ID: 1085186454

View in Genome Browser
Species Human (GRCh38)
Location 11:74579943-74579965
Sequence GCACCCTGCTTGGCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085186454_1085186460 -2 Left 1085186454 11:74579943-74579965 CCAGTTTTAGCCAAGCAGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1085186460 11:74579964-74579986 GCTGGGAACCAGGGATGAAAAGG 0: 1
1: 0
2: 4
3: 37
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085186454 Original CRISPR GCACCCTGCTTGGCTAAAAC TGG (reversed) Intronic
902970508 1:20044777-20044799 GCACCCTGCCAGGCTGAATCAGG - Intronic
907584912 1:55608481-55608503 GCTCCAGGCTTGGCTAAAAGAGG - Intergenic
908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG + Intergenic
910602023 1:89042756-89042778 GCTCCCTGCGAGGCTGAAACTGG + Intergenic
913234239 1:116766274-116766296 GCACCCTGCCTGGTTCAAGCAGG - Intronic
918011908 1:180594758-180594780 CCTTCCTGCTTGGCTAAAAGAGG - Intergenic
920245094 1:204581948-204581970 GCACCATGCTTGTCAAAGACAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921771459 1:219045561-219045583 ACAGGCTGCTTGGCTAAAATGGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1068253241 10:54470730-54470752 GCAGCCCGCTTGGCTACAATTGG - Intronic
1070846637 10:79527733-79527755 GAACCCTTCCTGGCTAACACGGG + Intergenic
1070927158 10:80232535-80232557 GAACCCTTCCTGGCTAACACAGG - Intergenic
1073415868 10:103381417-103381439 CCACCCTGCTTGGCTAATTTTGG + Intronic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG + Intergenic
1080689798 11:34546875-34546897 GCACCCTTCTCAGCTTAAACAGG - Intergenic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1084503984 11:69553785-69553807 GCACCCTTTTTGGCCAAGACAGG - Intergenic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG + Intergenic
1091811872 12:3406182-3406204 GCTCCATCCTTGGCTAAAAGGGG - Intronic
1096145497 12:49276077-49276099 GCACCCTGCTTGGGAAATGCTGG - Intergenic
1097557455 12:61156888-61156910 ACACCTTTCTTTGCTAAAACAGG - Intergenic
1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG + Intergenic
1098637303 12:72800290-72800312 GGACTGTACTTGGCTAAAACAGG - Intergenic
1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG + Intronic
1103212125 12:119174844-119174866 TCACCCTGCATGCCTGAAACTGG - Intergenic
1104587938 12:130062563-130062585 GCTCCCGTCTTGGCTAAAAGGGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1131050381 15:89343618-89343640 GCACCCTGCTTTGCTCAGATGGG + Intergenic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134237774 16:12481087-12481109 GCACATTGCTTGGCTGACACAGG - Intronic
1135282780 16:21167127-21167149 GCACCCTGCTTAAATAAAAGAGG - Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG + Intronic
1151610860 17:75173786-75173808 CCACCCTGCTAGGACAAAACTGG + Intergenic
1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG + Intergenic
1155386311 18:25281909-25281931 GAATCCTGCTGGCCTAAAACTGG + Intronic
1164561174 19:29293250-29293272 CCTCCCTGCTAGGCTAAAAGTGG - Intergenic
1164692393 19:30221295-30221317 GCACCCTGAGTTGCTAAGACAGG - Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1166925675 19:46265468-46265490 CCACCCTGCTGGGCTGAAATAGG - Intergenic
1168298299 19:55388665-55388687 GCACCCTTCTGGGCTAGAAAAGG - Intronic
925069056 2:951504-951526 GCACCTGGCTGGGCTCAAACTGG - Intronic
927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG + Intergenic
941113123 2:161439742-161439764 GCACCCCGCCTGGCTAAGGCTGG - Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG + Intergenic
1179418526 21:41217454-41217476 GGAAGTTGCTTGGCTAAAACGGG - Intronic
1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG + Intergenic
1183136469 22:35893805-35893827 GGAACCTACTTGGCTAACACAGG - Intronic
954943218 3:54393831-54393853 GTACCCTGCTTCCCTAGAACTGG + Intronic
960076798 3:113495421-113495443 CCAACCTGCTTGGCTATAGCCGG - Intronic
960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG + Intergenic
962477414 3:135767552-135767574 GAACCCTGATTGGCCAAAGCAGG - Intergenic
962615019 3:137116945-137116967 GAAACCTGGTTGGCAAAAACTGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
966431661 3:179837822-179837844 ACAGGCTGCTTGGTTAAAACAGG + Intronic
968580487 4:1389623-1389645 GCACTTTGCTAGGCTAAGACAGG - Intergenic
968606213 4:1536900-1536922 GCACCCTGCTGGGCAAAAAATGG - Intergenic
968679277 4:1905545-1905567 GCCACCTGCATGGCCAAAACAGG + Intronic
970126835 4:12823248-12823270 ACAGGCTGCTTGGTTAAAACAGG + Intergenic
970733717 4:19140682-19140704 GCACCCCGCCTGGCAAAAAGAGG + Intergenic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
977471355 4:97447558-97447580 GCTCCAGCCTTGGCTAAAACGGG + Intronic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
979460812 4:120980916-120980938 GCAACCTGATTGGCCCAAACTGG - Intergenic
981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG + Intergenic
982170248 4:152655234-152655256 GCATCCTTCTTGGCTGAGACTGG + Intronic
984855465 4:184191405-184191427 GCTCCCTGCTTGACTGAATCCGG + Intronic
997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG + Intronic
998648332 5:144089682-144089704 GCACCCTGCTCAGATAAAATGGG + Intergenic
1000437081 5:161225390-161225412 GCATACTGAATGGCTAAAACTGG - Intergenic
1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG + Intergenic
1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG + Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007632417 6:43279979-43280001 GCTCCCTACCTGGCTCAAACAGG - Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010176437 6:73033186-73033208 GCCCCCTGCTTGGGGAAAAGAGG - Intronic
1011574544 6:88781239-88781261 GCATTTTGCTTGCCTAAAACAGG + Intronic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG + Intronic
1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG + Intronic
1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG + Intronic
1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG + Intronic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1028458930 7:91069994-91070016 GCAACCAGCTTGGCCAACACAGG - Intronic
1029085616 7:98009403-98009425 GCACCGTGCTCGGCCAGAACTGG + Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG + Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1044624070 8:94218858-94218880 GAACCCTGTTTGTCTAAAAACGG + Intergenic
1047343791 8:124007695-124007717 GTTACCTGCTTGGCTAAAAATGG - Intronic
1050062412 9:1723572-1723594 GCAACCTGCCTGGCTTCAACAGG + Intergenic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG + Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1061603791 9:131692906-131692928 ACAGGCTGCTTGGCTAAAACAGG + Intronic
1187680155 X:21759700-21759722 ACACCCCTCTTGGCTTAAACTGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG + Intergenic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1198811785 X:140543373-140543395 TCACCATCCTGGGCTAAAACTGG - Intergenic
1199734863 X:150676377-150676399 GCACCCTGCTTGGAAATTACTGG - Intergenic
1201354218 Y:13081301-13081323 GCAGCCTGCTTGGCTTGAACTGG + Intergenic