ID: 1085196127

View in Genome Browser
Species Human (GRCh38)
Location 11:74672891-74672913
Sequence TTCCCAAGGCCTGTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085196127_1085196137 19 Left 1085196127 11:74672891-74672913 CCAGTGGGAACAGGCCTTGGGAA No data
Right 1085196137 11:74672933-74672955 AGAGAAACCCAGGATGGGCGAGG No data
1085196127_1085196133 13 Left 1085196127 11:74672891-74672913 CCAGTGGGAACAGGCCTTGGGAA No data
Right 1085196133 11:74672927-74672949 CTGCCCAGAGAAACCCAGGATGG No data
1085196127_1085196138 25 Left 1085196127 11:74672891-74672913 CCAGTGGGAACAGGCCTTGGGAA No data
Right 1085196138 11:74672939-74672961 ACCCAGGATGGGCGAGGAGCCGG No data
1085196127_1085196132 9 Left 1085196127 11:74672891-74672913 CCAGTGGGAACAGGCCTTGGGAA No data
Right 1085196132 11:74672923-74672945 TGTGCTGCCCAGAGAAACCCAGG No data
1085196127_1085196134 14 Left 1085196127 11:74672891-74672913 CCAGTGGGAACAGGCCTTGGGAA No data
Right 1085196134 11:74672928-74672950 TGCCCAGAGAAACCCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085196127 Original CRISPR TTCCCAAGGCCTGTTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr