ID: 1085186460

View in Genome Browser
Species Human (GRCh38)
Location 11:74579964-74579986
Sequence GCTGGGAACCAGGGATGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085186449_1085186460 29 Left 1085186449 11:74579912-74579934 CCAATAAATATTTGCTAAGGGCC 0: 1
1: 0
2: 3
3: 29
4: 293
Right 1085186460 11:74579964-74579986 GCTGGGAACCAGGGATGAAAAGG 0: 1
1: 0
2: 4
3: 37
4: 390
1085186454_1085186460 -2 Left 1085186454 11:74579943-74579965 CCAGTTTTAGCCAAGCAGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1085186460 11:74579964-74579986 GCTGGGAACCAGGGATGAAAAGG 0: 1
1: 0
2: 4
3: 37
4: 390
1085186451_1085186460 3 Left 1085186451 11:74579938-74579960 CCATTCCAGTTTTAGCCAAGCAG 0: 1
1: 0
2: 2
3: 15
4: 140
Right 1085186460 11:74579964-74579986 GCTGGGAACCAGGGATGAAAAGG 0: 1
1: 0
2: 4
3: 37
4: 390
1085186450_1085186460 8 Left 1085186450 11:74579933-74579955 CCTGTCCATTCCAGTTTTAGCCA 0: 1
1: 0
2: 3
3: 17
4: 289
Right 1085186460 11:74579964-74579986 GCTGGGAACCAGGGATGAAAAGG 0: 1
1: 0
2: 4
3: 37
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085186460 Original CRISPR GCTGGGAACCAGGGATGAAA AGG Intronic
900422060 1:2560006-2560028 ACTGGGGACCAGGGTGGAAATGG - Intronic
901742301 1:11350285-11350307 GCTGGGATGCAGGGAGGAAGTGG - Intergenic
902759380 1:18571244-18571266 GATGGGAATCAGGGATGAGGAGG + Intergenic
903321564 1:22546552-22546574 CCTGGGAAGAAGGGAGGAAAGGG - Intergenic
903453490 1:23470793-23470815 GGTGGGAAGCAGGGAGGAAGAGG + Intronic
903535289 1:24062787-24062809 GCTGGGAACTGGGGGAGAAAGGG - Intronic
903666190 1:25009051-25009073 GCTGGGAACCAGGGCGGGGAAGG + Intergenic
903996476 1:27308047-27308069 GGTGGGAGGCAGGGAGGAAATGG - Exonic
904677827 1:32209147-32209169 GCTGGGAGCCTGGGAAGAATGGG - Exonic
904683195 1:32242796-32242818 GCTGGGGCCCAGGGATGACTGGG + Intergenic
905279693 1:36841245-36841267 GCTGGGAAGAAGGGATGAGCAGG - Intronic
907447608 1:54519052-54519074 GCTGAGATCCAGGGGTGAGAAGG + Intergenic
907831444 1:58068199-58068221 GCTGGCAGCCAGGGGTGAAGTGG + Intronic
907920669 1:58908595-58908617 GCTGGGCAGGAGGGTTGAAAGGG + Intergenic
908424880 1:63997130-63997152 GCTGAGAATCAAGGCTGAAAAGG + Intronic
908471428 1:64447632-64447654 GCTGGGAAGGTGGGATGAAGGGG + Intergenic
910768276 1:90804552-90804574 GTTGGGAAGCAGGGATGACTGGG + Intergenic
910822379 1:91365199-91365221 GGTGGGAACGGGGGAAGAAATGG + Intronic
911793265 1:102045889-102045911 GATGGGATCAAGGGAGGAAAAGG + Intergenic
912309768 1:108608598-108608620 ACTGGGAAACAGTGATGAACAGG - Intronic
913190442 1:116408768-116408790 GCTGAGCACCAGGGATAAAATGG - Intronic
913613688 1:120534103-120534125 GCTGGGACCTAAGGATGAAAAGG - Intergenic
913695974 1:121326019-121326041 GCTGGAAACCATGGAGGAGATGG - Intronic
914141590 1:144954040-144954062 GCTGGAAACCATGGAGGAGATGG + Intronic
914372915 1:147045955-147045977 GCTGGGACCTGAGGATGAAAAGG - Intergenic
914576579 1:148976778-148976800 GCTGGGACCTAAGGATGAAAAGG + Intronic
915092518 1:153436497-153436519 GCTGGGCACTGGGGATGCAAAGG - Intergenic
917519364 1:175735269-175735291 GCTGTGAGCCAGGGGTGACAGGG - Intronic
918560980 1:185867323-185867345 TTTGGGAACCTGGGAAGAAAGGG + Intronic
919800802 1:201353615-201353637 GCTGAGAACCTGGGATGAGCAGG + Intergenic
919839633 1:201599416-201599438 TCTGGGAAAAAGGGATGGAAGGG - Intergenic
920055115 1:203185667-203185689 GCTGGGGAATAAGGATGAAATGG + Intronic
920483300 1:206344387-206344409 GCTGGAAACCATGGAGGAGATGG - Intronic
920678730 1:208056940-208056962 ACTGGGTCCCAGGAATGAAAGGG - Intronic
921100446 1:211924303-211924325 GGGGGGAAACAGAGATGAAAGGG + Intergenic
921203133 1:212825679-212825701 GCAGGGAGCCAGGGCAGAAAAGG + Intergenic
922463156 1:225828258-225828280 GGTGGGAACCTGGGAGGCAAAGG + Intronic
922470136 1:225871632-225871654 GCTGGGAAACAGGGCTGGAGAGG + Intronic
922881478 1:228984659-228984681 GCAGGGAAGCAGGGTTGAACTGG + Intergenic
923175639 1:231461920-231461942 GCTGGTAACAAGTGATCAAAGGG + Intergenic
923175652 1:231461980-231462002 GCTGGTAACAAGTGATGAAAAGG + Intergenic
923367371 1:233275945-233275967 GCTTGGAACCAGGGAGGCAGAGG + Intronic
923526414 1:234776247-234776269 GCTTGGTTCCAGGGATGAGATGG + Intergenic
1063381652 10:5589598-5589620 ACTAGGAACCAGGGCTGAGAGGG - Intergenic
1064418942 10:15173654-15173676 GCTGGCAAACAGGGAAAAAAGGG - Intergenic
1065205854 10:23357161-23357183 AGTGGGAACCAGGGAAGAACAGG + Intergenic
1065226503 10:23549036-23549058 GCTGGGAACCCCTGATGTAAAGG - Intergenic
1066430195 10:35344133-35344155 GCTGAGAATCAGAGAAGAAATGG - Intronic
1066539429 10:36429262-36429284 TCTGGGAAGCCAGGATGAAATGG - Intergenic
1068405685 10:56585838-56585860 GCTGGGCTCCAGGCAAGAAATGG + Intergenic
1068616960 10:59129495-59129517 ACATGGAAGCAGGGATGAAAAGG + Intergenic
1068801286 10:61143493-61143515 TCTGGGAACCAGAGAAGTAATGG - Intergenic
1068903567 10:62297763-62297785 GCAGGGAACGGGGGATGAGAAGG + Intergenic
1069080349 10:64081913-64081935 ACTGGGAACTAGGGATGTGAAGG + Intergenic
1069162947 10:65112633-65112655 GATGGGCTCCAGGGGTGAAAAGG - Intergenic
1069498826 10:68931218-68931240 GTTGGGCACTAGGGATAAAAAGG - Intronic
1069824242 10:71245596-71245618 GCTGGCTACCAGGGATGAGGTGG - Intronic
1070681472 10:78452099-78452121 GCTGGGCATCAGGGAAGAAGAGG - Intergenic
1071022100 10:81069749-81069771 GCTAGAATCCAGGGATGAACAGG + Intergenic
1072209767 10:93235768-93235790 GCTGTGAACCTGGGCTCAAATGG - Intergenic
1074404815 10:113171836-113171858 GCTGGGAATCACGAATGAACAGG + Intergenic
1074431830 10:113401009-113401031 GCTGGGAAGCAGGGATCCTAAGG + Intergenic
1075107606 10:119551962-119551984 CCTGGGAACAAGGGAAGAAGGGG + Intergenic
1075193300 10:120331094-120331116 GCTGGGAAGAAAGGAGGAAAGGG - Intergenic
1075645767 10:124094842-124094864 GATGGGAAACCGGGATGAGAGGG + Intergenic
1075845984 10:125545265-125545287 GCTGGGCACCGGGGATGCAAAGG + Intergenic
1076238988 10:128888048-128888070 GCTGGGAACCAGGGCTGGAAAGG + Intergenic
1077528301 11:3082232-3082254 GCTGGGCACCAGAGCTGGAAGGG - Intergenic
1077584881 11:3443661-3443683 GCTGTGAGCAAGGGATGCAAAGG + Intergenic
1080018402 11:27532196-27532218 GCTGGGACCCAGGCATCAGAGGG + Intergenic
1080619422 11:33974629-33974651 GATGGCAAACAGGGATGTAATGG - Intergenic
1081810961 11:45913938-45913960 GCTGGGAGGCAGGGAGGACATGG + Exonic
1081841351 11:46203725-46203747 GCTGAGAACCAGGCAAGAGAAGG + Intergenic
1082695990 11:56365255-56365277 GCTTGAAAGGAGGGATGAAAGGG + Intergenic
1083630499 11:64092659-64092681 GCTGGGTACCAGGGAGGCACAGG + Intronic
1083795073 11:65012043-65012065 GGTGGGAACCAGGGAGGATAAGG - Intergenic
1083896314 11:65621671-65621693 CCTGGGATCCAAGGATAAAATGG - Intronic
1084970909 11:72771655-72771677 GCTGGGGACCAGGGAGGGAAGGG - Intronic
1085017743 11:73186236-73186258 GCTGGGGACAAGTGGTGAAAAGG - Intergenic
1085186460 11:74579964-74579986 GCTGGGAACCAGGGATGAAAAGG + Intronic
1085244439 11:75088804-75088826 GCTGAGAAACAGGGATGTAAAGG - Exonic
1088626488 11:111733825-111733847 GAAGGGAACCAGGGATGAGAGGG + Intronic
1089131746 11:116217790-116217812 GCTGAGAACCCGGGAGGAAGAGG + Intergenic
1089310554 11:117555631-117555653 TCTGGGAAGCAGGGATGCACGGG + Intronic
1089573305 11:119423725-119423747 GCTGGGGACCAGGGACGGACAGG - Exonic
1089854948 11:121535423-121535445 GCTGGATACCAAGGATGCAAAGG + Intronic
1090249335 11:125240450-125240472 GCTGGGAAGGAGGGATGGGAGGG + Intronic
1090507943 11:127339586-127339608 GGTGGGAGGCAGGGAGGAAAAGG + Intergenic
1090885510 11:130872790-130872812 GATGGGAACCAGGGAAAGAATGG - Intergenic
1091980353 12:4859633-4859655 GCAGGGATCCAGGGATGGAGAGG - Intergenic
1092102726 12:5899677-5899699 TCTGCAAACCAGGGATGCAAAGG + Intronic
1092284986 12:7123506-7123528 GTTGGGAATGAGGGATGGAATGG - Intergenic
1092915751 12:13187616-13187638 GCAGGGACCCAGGAAAGAAATGG - Intergenic
1092926864 12:13279379-13279401 GAAGGGAAGAAGGGATGAAAGGG - Intergenic
1093260752 12:16934750-16934772 GGTGGTTACCAGGGATGGAATGG + Intergenic
1093423721 12:19004064-19004086 GCTGGAAATCTGGGAGGAAAGGG + Intergenic
1093613909 12:21197112-21197134 GCTGGAAACAAATGATGAAAAGG + Exonic
1093653407 12:21669621-21669643 GTTGAGAACCAGGGAAGCAAAGG - Intronic
1094008337 12:25780029-25780051 GCCAGGAACTAGGGATGAAATGG - Intergenic
1094352231 12:29539936-29539958 TCTGGGAACCAGAGTTGAATAGG - Intronic
1094842883 12:34349338-34349360 GGTGCGAACCAGGGATAACATGG + Intergenic
1094852148 12:34387091-34387113 GGTGTGAACCAGGGATGCCAAGG + Intergenic
1094856112 12:34403563-34403585 GGTGTGAACCAGGGATGACCAGG - Intergenic
1094856195 12:34403935-34403957 GGTGTGAACCAGGGATGCACAGG - Intergenic
1095750887 12:45709550-45709572 GCTGGAAACCAGTGAAGAAGCGG - Intergenic
1096743136 12:53709175-53709197 GCTGGGGAGCAGGGAGGAAAGGG + Intronic
1097035455 12:56120838-56120860 CCTTGGAGCCATGGATGAAACGG - Exonic
1098275606 12:68808543-68808565 GCTGGGAACCAGCGATAGAGGGG - Intronic
1098855855 12:75652661-75652683 ACTGGGAAGCATGGAAGAAAAGG + Intergenic
1099097820 12:78397591-78397613 GTGGGTAACCAGAGATGAAAAGG - Intergenic
1099501872 12:83423225-83423247 GCTAGGAAAGAGGCATGAAACGG + Intergenic
1100234230 12:92642574-92642596 GCTGGGAGCAAGAGAGGAAATGG + Intergenic
1100270954 12:93024011-93024033 GCTGGTTTCCAGGGATGAGAAGG - Intergenic
1100722448 12:97373268-97373290 GTAGGGGACCAGAGATGAAAAGG + Intergenic
1100789391 12:98113719-98113741 GCTGGGCACGAGGGATGCGAAGG - Intergenic
1101673197 12:106896364-106896386 GCTGGCAAGAAGGGAAGAAAGGG + Intergenic
1101693656 12:107104381-107104403 GGTAGGAAGCAGGGAAGAAATGG + Intergenic
1101805483 12:108060041-108060063 CCTGGGTACCAATGATGAAAAGG + Intergenic
1102014362 12:109637935-109637957 GCTGGGAGGGAGGGATGAGAGGG + Intergenic
1102092603 12:110204659-110204681 GCTGAGACCTAGTGATGAAAAGG - Intronic
1102551005 12:113692190-113692212 GCTGGGCTCCAGGGATGCCATGG + Intergenic
1102680662 12:114688278-114688300 GCTGGGATCCTGAGATCAAATGG - Intergenic
1102863291 12:116354813-116354835 GCTGGGCACTAGAGATTAAATGG + Intergenic
1102887556 12:116533458-116533480 GCTTGGTACCAGGGAGGGAATGG + Intergenic
1104134400 12:125923572-125923594 GAGAGGAACCAAGGATGAAATGG + Intergenic
1107216223 13:37922127-37922149 GCTGGGAAACAGGGGTGGGAAGG - Intergenic
1107482226 13:40794584-40794606 GCTGGGAAACAGGGCGGAATGGG + Intronic
1107755954 13:43622654-43622676 GATGGGGATCAGGGATGCAATGG + Intronic
1107828281 13:44350459-44350481 ACTGGGAACAGGGGATGAAAGGG - Intergenic
1108183042 13:47860587-47860609 GCTGGGAGACAGAGATGGAAAGG + Intergenic
1110188259 13:72700563-72700585 GCTGGAAACAAGGTAGGAAAAGG - Intergenic
1110242047 13:73279468-73279490 GCTGAGAAATAGAGATGAAAGGG - Intergenic
1111968628 13:94886874-94886896 GCTTGGCATCAAGGATGAAAAGG - Intergenic
1112244625 13:97720414-97720436 GATGGGAACTGGGGAGGAAAAGG - Intergenic
1112353779 13:98657874-98657896 GCTTGGAGCCTGGGATGAAAAGG + Intergenic
1112551091 13:100421290-100421312 GCTGAGGAACAGGTATGAAAGGG - Intronic
1112825385 13:103386405-103386427 GCTGTGAGCCAGAGAAGAAAAGG - Intergenic
1113141760 13:107160274-107160296 ACTGGGAACCAGGTCTGAATTGG - Intergenic
1113672243 13:112183118-112183140 GCTGGGAGACAGGGAAGAAGAGG + Intergenic
1113730315 13:112636979-112637001 GCTGGGAACCAGGAAAGAAATGG - Intergenic
1115593102 14:34883051-34883073 GCTAGGAGACAAGGATGAAAGGG + Intergenic
1116377638 14:44224238-44224260 ACTGAGAACGTGGGATGAAATGG + Intergenic
1117002192 14:51382149-51382171 GCTGGTGTCCAGTGATGAAAGGG + Intergenic
1119072876 14:71605916-71605938 CCTGGGAAGCAGGCATGATAGGG + Intronic
1119592119 14:75899703-75899725 ACTGGGAACCAGGGACCATAGGG + Intronic
1119863431 14:77953860-77953882 GCTGGGAATAAAGGAGGAAATGG + Intergenic
1121280335 14:92692922-92692944 GCTGGGATCCAGGGCTCAGAGGG + Intergenic
1124402824 15:29365066-29365088 GTTGGGAAAGAGGGATGAAGAGG - Intronic
1125263541 15:37853869-37853891 GCTAGGATTCAGGGATGAATGGG - Intergenic
1126533481 15:49734954-49734976 GCTGGTCACCAGGCAAGAAATGG + Intergenic
1127187041 15:56490849-56490871 GCTGGGTACCATGGAGGAGACGG - Intergenic
1128773261 15:70299848-70299870 GCGGGGAGCCAGGGTTCAAATGG - Intergenic
1128865514 15:71112171-71112193 GCTGGGAACCACAGGAGAAATGG + Exonic
1128937109 15:71756241-71756263 GCTGGGAACCATGGATGGAAAGG + Intronic
1129062036 15:72867842-72867864 GCTGGGAACCAAGCAGGAATTGG - Intergenic
1129101815 15:73272204-73272226 GCTGGGAGTCAGGGATAAACAGG - Intronic
1130915295 15:88300036-88300058 GCTGGTCAGCAGGGGTGAAATGG - Intergenic
1132363186 15:101235276-101235298 CCTGGGCACCACGGAAGAAATGG - Exonic
1133319562 16:4904547-4904569 GCTAAGAACAAAGGATGAAAGGG + Intronic
1134226171 16:12392253-12392275 CCTGGAAACAAGGAATGAAATGG - Intronic
1135843204 16:25895096-25895118 GCCTGGAACCAGGGCTGAGAGGG + Intronic
1137619091 16:49864670-49864692 GCAGGGTACTAGGGATGCAATGG - Intergenic
1137710022 16:50560034-50560056 TCTGGAAACCAGGCATGGAATGG - Intronic
1140724077 16:77796442-77796464 GCTGGGACTCAGGGATGGAGTGG + Intronic
1141560140 16:84862495-84862517 AATGGGAACCAGTGAAGAAATGG - Intronic
1142134453 16:88445189-88445211 GCTGGGAGCCAGGGCTGGAAAGG - Intergenic
1143350173 17:6282303-6282325 CCTGGGAATCAGGAATCAAAAGG + Intergenic
1143458124 17:7080890-7080912 GCAGGGATCATGGGATGAAATGG - Intergenic
1144228293 17:13173476-13173498 GCTGGGACTCAGGGATATAAGGG + Intergenic
1145042002 17:19583907-19583929 GCTGGGAGCCAGGGGTGAGTTGG + Intergenic
1145207015 17:20989965-20989987 AATGGGAACCAGAGATGACAAGG + Intergenic
1145848940 17:28071888-28071910 ACTGTGACCCAGGGATGAAAAGG + Intronic
1145924653 17:28637185-28637207 GCCGGGAACCAAGGCTGACATGG - Intronic
1146469236 17:33110977-33110999 ACTGGGAACCATGGATTTAAGGG - Intronic
1146941294 17:36846061-36846083 CCTGGGCCCCAGGGAGGAAAAGG + Intergenic
1146967773 17:37047499-37047521 GCTGGGGAACAGGGAGGAGAGGG - Intronic
1147177057 17:38662496-38662518 CCTGGGGAGTAGGGATGAAACGG - Intergenic
1147704514 17:42416768-42416790 GCTGGGTTTTAGGGATGAAAGGG + Intronic
1148378420 17:47171808-47171830 GATGGAAAACAGGGAAGAAAGGG + Intronic
1148509415 17:48155979-48156001 CCTGGGCACCAGGCATGACAGGG - Intronic
1148679506 17:49465658-49465680 GCTGAGAAACAGGGAGGAACTGG + Intronic
1148698517 17:49575184-49575206 GCTGGGCCCCTGGGCTGAAAAGG - Intergenic
1148844023 17:50518170-50518192 GCCTGGAACCAGGGAAGCAAGGG - Intronic
1150207954 17:63423248-63423270 GCTGCAAAACAGGGCTGAAAGGG - Exonic
1151815909 17:76471294-76471316 GCTGAGGACCTGGGAAGAAAAGG + Exonic
1151954824 17:77374970-77374992 TCTGGGAAGCAGGGATGCAAAGG - Intronic
1152158006 17:78647600-78647622 GCTGAGAAGCAGTGATCAAACGG + Intergenic
1152660263 17:81538824-81538846 GCTGGCCACCAGGGCTGAGACGG - Intergenic
1152807259 17:82362032-82362054 GCTGGGCGGCAGGGATGAAGGGG - Exonic
1152816880 17:82412958-82412980 GCTTGGACCCAGGGATCACAAGG + Intronic
1155407498 18:25505334-25505356 GCTGAGAACCACTGATGTAATGG - Intergenic
1156609202 18:38706759-38706781 GAAGGGAACCAGTGCTGAAAGGG - Intergenic
1156991303 18:43411238-43411260 GCTGGGGACTGGGGAAGAAATGG - Intergenic
1157415677 18:47500773-47500795 GCAGGGAAACAAGGATGAAGGGG + Intergenic
1157825612 18:50809343-50809365 GCTGGGAAGTAGGGATGGAAAGG + Intronic
1159174403 18:64814736-64814758 GCTGGGACCCAGGGACTACAGGG + Intergenic
1159465565 18:68778729-68778751 GCTGGGAACTGGGGATAAAAAGG + Intronic
1160440062 18:78882956-78882978 GCTAGAAACCAGGGAGGAAGAGG + Intergenic
1160781865 19:881070-881092 CCAGGGAACCAGGGAAGAACGGG + Intronic
1161566621 19:5006168-5006190 GCGGGGAGCCAGGCATGAAGAGG - Intronic
1161938734 19:7388953-7388975 GCTGGGAAGGAGGGCTTAAAGGG - Intronic
1163020385 19:14478227-14478249 ACTGGGAACCAGGGAGGGGATGG + Exonic
1163324966 19:16597598-16597620 GCTGGGAACCAGGAGAGAGAGGG - Intronic
1164432690 19:28201675-28201697 GCTGGGACTCAGCGATGAGATGG - Intergenic
1165271481 19:34711511-34711533 CCTGGGAATCTGGGAGGAAAAGG + Intergenic
1165945246 19:39437849-39437871 TCTGGGATCCAGGGTTCAAAAGG + Intronic
1166099897 19:40565681-40565703 GCTGGGAACCAGGAAGGAGGAGG + Exonic
1167422514 19:49412582-49412604 TCTGGGAACCTGGGATGAGAAGG + Intronic
1167757302 19:51421025-51421047 ACAGGGAAGCAGGGATCAAAGGG - Intergenic
1168259430 19:55185296-55185318 GATGGGAACGAAAGATGAAAAGG - Intronic
925902588 2:8518913-8518935 GCTGGGCTCCTGGGATGAAGAGG - Intergenic
926128088 2:10284216-10284238 GCCGGGATCCAGAGATGAACAGG + Intergenic
926837923 2:17044939-17044961 GCAGGGAGCCAGGGAAGCAAGGG - Intergenic
926975469 2:18512439-18512461 GCAGGAAACCAGAGATGTAAGGG - Intergenic
927451098 2:23210116-23210138 AGTGGGAGCCAGGGAAGAAATGG - Intergenic
927498015 2:23563677-23563699 AATGGGAAGCAGGGCTGAAAGGG - Intronic
927619969 2:24644908-24644930 GCTGGGACACATGGATGAAGAGG - Intronic
928672901 2:33620787-33620809 GTTTGGAATCAGGAATGAAAAGG + Intergenic
928884679 2:36134814-36134836 CCTGAGAACCAGGGAGCAAATGG - Intergenic
929434817 2:41920528-41920550 GATGGGAAACAGAGAGGAAATGG + Intergenic
929935317 2:46290731-46290753 GCAGGGAACCTGGCATAAAATGG - Intergenic
930013846 2:46957524-46957546 GCTGAGACCCAGTGATGAACAGG + Intronic
930025569 2:47027234-47027256 GCTAGGAATCAGGGATGAGGAGG + Intronic
931475028 2:62578894-62578916 GGTTGGAACCAGGAATGAGAAGG + Intergenic
934067832 2:88355670-88355692 TCTAGGCACCAGGGGTGAAATGG - Intergenic
934778471 2:96953922-96953944 GCTGGGAAGCCTGGAGGAAAAGG + Intronic
935559433 2:104545113-104545135 AGTGGGCACCAGGGATGAGAAGG - Intergenic
935600905 2:104920399-104920421 GTTGGCAAGCAGGGATGGAAGGG - Intergenic
936906118 2:117537108-117537130 GCTTAGACTCAGGGATGAAAGGG + Intergenic
937103042 2:119286342-119286364 GCTGGGAAGGTGGGATGGAAAGG + Intergenic
937736249 2:125294368-125294390 GCTGGGAAGCTGGGAGGGAAGGG - Intergenic
939367800 2:141257375-141257397 GCTGGGCTCCAGGGATTACATGG - Intronic
939561972 2:143742979-143743001 GCTGGGACCAGGGGAAGAAAGGG + Intronic
940907213 2:159180033-159180055 GCTGGGATCCAGAAATGAAGAGG + Intronic
940932603 2:159452134-159452156 TCTGGGAAGCAGGGATGCTAAGG - Intronic
941165904 2:162082715-162082737 GGTGGGGAACAGGGATGGAAAGG + Intergenic
941204959 2:162560496-162560518 GCTGGCATCCAGGGTTAAAAAGG + Intronic
942310964 2:174656146-174656168 GCTGGGAAACAGGGATGGCTGGG - Intronic
942473682 2:176291411-176291433 GCTAGGTTCTAGGGATGAAATGG + Intronic
943448743 2:188021537-188021559 GTTGGGAACCAGGGGTTAAGGGG - Intergenic
944344438 2:198644297-198644319 GCTGGGAACCAGTGGTGACTGGG - Intergenic
944344895 2:198651444-198651466 ACTGGGTCCTAGGGATGAAATGG - Intergenic
944513360 2:200485938-200485960 GCTGAGCTCCAGGTATGAAATGG - Intergenic
944563713 2:200966395-200966417 GCTGGAATCCAGGCCTGAAAGGG + Intergenic
944680500 2:202072802-202072824 GTTGAGAACCAGGTATGCAAAGG + Intergenic
944817125 2:203388915-203388937 GCTGAGAAACAGGAAGGAAAAGG - Intronic
946053724 2:216883878-216883900 GCTGGGAGCAAGGGATGGCAGGG + Intergenic
946123621 2:217539239-217539261 GTGGGGAACGAGGGAGGAAATGG + Intronic
946177610 2:217931053-217931075 GCTGGGAACCTGGCATGGAGGGG - Intronic
946832292 2:223739175-223739197 GCTGGGTACTAAAGATGAAAAGG + Intergenic
946876624 2:224136098-224136120 GCTGGGAACTACAGATGAACAGG + Intergenic
947103355 2:226645134-226645156 CCTGGGAACCAGAGGTGAAGGGG - Intergenic
947524507 2:230870074-230870096 GCTGGGCACCAGGGATCCCAAGG + Intronic
947700571 2:232230855-232230877 GCTGGAAAGCAGGGAAGAAGTGG - Intronic
1171104943 20:22423863-22423885 GCTGAGAATCAGGGATAAGAAGG - Intergenic
1171123741 20:22584986-22585008 GCTGTGGACCCGGGAGGAAAGGG - Intronic
1172013965 20:31862122-31862144 CCTGGGAACAAAGGATGAGAGGG - Intronic
1172444009 20:34983883-34983905 GCTGGGAGCCAAGGAAGAAAGGG - Intronic
1173198814 20:40938657-40938679 GCTGGTCACCAGAGCTGAAAAGG + Intergenic
1173563558 20:44023078-44023100 GATGGGAAGGAGGGAGGAAAGGG + Intronic
1174174860 20:48638009-48638031 GCTGTGGCCCAGGGATTAAAGGG - Intronic
1174238970 20:49117634-49117656 GCTGGGGAGCAGTGATGGAAGGG - Intronic
1174657373 20:52182856-52182878 GCTGGGATCCAGTGGTGAACAGG + Intronic
1175134145 20:56810309-56810331 GCTGGGTTCCAGGGATGAAGGGG - Intergenic
1175216171 20:57392598-57392620 GGGGGGAACCAGGGGCGAAAGGG - Intronic
1175262242 20:57681897-57681919 GCTGAGAATGAGGGATGAGAAGG - Intronic
1175880367 20:62254503-62254525 GCTGGGAAGGAGGGAGGAACCGG + Intronic
1176092878 20:63326677-63326699 TCTGGGAACCAGGGCTGAAGTGG + Intronic
1176103599 20:63375641-63375663 GCTGGGATGCAGGGATGGTAGGG - Intronic
1177147859 21:17425754-17425776 GCTGTGATCTAGGTATGAAATGG - Intergenic
1177149082 21:17436596-17436618 TCTGGGAAACTGGAATGAAATGG - Intergenic
1177457481 21:21360575-21360597 GCTATGAACCAGGGGTAAAATGG - Intronic
1179121995 21:38556538-38556560 TCTGGGTACCAAGGAGGAAAAGG - Intronic
1181961643 22:26625941-26625963 TCTGGGTACCAGGGATGGTAGGG + Intronic
1182128855 22:27836128-27836150 GGCGGGAAGCAGGGATCAAAGGG - Intergenic
1182475151 22:30573171-30573193 GCTGGGAGCCAGGGAGGCGAGGG + Intronic
1183070727 22:35394252-35394274 GCAAGAAACCAGGGAGGAAAAGG - Intergenic
1183584203 22:38742738-38742760 GCTGGGAGCCAGGGATCACTGGG + Intronic
1185134517 22:49062173-49062195 GCTGGCAACTGGGGAAGAAATGG + Intergenic
950171709 3:10843369-10843391 GCTGGGAGGCAGGGATCAGAAGG - Intronic
951459451 3:22933595-22933617 ACTGGGAACCAGGCATGAATGGG + Intergenic
953003649 3:38957801-38957823 GCTGGGCACTGGGGATGCAAAGG + Intergenic
953388471 3:42520729-42520751 ACTGGGGTCCAGGGAGGAAAAGG - Intronic
953607956 3:44424203-44424225 GCTGGAAACCAGGCAGGGAAAGG - Intergenic
953627967 3:44586287-44586309 TGTGGGCACCAGGGTTGAAAGGG + Intronic
953809955 3:46103723-46103745 GCTGGGTTCAAGGGGTGAAATGG + Intergenic
956749700 3:72336100-72336122 GCTGGGAACCTGGGATAACTGGG + Intergenic
956906787 3:73774105-73774127 ACTGGGAAACAGTGAAGAAAGGG + Intergenic
957057241 3:75453146-75453168 GCTGTGAGCAAGGGATGCAAAGG + Intergenic
961296212 3:125886589-125886611 GCTGTGAGCAAGGGATGCAAAGG - Intergenic
961312981 3:126015650-126015672 GATGGGAAGCTGGGCTGAAAGGG - Intronic
962967056 3:140365096-140365118 GCAGGAAAACAGGGAAGAAAAGG + Intronic
963233579 3:142934177-142934199 AATGGAAACCAGGGATGAATGGG - Intergenic
963680568 3:148370535-148370557 ACTGAGACCAAGGGATGAAAAGG - Intergenic
964282139 3:155079257-155079279 GCTTGGATTCAGGGAGGAAAGGG + Intronic
964465849 3:156991212-156991234 GATTGGAACCAGGGACAAAAAGG + Intronic
966677879 3:182608996-182609018 GGTGGGGAGCAGGGATGAAGGGG - Intergenic
966759211 3:183401594-183401616 CCTGGGAACCAGGGTTGACTGGG - Intronic
967287354 3:187886152-187886174 GTTGAAAACCAGTGATGAAAAGG + Intergenic
968151227 3:196338245-196338267 GCAGGTAAGCAGAGATGAAAGGG - Exonic
968432804 4:568537-568559 CCTGGGAGCCAGGGAGGAAGTGG - Intergenic
968868407 4:3227994-3228016 GCTGGGTCCCAGGGGGGAAATGG + Intronic
969000075 4:3973504-3973526 GCTGTGAGCAAGGGATGCAAAGG + Intergenic
969163886 4:5287563-5287585 GCTTGGTTTCAGGGATGAAAAGG - Intronic
969753946 4:9135103-9135125 GCTGTGAGCAAGGGATGCAAAGG - Intergenic
970216295 4:13762274-13762296 CCTGGGAAGCAGGCATGACAGGG + Intergenic
970221709 4:13818589-13818611 GCTGGGGACCAGGGGTGAAGAGG - Intergenic
970455279 4:16217251-16217273 GCTGGGTCCCAGTGATGCAAAGG - Intronic
971493186 4:27236167-27236189 GCTGGACACCAAGGATAAAATGG - Intergenic
973839322 4:54844865-54844887 GTGGAGAAGCAGGGATGAAATGG - Intergenic
975455724 4:74587602-74587624 GACAGGAACCAGGGATCAAAGGG - Intergenic
975493672 4:75014873-75014895 GCTGGGAACCTGGGGTGCAGGGG - Intronic
977247444 4:94649432-94649454 GGTAGGAAGTAGGGATGAAATGG - Intronic
977297376 4:95225906-95225928 GCTGGGAATCAGAGAAGAAGGGG + Intronic
977323478 4:95548059-95548081 GGTGGGAAGCAGGCATGAAGCGG + Intronic
977522918 4:98108548-98108570 GATGAGAGCCAGGGATAAAATGG + Intronic
980432958 4:132727762-132727784 GCTTGGAAGCAGTGAAGAAAGGG - Intergenic
981268558 4:142817143-142817165 GATGGGGATCAGGGAGGAAATGG + Intronic
983591661 4:169419144-169419166 GCTAGAAACCAGTGATAAAAAGG + Intronic
984888086 4:184468731-184468753 GCTGGGGAGCAGGGATCCAATGG + Intronic
985506138 5:281600-281622 GCTGGAGACCAGGGAGGAACTGG + Intronic
986282887 5:6337943-6337965 GCTGGGAACCTGGGAGCACACGG - Intergenic
989559866 5:42837756-42837778 GCTCAGAGCCAGGGAGGAAATGG - Intronic
990195438 5:53310041-53310063 GGTGGGAACAGGGGATCAAAAGG + Intergenic
990347226 5:54883025-54883047 TCTGGGAACCAGGCAGGAATGGG + Intergenic
991119316 5:62993481-62993503 GGGAGGAACCAGGGATGAAATGG - Intergenic
992160610 5:73997279-73997301 GCAGGGGGCCATGGATGAAAAGG + Intergenic
992178237 5:74172016-74172038 GCTGAGGATCAGGGATGAGAAGG + Intergenic
992219187 5:74555155-74555177 GTTGGGCACGAGGGATGTAATGG + Intergenic
992671778 5:79068837-79068859 TCTGGGAACCAGGGAAGATGTGG + Intronic
993700373 5:91112250-91112272 GGAGGGAGCCAGGTATGAAAAGG - Intronic
994737189 5:103569656-103569678 GCAGGGAAACAGGGAAGGAAAGG - Intergenic
995410629 5:111853235-111853257 GTAGGGAAGCAGGGATGAATAGG + Intronic
995661966 5:114494999-114495021 GCTGGCAAAGAGGGAGGAAAAGG - Intronic
996366053 5:122702600-122702622 GCTAGGAACCACGCATGAGATGG - Intergenic
996734970 5:126750063-126750085 GCTAGGCACTAGGGATGCAAAGG + Intergenic
997884035 5:137614918-137614940 GCTGGGAACTAGGAATGGGAAGG + Intergenic
998167155 5:139850710-139850732 GCTTGGAGTCAGGGAAGAAAGGG + Intronic
998411527 5:141914943-141914965 GCTGGAACCCAGTGATGGAAGGG - Intergenic
999179797 5:149661371-149661393 GCTGGGGACCATGGAAGACACGG + Intergenic
999623408 5:153494743-153494765 CCTGGCAACTAGGAATGAAAAGG + Intronic
999776362 5:154815640-154815662 CCTGGGAACAAGGGATGAGGAGG + Exonic
1001056522 5:168454541-168454563 GCAGGGAAGCAGGGAGCAAAGGG - Intronic
1001216033 5:169856562-169856584 GCTGAGAGTCAGGGATCAAAGGG - Intronic
1001310062 5:170604101-170604123 GGTGGGAACCAGGGAAGAGGAGG + Intronic
1003733695 6:8854200-8854222 GCTGGGAACCAGCCTTGAGAAGG - Intergenic
1005471462 6:26165804-26165826 CCTGGGAATGAGGGATGAAAAGG + Intronic
1005903972 6:30244365-30244387 GCTGGGAACCATGTAGGAAGGGG - Intergenic
1005995951 6:30931574-30931596 GCTGGGAACAAAGGGTTAAAGGG + Exonic
1006396599 6:33791320-33791342 GCTGGGAATTCAGGATGAAATGG - Intergenic
1006586787 6:35120340-35120362 TCTGGGAACCAGGGAAGAACAGG + Exonic
1006926710 6:37659675-37659697 GCTGGGGAGAAGGGGTGAAAGGG + Intronic
1007813882 6:44506368-44506390 GCTGGGAACTAAGAGTGAAAGGG - Intergenic
1008071196 6:47100726-47100748 TCTGGGAACCAGTTCTGAAATGG + Intergenic
1008203366 6:48620296-48620318 GTTGGGGACCAGTGATGAGAAGG + Intergenic
1010516318 6:76775992-76776014 ACTGGGAATCAGGGATTAAGAGG - Intergenic
1012250124 6:96970601-96970623 GCTGGGTACTGGGGATAAAATGG - Intronic
1013502713 6:110768720-110768742 GGAGGGAACCAGGGATGAAAAGG + Intronic
1015527194 6:134185008-134185030 CCTGGGCACCAGGGATGATGTGG - Intronic
1017459930 6:154639430-154639452 GTTGGGAAACGGTGATGAAACGG - Intergenic
1019196791 6:170287844-170287866 ACTGGGAACTCGGGTTGAAATGG + Intronic
1019659781 7:2217799-2217821 GCTGGGCACCAGGGATGCCATGG - Intronic
1019662978 7:2235557-2235579 GCTGGGATCTATGGAAGAAATGG + Exonic
1019908009 7:4079437-4079459 GAGAGGAACCAGGGAGGAAAGGG - Intronic
1022529203 7:31056694-31056716 GCTGGGGAGCAGAGATGAAGGGG - Intronic
1022799320 7:33760795-33760817 GATGGGAGGCAGGGAAGAAAAGG - Intergenic
1023794860 7:43783224-43783246 GCTGGGAAACAGGGATAGGAGGG - Intronic
1024632724 7:51262775-51262797 GCTGGGATACAAGGATGAAGAGG + Intronic
1025605763 7:63038898-63038920 GCTGGGAAACAGGGTGGACATGG + Intergenic
1025903089 7:65763272-65763294 GGTGGCAACCAGTGCTGAAAGGG - Intergenic
1026593139 7:71713308-71713330 GATGGGGACGAGGGATGAGAAGG + Exonic
1028039444 7:86030696-86030718 ACTGGAAACCAGGGATGGAAGGG + Intergenic
1031152961 7:118075811-118075833 ACTGGCAACCAGCGATGACATGG + Intergenic
1034060889 7:148087772-148087794 TCTGGGAACTAGGGATAAACAGG + Intronic
1034285090 7:149879104-149879126 GTTGGCCGCCAGGGATGAAATGG + Intronic
1034313693 7:150111211-150111233 GCTGCGGTCCAGGGAGGAAAAGG - Intergenic
1034793207 7:153989585-153989607 GCTGCGGTCCAGGGAGGAAAAGG + Intronic
1036377160 8:8210452-8210474 GCTGTGAGCAAGGGATGCAAAGG - Intergenic
1036659885 8:10701078-10701100 GCTGGGGCCCAGAGATGAAAGGG - Intronic
1036736144 8:11318337-11318359 CCCAGGAACCAGGGATGACAAGG - Intronic
1036779185 8:11634086-11634108 GCTGGGAAACAGGGCGGACACGG - Intergenic
1036852386 8:12212697-12212719 GCTGTGAGCAAGGGATGCAAAGG + Intergenic
1036873754 8:12455220-12455242 GCTGTGAGCAAGGGATGCAAAGG + Intergenic
1037655852 8:20883554-20883576 GCTGGGAAGCAGGGATGCTAAGG + Intergenic
1037776812 8:21841009-21841031 GCTGGCAGCCAGGGAGGACAGGG - Intergenic
1038389037 8:27177872-27177894 GCTGGGAATAAGGGGAGAAATGG + Intergenic
1038435466 8:27532584-27532606 GCTGGGAGACAGGCATGAAATGG - Intronic
1038442523 8:27581920-27581942 TCTGGGACCCATGGAGGAAATGG + Intergenic
1039133306 8:34292455-34292477 GTTGGGAAAGAGGCATGAAATGG + Intergenic
1039434446 8:37550065-37550087 TCTGGGACCCAGGGCTGCAAAGG - Intergenic
1039738990 8:40362528-40362550 TCTGGGCACCACGTATGAAAGGG + Intergenic
1041483977 8:58353702-58353724 GCTGAGAAGCAAGAATGAAAGGG + Intergenic
1041720982 8:60975040-60975062 GCTGAGAACCATGGATCATAGGG + Intergenic
1042791214 8:72608297-72608319 GCTGGGAACCAGGCAGGGAGAGG + Intronic
1045651979 8:104349681-104349703 GCTGGGCACCAAGGATGCAAAGG - Intronic
1046565310 8:115892043-115892065 GCTGAGACTCAGGAATGAAAAGG + Intergenic
1047006623 8:120627029-120627051 ACTGGGAGACAGGGAGGAAAGGG + Intronic
1047790565 8:128199405-128199427 TCTGGGAACAAGAGATTAAAGGG - Intergenic
1047807223 8:128373115-128373137 GCTGAGAACCAGGAATGCAGGGG + Intergenic
1047826829 8:128585298-128585320 TTTGGGGGCCAGGGATGAAAAGG + Intergenic
1048285253 8:133136575-133136597 ACTGGCAATGAGGGATGAAAGGG + Intergenic
1048513642 8:135085041-135085063 GCTGAAAACCAAAGATGAAAGGG - Intergenic
1049306993 8:141909266-141909288 ACTAGGAACCAGGGATGCAGTGG + Intergenic
1049806251 8:144541830-144541852 GCTGGGAGCCAGGACTGTAATGG - Intronic
1051791699 9:20811183-20811205 GCTGGGAACGAGGGACACAAAGG + Intronic
1052026459 9:23578236-23578258 CATGGGAAACAGGGAAGAAAAGG - Intergenic
1052255861 9:26455764-26455786 GCTGGGAAATGGGGAAGAAATGG + Intergenic
1052960549 9:34292728-34292750 GCTGGGAGCCAGGGTTCAAAAGG - Intronic
1053196843 9:36126251-36126273 GCTGGGAGGCAGGGAAGGAAAGG - Intergenic
1053375989 9:37606851-37606873 GCAGGGAACCATAGATGTAAGGG + Intronic
1057168358 9:92945694-92945716 GCTGGGACCCAGGAAGGACAGGG + Intergenic
1058040575 9:100297336-100297358 GCTGGGAGGCAGGAATGAAATGG - Intronic
1058071905 9:100609948-100609970 GCTGGAACCCAGGAATGGAAAGG + Intergenic
1059604160 9:115815394-115815416 ACTGAGAACCAGTGAAGAAAAGG - Intergenic
1061394304 9:130335186-130335208 GCTGGCAAACAGGGATGATGTGG - Intronic
1061624202 9:131831581-131831603 GCTGGGAACCAGGGACCGAGGGG - Intergenic
1061662234 9:132137839-132137861 GCTGTGAGTCAGGGACGAAATGG - Intergenic
1061890384 9:133616224-133616246 GCTGGGATGCAGGAATGAACAGG + Intergenic
1061939238 9:133875213-133875235 GCTGGGAACCCGGGTTCACAGGG + Intronic
1185805770 X:3055657-3055679 GCTGGGACAGAAGGATGAAAAGG + Intronic
1187499048 X:19823438-19823460 GCTGGCAGCCAGGAAAGAAATGG - Intronic
1188648218 X:32595482-32595504 GCTGGGAAGCAGGGGTTGAAGGG - Intronic
1189420260 X:40851010-40851032 ACTAGGAAACAGGGATGACAGGG + Intergenic
1190310041 X:49110750-49110772 GCTGAGAACCATGGGGGAAAGGG - Intergenic
1190558452 X:51662578-51662600 GGTGGGAAGAAGGGATGAATTGG + Intergenic
1191898358 X:66016887-66016909 GCTGGAAAGGAGGCATGAAAGGG - Intergenic
1194973185 X:100367015-100367037 GCAGGCAACCAGTAATGAAAAGG + Intronic
1198068130 X:133120177-133120199 TCTGGGAGACAGGGATGAAAAGG + Intergenic
1200071394 X:153531130-153531152 GTGGGGAATCAGGGATAAAAGGG + Intronic
1200088954 X:153625563-153625585 GCCGGGACCCAGGGAGGAGAGGG - Intergenic
1201273270 Y:12276334-12276356 GCTGGGACAGAAGGATGAAAAGG - Intergenic
1201430488 Y:13897249-13897271 GCTGGGAACCAGGGCTGCATGGG + Intergenic