGGG - Intergenic
1174668823 20:52286350-52286372 ATGAACAAGAGGGAGCATGAAGG - Intergenic
1176311964 21:5155394-5155416 ATGCCCAAGAGTCAGGAACAAGG + Intergenic
1176658932 21:9615232-9615254 ATGGACAAGAGGCAGGTGAACGG + Intergenic
1177301892 21:19257383-19257405 AGGGACAGGAGGCAGGAGGAGGG + Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178664148 21:34532056-34532078 ATGGCCAAGAAGCAGTGTCAGGG + Intronic
1178921973 21:36744701-36744723 ATGGCAAAGAAGATGGATGAAGG - Intronic
1179233807 21:39527884-39527906 CTGGCCAAGAGCCAGAATGCTGG - Intergenic
1179845083 21:44106635-44106657 ATGCCCAAGAGTCAGGAACAAGG - Intergenic
1180080337 21:45483723-45483745 ATGGCCAAGCTCCAGGATGGGGG + Intronic
1184417101 22:44358791-44358813 ATGGCCAAGGAGCAGAGTGAGGG + Intergenic
1184497307 22:44849313-44849335 TGGGCCAGGAGGCAGGGTGATGG + Intronic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
1185394511 22:50579840-50579862 ATGGCCAAGAGTCAGGAATTGGG + Intronic
949131256 3:503699-503721 ATGTCCAAGAGGAAGCATTAAGG - Intergenic
949343577 3:3055015-3055037 ATGGCTAAAAGTCAGGATGGTGG - Intronic
949893134 3:8748064-8748086 ATGGGCCTGAGGCAGGAGGATGG + Intronic
950685086 3:14611268-14611290 ATGGTCATGAGGCAGGAGGCAGG - Intergenic
950779082 3:15375623-15375645 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
952229945 3:31419350-31419372 TTGACCCAGAAGCAGGATGAAGG + Intergenic
952707352 3:36392699-36392721 CTGGCCACCAGGCATGATGAAGG - Intronic
953477832 3:43221088-43221110 ATGGCCAAGTGCCAGGTGGAAGG + Intergenic
953852218 3:46473037-46473059 AGGCGCAAGAGGCAGGATGGAGG - Intronic
954196534 3:49000432-49000454 ATTGCCAAGAGGAAGGAAAATGG - Intronic
954440831 3:50521151-50521173 AAGGCCAAGAGAGAGGAGGAGGG + Intergenic
954652446 3:52173422-52173444 ATGCCCAAGAGGCCAGATCATGG + Intergenic
955111519 3:55955377-55955399 AGGGCCATGAGGCAGGGTGATGG - Intronic
955797266 3:62650453-62650475 GTAGCCAACAGGAAGGATGATGG + Intronic
956517836 3:70069348-70069370 CTGGCCAAGAGACAGAAAGATGG + Intergenic
956687124 3:71840427-71840449 ATGGCCAAGGAGCAGGGTGGAGG + Intergenic
956797597 3:72730746-72730768 ATTGACAAGAGGCTGGATGAAGG - Intergenic
957402574 3:79735383-79735405 ATGGCTGGGAGGCAGCATGATGG + Intronic
957767152 3:84639930-84639952 ATAGCCAAGGAGCAGGGTGAGGG + Intergenic
959575143 3:107925876-107925898 ATGGATAGGAGGTAGGATGAGGG - Intergenic
960252477 3:115471312-115471334 TTGGCCAAGAGGCAAAATCAAGG - Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961167558 3:124774059-124774081 AGGGCCTAGAGCCAGCATGAAGG + Intronic
962937331 3:140092919-140092941 ATGGCCAAGAACAAGGATGAGGG + Intronic
963033178 3:140999543-140999565 ATGGCCAGCAGGCAAGAAGAGGG - Intergenic
963131816 3:141865257-141865279 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
963762145 3:149294932-149294954 ATGGACAGGAGACAGGAAGAGGG + Intergenic
964755637 3:160088854-160088876 AAGGCCAAGGGTCAGGATTAAGG - Intergenic
965888512 3:173479262-173479284 TTGGGCAAGAGTGAGGATGAAGG + Intronic
966931286 3:184677449-184677471 ATGTCCAGCAGGCAGGACGATGG - Intronic
968013479 3:195303770-195303792 ATGGCCATGTAGCAGGATGGCGG - Intronic
968740653 4:2330097-2330119 AGGGTTAAGGGGCAGGATGAAGG + Intronic
971263088 4:25074904-25074926 CTGGCCCAGGGACAGGATGACGG + Intergenic
971631706 4:29000678-29000700 ATGGTGAAGAGGGAAGATGATGG + Intergenic
971651001 4:29273896-29273918 AAGGCCTAGAGACAGGAAGAAGG - Intergenic
971802953 4:31316586-31316608 ATGTCCGAGAGGAAGGATAATGG + Intergenic
973098676 4:46234068-46234090 ATGGCAAATAGGCAAGATGTGGG + Intergenic
973158879 4:46992417-46992439 ATGGACACGTGGGAGGATGAGGG + Intronic
973610895 4:52635249-52635271 ATGGCCAAAGGGCAGGGTGAGGG - Intronic
973778463 4:54265688-54265710 GTGACCAAGAGGCAGCATGGTGG - Intronic
973815139 4:54612584-54612606 ATGAGCATGAGGCAGGATTAGGG - Intergenic
974093184 4:57333809-57333831 ATGTCCAAGAGACAGAGTGATGG - Intergenic
975057449 4:69951867-69951889 ATAGCCAAGAAGCAGAGTGATGG - Intergenic
975180599 4:71339605-71339627 ATGGCCAATGGGCATGATGTTGG + Intronic
976197004 4:82542549-82542571 GTGGCCAAAAGGCAGGAGGTAGG + Intronic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
978279437 4:106992414-106992436 ATGGCCAAGAGGTGGGAAGAGGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
979552766 4:122009700-122009722 AGGACTAAGAGGCAGGAGGAGGG + Intergenic
980533693 4:134087790-134087812 AAGGCCAGGAGGAAGGAAGAAGG - Intergenic
980867137 4:138565075-138565097 AGGGACCAGAGGCAGCATGAGGG + Intergenic
981036702 4:140176920-140176942 ATGTCCAAGAAGCTGAATGAAGG - Intergenic
982366228 4:154582236-154582258 AGGCCCAAGAGGCAGGATAAGGG + Intergenic
982464261 4:155710689-155710711 ATTGCCAAGAAGCAGGAAAAAGG + Exonic
984279364 4:177650349-177650371 ATAGCCAAGGAGCAGGATGGGGG - Intergenic
985044977 4:185931473-185931495 ATGGCCAAGAAGCAGGCTGCGGG + Intronic
985269541 4:188180851-188180873 AAGGTGAAGAGTCAGGATGAAGG + Intergenic
985416395 4:189740197-189740219 ATGGACAAGAGGCAGGTGAATGG - Intergenic
985901279 5:2796660-2796682 ATGGCCAAGTGTCATGATGTGGG - Intergenic
987216138 5:15739249-15739271 AAGGGCAAGAGGCAGAATCAAGG - Intronic
987517523 5:18932408-18932430 ATGGCTAAGAGAGAGGATGATGG + Intergenic
987932178 5:24415385-24415407 ATGGACAGGAGGCAGGAGGGTGG - Intergenic
988009464 5:25463945-25463967 ATAGCCAAAAAGCAGGATCAGGG + Intergenic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
991092681 5:62708165-62708187 AAGGGGAAGAGACAGGATGAGGG + Intergenic
991968455 5:72114803-72114825 GAGGGCAAGAGGCGGGATGAGGG - Intronic
992381526 5:76242273-76242295 ATGCCCAAGAGAAAGGCTGAAGG - Intronic
992710800 5:79453682-79453704 ATGGTCAAGGGCCAGGATCAGGG - Intronic
992810872 5:80387160-80387182 ATGCCCAAGAGGCAGGCTCCAGG - Intergenic
993177230 5:84502502-84502524 ATGTCCAAGAGACAAGAAGACGG + Intergenic
993275795 5:85855858-85855880 ATGGACAAGAGTCTGGATGTTGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993562581 5:89429229-89429251 ACGTCCAAGAGACTGGATGAGGG + Intergenic
994170745 5:96657387-96657409 ATGGACAAAAGACAGGCTGAGGG + Intronic
995819909 5:116218273-116218295 ATGCCCAAGAGAAAGGCTGAAGG - Intronic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998653552 5:144148907-144148929 CTGGCCAAGAGGCAAAATCAAGG - Intergenic
998983626 5:147730851-147730873 ATAGCCAAGAAGCAGAGTGAGGG - Intronic
999179290 5:149657549-149657571 AGGGCCAAGAAGCAGGAAGCAGG - Intergenic
999232710 5:150070950-150070972 AGAGACAAGAGGCAGGATGTAGG + Intronic
999871982 5:155761868-155761890 AAGGACAATAGGGAGGATGATGG - Intergenic
1002660440 5:180787900-180787922 AAGGCCAAGAGGCTTGAGGAGGG + Intergenic
1003401563 6:5795137-5795159 ATGGCCAGCAGACAGGGTGAGGG + Intergenic
1003596414 6:7478188-7478210 ATCGAAAAGAGGCAGGATGCCGG + Intergenic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1005899083 6:30202012-30202034 TTGGCAAAGAGGCATGATAAAGG - Intronic
1006400505 6:33814591-33814613 CTGGCCCAAAGGCTGGATGAGGG + Intergenic
1006726581 6:36203459-36203481 ATGGCCAAGAGGTAGAGGGAGGG + Intronic
1007386433 6:41523323-41523345 GTGGCCAAGCGGCAAGATTAGGG + Intergenic
1007469832 6:42082208-42082230 ATTGCAAAGAGACAGCATGAGGG - Exonic
1010327178 6:74577858-74577880 ATGGCCTGGAGGAAGGATGGGGG + Intergenic
1010727773 6:79354691-79354713 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
1011490291 6:87884566-87884588 TTGGAGAAAAGGCAGGATGAAGG + Intergenic
1011550757 6:88529277-88529299 ATTGAGAAGGGGCAGGATGAAGG - Intergenic
1012733855 6:102914320-102914342 ATGGGAAACAGGCAGGCTGAGGG + Intergenic
1013094473 6:106932024-106932046 ATGCCCAAGAGAAAGGCTGAAGG - Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013780796 6:113726507-113726529 AAAGCCAAGAGGCAGGAAGATGG + Intergenic
1014262030 6:119230440-119230462 AAGGCCAAGAGGCTGAAGGATGG - Intronic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1019636742 7:2080079-2080101 ATGGCCAACAGGCAGGCAGCAGG + Intronic
1023625717 7:42113365-42113387 ATGCCCAAGAGAAAGGCTGAGGG + Intronic
1024299624 7:47877076-47877098 ATGGCCCAGAGAAAGGGTGAGGG + Intronic
1026045901 7:66905100-66905122 GTTGCCAAGAGGCAGGAGAATGG - Intergenic
1026824564 7:73573400-73573422 ATGACCAAGCGGGAGGATGGGGG - Exonic
1029354859 7:100044221-100044243 ATAGCCAAGGAGCAGGATGGGGG - Intergenic
1030085424 7:105811637-105811659 ATAGCCATGGGGCTGGATGAGGG + Intronic
1030182307 7:106722696-106722718 AGGGAAAAGAAGCAGGATGAGGG - Intergenic
1031454019 7:121957297-121957319 ATGCCCAAGAGAAAGGCTGAAGG - Intronic
1031460671 7:122045043-122045065 ATGGCCTTGAGACAGGGTGAGGG - Intronic
1032709724 7:134451209-134451231 AAGGACATGAGGCAGGAGGATGG - Intronic
1032907268 7:136383243-136383265 AAGGCCCAGAGGGAGGATCAAGG + Intergenic
1034459994 7:151192892-151192914 CTGGTCAGAAGGCAGGATGAGGG + Intronic
1036657359 8:10685622-10685644 ATTGCCAAGGGCCAGGAGGAGGG + Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1039424906 8:37477692-37477714 ATGGATAAGAGGGAGGGTGAGGG - Intergenic
1042062805 8:64839627-64839649 ATTCCTAAAAGGCAGGATGATGG - Intergenic
1044738752 8:95304439-95304461 GTAGCAAAGAGGCAGAATGAAGG - Intergenic
1044869924 8:96608653-96608675 CTGGCGAAGAGGTAGGTTGAGGG - Intronic
1044872740 8:96635897-96635919 ATGACTAATAGGCAGTATGAGGG + Intergenic
1046309295 8:112414071-112414093 ATAGACAAGAAGCAGGATGGAGG - Intronic
1047190001 8:122669691-122669713 TTGGGGAAGGGGCAGGATGAGGG - Intergenic
1047441763 8:124885041-124885063 ATAGCCAGGACGCAGGGTGAAGG + Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1048043998 8:130756266-130756288 ATAGCCCAGAAGCAGGGTGAGGG - Intergenic
1049849804 8:144824802-144824824 ATGGCCAGGAGGCAGAAAGGGGG - Intergenic
1049969902 9:812799-812821 TTGGCCAAGAAGGATGATGAGGG + Intergenic
1050077949 9:1884320-1884342 ATGCCCAGGAGCCAGGGTGAGGG + Intergenic
1050406245 9:5311445-5311467 ATGCCCAAGAGAAAGGCTGAAGG + Intergenic
1050450059 9:5770766-5770788 AAGGCCAAGAGGCAAAATCAAGG - Intronic
1050454045 9:5815552-5815574 ATGACCTACAGGCAGAATGATGG + Intronic
1050847415 9:10239816-10239838 AGGGGCAAGAGGCAGGAGGGCGG - Intronic
1052374776 9:27706663-27706685 ATTGACACGAGGCAGGACGATGG + Intergenic
1056180575 9:84078584-84078606 ATGCCCAAGAGGAAGGCTGAAGG + Intergenic
1056602157 9:88054832-88054854 GTGGCCATGGGGCAGGATGTGGG + Intergenic
1056712536 9:89002278-89002300 TTGTCCATGATGCAGGATGAGGG - Exonic
1057742810 9:97726820-97726842 ATGTTCAAGATGCAGGATGTGGG - Intergenic
1058683251 9:107458284-107458306 ATGCCCAAGAGAAAGGGTGAAGG - Intergenic
1058726646 9:107810865-107810887 ATGGAGGAGAGGCAGGATGTGGG + Intergenic
1058986729 9:110214759-110214781 TGGGCAAAGAGGCAGGATGCAGG - Intergenic
1059466459 9:114471763-114471785 TTGGCCAAGAGGCATGGTGGGGG + Intronic
1061264010 9:129495342-129495364 ATGGACAAGGGACAGGAAGAAGG - Intergenic
1061377605 9:130235506-130235528 AAGGCCAAAGGGCAGGACGATGG - Exonic
1061619661 9:131803641-131803663 ATGGACCAGAGGTAGGAGGAGGG + Intergenic
1203636678 Un_KI270750v1:118840-118862 ATGGACAAGAGGCAGGTGAACGG + Intergenic
1186236179 X:7513421-7513443 ATGGACAAGAGGAAACATGACGG + Intergenic
1186456206 X:9712003-9712025 ATGGCCAAGAGCCATGATTACGG - Intronic
1186918577 X:14250880-14250902 ATAGCCAAGAGCCACAATGATGG - Intergenic
1187069583 X:15874904-15874926 AGTGCCAAGAGGTAAGATGAAGG + Intergenic
1187200957 X:17133267-17133289 ATGCCCAAGAGAAAGGCTGAAGG - Intronic
1187493608 X:19775671-19775693 GTGTCCATGATGCAGGATGATGG - Intronic
1190233876 X:48601530-48601552 CTGGCCAAGGGGCAGCATGATGG + Intronic
1190305118 X:49077613-49077635 TGGGCCAAAGGGCAGGATGAGGG + Intronic
1191682990 X:63860249-63860271 AGGCCCAAGGGGCAGGATGTAGG - Intergenic
1194325014 X:92503900-92503922 ATGACCATGAGGTGGGATGAGGG + Intronic
1195289072 X:103414195-103414217 ATGGCGATGTGGCAGGAGGAGGG + Intergenic
1196310900 X:114163880-114163902 ATGGATAAAAGGCAAGATGAAGG - Intergenic
1196409952 X:115407837-115407859 ATGGGCAAGAGCCTGAATGAAGG - Intergenic
1200226390 X:154420068-154420090 ATGCCACAGGGGCAGGATGATGG - Exonic
1200332740 X:155314372-155314394 ATGGCCAAAAGACATGAAGATGG + Intronic
1200429073 Y:3055696-3055718 ATGGCCACTATGGAGGATGAGGG + Intergenic
1200633746 Y:5623079-5623101 ATGACCATGAGGTGGGATGAGGG + Intronic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic