ID: 1085194851

View in Genome Browser
Species Human (GRCh38)
Location 11:74662957-74662979
Sequence AGGGAGAGTGCAGCAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 2, 1: 12, 2: 28, 3: 85, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085194851_1085194866 27 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194866 11:74663007-74663029 AAGGGCACTGCAAGGGGATGAGG 0: 1
1: 0
2: 0
3: 39
4: 407
1085194851_1085194867 28 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194867 11:74663008-74663030 AGGGCACTGCAAGGGGATGAGGG 0: 1
1: 0
2: 1
3: 24
4: 344
1085194851_1085194863 20 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194863 11:74663000-74663022 CTGTACCAAGGGCACTGCAAGGG 0: 1
1: 0
2: 1
3: 11
4: 136
1085194851_1085194861 9 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194861 11:74662989-74663011 ACACAGATTCTCTGTACCAAGGG 0: 1
1: 0
2: 0
3: 25
4: 170
1085194851_1085194862 19 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194862 11:74662999-74663021 TCTGTACCAAGGGCACTGCAAGG 0: 1
1: 0
2: 1
3: 14
4: 153
1085194851_1085194864 21 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194864 11:74663001-74663023 TGTACCAAGGGCACTGCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 109
1085194851_1085194860 8 Left 1085194851 11:74662957-74662979 CCCACAGTTGCTGCACTCTCCCT 0: 2
1: 12
2: 28
3: 85
4: 328
Right 1085194860 11:74662988-74663010 CACACAGATTCTCTGTACCAAGG 0: 1
1: 0
2: 0
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085194851 Original CRISPR AGGGAGAGTGCAGCAACTGT GGG (reversed) Intronic
900794747 1:4701147-4701169 ACGGAGTCTGCAGCAACTTTGGG - Intronic
900864470 1:5257984-5258006 AGCGAGAGAGCAGAAAATGTGGG - Intergenic
904534794 1:31192159-31192181 GTGGAGAGAGCAGCACCTGTGGG - Intronic
904558033 1:31378171-31378193 AGGGGGATTGCAGCTACAGTGGG + Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906694317 1:47814005-47814027 TGTGAGAGTCCAGCAAATGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908002746 1:59696688-59696710 AGGAAAAGTGCAGCAAGTGCAGG + Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909663707 1:78111089-78111111 ATGGAAAGTACAGAAACTGTTGG + Intronic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912096985 1:106157935-106157957 AGGGAGAGATCAACAACAGTTGG + Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913694126 1:121307826-121307848 AGAGAGAGTGAAGGAACTGAAGG + Intronic
914143437 1:144972240-144972262 AGAGAGAGTGAAGGAACTGAAGG - Intronic
915093217 1:153441026-153441048 AAGAAGAGAGCAGCAACTCTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916426463 1:164685856-164685878 AGTGAGAGTTCAGGATCTGTTGG + Intronic
917154578 1:171983108-171983130 AGGGAGAGGGCAGCTACAGAGGG - Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917720791 1:177784767-177784789 AGGAAGAGGGCAGCTACTGCAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
920481453 1:206326213-206326235 AGAGAGAGTGAAGGAACTGAAGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923558863 1:235023305-235023327 ATGGAGTGTGCAGGAACTATAGG - Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1065402221 10:25318279-25318301 AGTGAGAGAGAGGCAACTGTTGG - Intronic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066279008 10:33896937-33896959 TGGGAAAGTTCAGAAACTGTAGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1069403701 10:68075856-68075878 AGGGAGAGTGTAGAAAGTGATGG - Intergenic
1069914722 10:71780389-71780411 AGGGTGAAGGCAGCAATTGTAGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070151526 10:73808212-73808234 TGGGAGACTGCAGCAGCGGTGGG - Exonic
1070742567 10:78912531-78912553 ATATAGTGTGCAGCAACTGTGGG - Intergenic
1070756550 10:78997004-78997026 AGTGAGAGTGCAGCCACATTTGG - Intergenic
1071073671 10:81726467-81726489 AGGAATAGTGCAGCTACTATGGG - Intergenic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072608350 10:97001433-97001455 AGGAGGAGGGCAGCATCTGTGGG + Intronic
1072634637 10:97169958-97169980 AGGGAGAGTCCAGCAACATGAGG - Intronic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1073564582 10:104524237-104524259 AGTGAAAATGCAGCAAGTGTGGG + Intergenic
1073870789 10:107861868-107861890 AGGGAGAGCTCAGCAGCTTTGGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075798853 10:125139991-125140013 AGGGACAGTTCAGCAAGGGTTGG - Intronic
1076865978 10:133166415-133166437 AGGGTGTGTGCACCAAGTGTGGG + Intronic
1078244718 11:9563618-9563640 AGGGCAAGTGCAGCTATTGTGGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078844124 11:15106632-15106654 CTGGAGAGTGCAGCAGCTCTGGG - Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1081591504 11:44426372-44426394 AGGGAGAGGGCAGCCACCCTCGG + Intergenic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086774324 11:90811063-90811085 AGTGAGATTGCAGCACTTGTTGG - Intergenic
1086845745 11:91747814-91747836 AGGTAGAGTCCAGAAACTTTTGG - Intergenic
1087789566 11:102392106-102392128 AGGGTGAGTGAAGGAACTGTGGG - Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088110324 11:106253378-106253400 AGGGAGAGTGCAGGACTGGTGGG - Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090529440 11:127575530-127575552 AGGGAGAGTGCAGGAGATGGAGG + Intergenic
1093122902 12:15294604-15294626 GGAGAAAGTGCAGCAATTGTGGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100755419 12:97746004-97746026 AGGGTGAGTGCAGCCCCAGTTGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1101840597 12:108324975-108324997 AGGTTGAGTGCAGCAACTTTGGG - Intronic
1104948514 12:132428200-132428222 AGGGCGAGAGCAGCAGCTGCTGG + Intergenic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108417096 13:50209004-50209026 AGGGAGCGTGGAGAAATTGTTGG - Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113516601 13:110907390-110907412 AAAAGGAGTGCAGCAACTGTGGG + Intronic
1113625080 13:111789130-111789152 AGGGAGAGGGCAGCATCTTCAGG - Intergenic
1114246502 14:20919442-20919464 AGCGACAGGGCAGCAACTGAGGG + Intergenic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1116490920 14:45502193-45502215 AGGGTGACTGCAGTAACTGCAGG + Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1119071201 14:71586398-71586420 GTGGAGAGTGCAGCAAGTGCAGG + Intronic
1119495191 14:75071736-75071758 TGGGTGAGTGCAGCCACTGTGGG + Exonic
1119850669 14:77864377-77864399 AGGCAGAGAGCAGGCACTGTAGG + Intronic
1119872563 14:78029788-78029810 AGAGAGAGAGCAGAAAATGTGGG - Intergenic
1120463088 14:84821826-84821848 AGGGAATGTGTAGCAACTGAAGG + Intergenic
1122284907 14:100645131-100645153 TGGGAGTGGGCAGCAACTCTGGG - Intergenic
1123034111 14:105464908-105464930 GGGGAGAGAGCAGCAACCTTGGG + Intronic
1123801357 15:23824093-23824115 AAAGAGAGGGAAGCAACTGTAGG - Intergenic
1124472134 15:29997265-29997287 ATGGAGAGTGCAGGAAGTGCAGG - Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128601355 15:68998058-68998080 TGGGTGAGGGCAGCTACTGTGGG - Intronic
1128860642 15:71068474-71068496 AGAGAGTGTGGAGGAACTGTCGG - Intergenic
1128945139 15:71814674-71814696 AGGCAGAGGGCAGCTACTGCAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131302986 15:91216122-91216144 GGGGCGAGTGCAGCAATTGTTGG + Intronic
1133407749 16:5539156-5539178 AGGGAAAGTGCAGGAAGTGCTGG + Intergenic
1134297482 16:12959831-12959853 ATGTAGAGTGCGGAAACTGTTGG - Intronic
1135334911 16:21593138-21593160 AGGGAGAGAGTAGCAGCTGAGGG - Intergenic
1135774753 16:25247202-25247224 ATGGAGAGAGCAGCAGCAGTGGG - Exonic
1136194286 16:28641257-28641279 AGGGACAGGGCATCATCTGTGGG + Intronic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1140954547 16:79849816-79849838 AGGGAGGAAGCAGCAGCTGTAGG - Intergenic
1141485008 16:84333167-84333189 AGGAAGACTGCAGCCACTGGGGG + Intergenic
1142344421 16:89544973-89544995 AGGGGGCGTGCAGCCAATGTGGG - Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148777210 17:50102395-50102417 AGGGAGAGTGCCCCAGCTGCTGG - Intronic
1148780708 17:50119833-50119855 CAGGAGATTGCAGCACCTGTAGG - Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1152452208 17:80388795-80388817 AGGGAGGCCGCAGAAACTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155087363 18:22471433-22471455 AGGAAAAGTGCACCAACTTTAGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155868599 18:30997396-30997418 AGGGAGAGAGGAGCAACAGGGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158437359 18:57442821-57442843 AAGGAGAGTGAAGCAGCTGCTGG - Intronic
1158563879 18:58537824-58537846 AGGGTGAGGGCAGTATCTGTGGG + Exonic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1159918572 18:74207005-74207027 AGGGAGATAGCAGCAGCGGTGGG + Intergenic
1161260512 19:3335402-3335424 AGGGAGAGTGAGTGAACTGTGGG + Intergenic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1163833318 19:19558316-19558338 AGGGAGAGGGCAGGACCTGCCGG - Intergenic
1164463115 19:28465214-28465236 TGGGAGAGTGGAGGAACAGTGGG + Intergenic
1164561115 19:29292923-29292945 AGCGAGAGAGAAGAAACTGTGGG + Intergenic
1166347966 19:42178060-42178082 AGGGAGAGGGCAGGAAGTATAGG + Intronic
1166408459 19:42540421-42540443 AGGGTGAGTGCGGCCACTGGAGG - Intronic
1167972313 19:53196266-53196288 AGTGAGACTGAAGCAACTCTGGG + Intergenic
925042771 2:746434-746456 AGGGAGCGTGCAGCTGCTGCTGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925747365 2:7055008-7055030 AGGAAGAGTAAAGCAACTGCAGG - Intronic
927170510 2:20365538-20365560 AGGAAGAATGCAGCTACTATGGG - Intergenic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
928545055 2:32321965-32321987 AGGGACAGTGCAGCGGCAGTGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932456558 2:71853103-71853125 ACAGAGAGTGCAGGAAGTGTGGG - Intergenic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
934603172 2:95673948-95673970 GGGGAGGGTGCAGCAAGGGTGGG + Intergenic
934777228 2:96947182-96947204 AGGGAGGGTGCAGCCACTAGGGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937628242 2:124068286-124068308 AGACAGAGCGCAGCAACTGGTGG + Intronic
937667009 2:124499361-124499383 ATGGAGAAGGCAGCCACTGTGGG + Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
940569885 2:155417609-155417631 AGTGAGAGAGCCACAACTGTAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
942074462 2:172343813-172343835 AGGGAGGAGGAAGCAACTGTGGG - Intergenic
942814413 2:180034675-180034697 AGGGAAAGTGCGGCAGCTGGGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944238136 2:197459132-197459154 AAGGAGAACGCAGCAACAGTTGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
947229660 2:227871882-227871904 AGGAAGAGTCCAGCATCTGAAGG - Intronic
947439854 2:230109767-230109789 AGGGAGGGTGGGGCAACTGGGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1169782889 20:9328125-9328147 AGGGAGAGTACATCAAATGAGGG + Intronic
1170024264 20:11871986-11872008 AGGGAGTGTGCAGAAGCTGGGGG - Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171231943 20:23493773-23493795 AGGGACAGTGATGCACCTGTTGG - Intronic
1171343607 20:24449050-24449072 AGGGTGAGTGCAGGAGCTGGGGG - Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1174847304 20:53955114-53955136 ATGGAGAAGGCATCAACTGTAGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176086200 20:63296659-63296681 AGGCAGAGTGGAGCAACAGAAGG + Intronic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178495193 21:33080444-33080466 AGGGACAGTGGGGCAGCTGTGGG - Intergenic
1180926743 22:19560224-19560246 GGGGAGGGGGCAGCAACTGGAGG + Intergenic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1185254438 22:49824673-49824695 TGGGAAAGTCCTGCAACTGTGGG - Exonic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951495166 3:23317388-23317410 ACGGAGAGCACACCAACTGTGGG - Intronic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952698057 3:36293544-36293566 GAGGAGAGAGCAGCAACTGAGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953072125 3:39531227-39531249 CGGGAGAGGGCAGCAACAGCAGG - Intergenic
953912373 3:46899511-46899533 AGGGAGAGGGCAGCCCCTGGGGG + Intronic
953918229 3:46934332-46934354 TGGCAGAGTGCAGCAGCTGCTGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955925005 3:63995955-63995977 AGGAAGAGTGAACCAACAGTGGG - Exonic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958134867 3:89475888-89475910 ATGGAGACAGCAGCAACTGGGGG + Intronic
958151544 3:89699717-89699739 AGACAGAGTGCAGCTCCTGTTGG - Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959335979 3:105066000-105066022 GGGGAGGGTGCAGGAACTGGAGG + Intergenic
959409150 3:105998399-105998421 AGGGACAGCACAGCAACTCTGGG - Intergenic
959656986 3:108818597-108818619 AGGGAAAGTGAAGCACCTCTGGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
962193457 3:133335899-133335921 TGTGAGAGTGCAACAATTGTGGG + Intronic
962229866 3:133654109-133654131 AGGAAGACAGAAGCAACTGTGGG + Intronic
962810477 3:138955247-138955269 AGGGAGAGAGCAGGAAGTCTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966294950 3:178408688-178408710 TGGAAGAGTGAAGGAACTGTGGG + Intergenic
967145786 3:186604798-186604820 AGGGACAGGGCAGCTAATGTGGG - Intergenic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968500294 4:946818-946840 AGGGAGAGCGCGGCCCCTGTAGG + Intronic
968500336 4:947000-947022 AGGGAGAGCGCGGCCCCTGTAGG + Intronic
968500366 4:947126-947148 GGGGAGAGCGCAGCCCCTGTAGG + Intronic
968762679 4:2450709-2450731 AGGGAGGGTGCAGGGCCTGTGGG - Intronic
969474101 4:7411502-7411524 AGGGAGAGAGGAGCAAAGGTGGG - Intronic
969661779 4:8534282-8534304 AGGGAGAGTGGAGCATGTGCTGG + Intergenic
971028137 4:22608381-22608403 AGGGAGAGTGGAGCCCCTGGCGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973852661 4:54976759-54976781 AGGGAAAATGCAGCAACTTGGGG + Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976523468 4:86058328-86058350 AGGGGGAGGACAGCATCTGTGGG - Intronic
977339351 4:95738885-95738907 AGGGCTATGGCAGCAACTGTGGG + Intergenic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980562068 4:134490657-134490679 AGGGACATTGCAGTAACTTTGGG - Intergenic
981762388 4:148208667-148208689 AGGCAGAGTGCAGAAACTGCTGG - Intronic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
986076872 5:4346959-4346981 AGGGAGAGAGTAGCTAATGTCGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986941960 5:12964363-12964385 AGGGAGAGAGCAGGAACTTAAGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
990348266 5:54890346-54890368 AAGGAGAGTGGAGCAATTCTAGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991190438 5:63866791-63866813 AAGGAGAGTTTAGCAAATGTTGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992142447 5:73812673-73812695 AGGGAGACGGCAAGAACTGTTGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996675752 5:126172524-126172546 AGGGGGTGTGCTGCAACTGGGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
997607503 5:135185639-135185661 AGGCAGAGCCCAGCAGCTGTGGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999736868 5:154519357-154519379 AGGGAGAAGGGAGCACCTGTGGG - Intergenic
1000092147 5:157939094-157939116 AGGAAGAGTGCCCCAACTATAGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002881244 6:1254416-1254438 AGGGAGAAGGCAGCATCTGCAGG + Intergenic
1005842223 6:29751092-29751114 CGGGGGAGGGCAGCCACTGTTGG + Intergenic
1006058920 6:31404871-31404893 AGGGATGGTCCAGCACCTGTGGG - Intronic
1006071404 6:31499756-31499778 AGGGATGGTCCAGCACCTGTGGG - Intronic
1006336848 6:33425453-33425475 AGGGAGAATGGAGGAACTGAAGG + Intronic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012783124 6:103589062-103589084 AGGGAAAGCGCAGCAATAGTGGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1015134968 6:129858427-129858449 AAGAAGAGTGAAGCTACTGTAGG - Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1017736492 6:157369566-157369588 AGGCAGAGGGCAGCAGCTCTGGG - Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1019162322 6:170076832-170076854 AGGGAGATAGCAGCAGCTGCAGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023883474 7:44334856-44334878 AGGGAGCGTCCAGCAACCGAGGG - Intergenic
1024264677 7:47597603-47597625 TGTGGGAGTGCAGCTACTGTGGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026356065 7:69558554-69558576 TGGGGGAGTGCAGCAAAGGTAGG - Intergenic
1027124689 7:75547990-75548012 AGGGGGAGTGCAGCTGCAGTGGG + Intronic
1027219407 7:76204412-76204434 AGGGAGACAGCAGCACCTTTGGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028033638 7:85950578-85950600 AGTGAGAGTGAAGCAAATCTGGG - Intergenic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028299657 7:89181496-89181518 AGGGAGACTGCAGGGACCGTGGG - Intronic
1028341616 7:89728732-89728754 AGGGCGACTGCAGTAACTATAGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031439397 7:121774501-121774523 AGGGAGAGTTCTGCATATGTTGG - Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031991689 7:128202849-128202871 AGGGACAGTGCAGGATCTGGTGG + Intergenic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034291053 7:149932082-149932104 AGGAAGTGTCCAGCAACTGATGG + Intergenic
1034491506 7:151395545-151395567 AGGGAGAAGGCAGCATCTGCAGG + Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034815047 7:154164856-154164878 AGGAAGTGTCCAGCAACTGATGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1040046072 8:42964985-42965007 AGGCAGAATGCCGCAACTATAGG + Intronic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1042906628 8:73778364-73778386 GAGGCGAGTGCAGCAGCTGTGGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043550780 8:81370059-81370081 TGGGGGAGTGAAGCAACTCTTGG - Intergenic
1043732041 8:83694656-83694678 AGGGAGAGGGCAGCAGATGAAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1047904286 8:129456374-129456396 AGGGAAATTCCAGGAACTGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052984344 9:34475326-34475348 AAGGAGGATGCAGCATCTGTGGG + Intronic
1053367593 9:37534598-37534620 AGTGTGAGTGCAGAAACTCTGGG + Intronic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056522287 9:87412132-87412154 AGAGAGAGTGGAGAAACTGAGGG - Intergenic
1056589258 9:87952223-87952245 AGGGTGAGTGAAGGAACTATGGG - Intergenic
1056935940 9:90914762-90914784 AGAGAGAGTGCAGCAGCAGTGGG - Intergenic
1057443077 9:95096023-95096045 AGGGAGGCTGCAGCCACTCTGGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061271674 9:129547239-129547261 AGGGAGAGTGCAGCCCATGGGGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062054370 9:134463365-134463387 AGGGACACTGCAGCAGCTGCAGG - Intergenic
1187075693 X:15932229-15932251 AGGGAGAATGCAGTACCTGAGGG + Intergenic
1187566804 X:20458685-20458707 AGGCAGTTAGCAGCAACTGTTGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1190598522 X:52068209-52068231 AGGGAGGGTGAAGCAGCTGCAGG + Exonic
1190610302 X:52185864-52185886 AGGGAGGGTGAAGCAGCTGCAGG - Exonic
1190737366 X:53264460-53264482 ATGGAGAGAGAAGCAAGTGTGGG - Intronic
1191194228 X:57704204-57704226 AGGGAGAGTAAGGCTACTGTGGG - Intergenic
1191667313 X:63716736-63716758 AGGTAGAGTGTAGCATCAGTAGG - Intronic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193580368 X:83257105-83257127 AGGAAGAGTGCATCAAGTTTGGG + Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194414517 X:93593870-93593892 AGGGAGAGAGCACCAAGTGATGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199568903 X:149247258-149247280 AGGGCAAGTGTAGCACCTGTGGG - Intergenic
1199595976 X:149505980-149506002 ACAGAGAGAGCAGCAATTGTGGG + Intronic
1199596057 X:149506622-149506644 AGGGAGATGGCAGGAAATGTAGG + Intronic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic