ID: 1085201564

View in Genome Browser
Species Human (GRCh38)
Location 11:74705257-74705279
Sequence CAGTGACAGCAATAGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 208}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085201550_1085201564 20 Left 1085201550 11:74705214-74705236 CCCCCAGACCCTGTCCCTCCAGA 0: 1
1: 0
2: 6
3: 61
4: 547
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201562_1085201564 -3 Left 1085201562 11:74705237-74705259 CCAGGTCTTGAGAGGGCTGTCAG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201549_1085201564 26 Left 1085201549 11:74705208-74705230 CCAAAACCCCCAGACCCTGTCCC 0: 1
1: 0
2: 4
3: 52
4: 489
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201551_1085201564 19 Left 1085201551 11:74705215-74705237 CCCCAGACCCTGTCCCTCCAGAC 0: 1
1: 0
2: 5
3: 42
4: 438
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201558_1085201564 5 Left 1085201558 11:74705229-74705251 CCTCCAGACCAGGTCTTGAGAGG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201553_1085201564 17 Left 1085201553 11:74705217-74705239 CCAGACCCTGTCCCTCCAGACCA 0: 1
1: 0
2: 3
3: 36
4: 432
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201556_1085201564 11 Left 1085201556 11:74705223-74705245 CCTGTCCCTCCAGACCAGGTCTT 0: 1
1: 0
2: 0
3: 17
4: 216
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201561_1085201564 2 Left 1085201561 11:74705232-74705254 CCAGACCAGGTCTTGAGAGGGCT 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201557_1085201564 6 Left 1085201557 11:74705228-74705250 CCCTCCAGACCAGGTCTTGAGAG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201555_1085201564 12 Left 1085201555 11:74705222-74705244 CCCTGTCCCTCCAGACCAGGTCT 0: 1
1: 0
2: 1
3: 29
4: 227
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208
1085201552_1085201564 18 Left 1085201552 11:74705216-74705238 CCCAGACCCTGTCCCTCCAGACC 0: 1
1: 0
2: 4
3: 43
4: 442
Right 1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085201564 Original CRISPR CAGTGACAGCAATAGGAGTG TGG Intronic
901769800 1:11524466-11524488 GAGTGACAGTAGTAGGAGAGAGG - Intronic
902088905 1:13886736-13886758 CAGCAACAGCAATAGGAGATTGG - Intergenic
902394502 1:16125301-16125323 CAGCGACATCAAGAGGATTGGGG - Exonic
902644431 1:17788637-17788659 AAGAAACAGCAAGAGGAGTGGGG + Intronic
903443230 1:23403914-23403936 CATTGAAAGCAAAATGAGTGTGG - Intronic
903673714 1:25051607-25051629 CAGAGACAGCCAAAGGAGAGGGG + Intergenic
907182765 1:52585424-52585446 AAGTGACAGTAATAAGAGTCTGG + Intergenic
907239201 1:53071320-53071342 CAGTGATCACAACAGGAGTGTGG - Intronic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
911433196 1:97819819-97819841 CTGTGACAGCATTTGGAGTTTGG - Intronic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
915799770 1:158777762-158777784 CAGTAATAGTAATAGTAGTGAGG - Intergenic
916817282 1:168366275-168366297 CACTGACAGCAATTGGAGCAGGG + Intergenic
916993701 1:170273056-170273078 CAGTGTCAGTAGTAGAAGTGGGG + Intergenic
917402007 1:174660181-174660203 CAGGGACAGAAATAGCAGTGGGG + Intronic
917412871 1:174778231-174778253 CAGTGCCAGCAATAAGACAGTGG + Intronic
918005633 1:180539856-180539878 CACTGACAGCAAGAGGAGGTAGG + Intergenic
918270897 1:182898217-182898239 CAGTGGCAGCAACAGAAGGGAGG + Intergenic
920453615 1:206080250-206080272 AAGTGTCAGAAATAGGATTGGGG - Intronic
922072040 1:222204235-222204257 AAGTGGCTGGAATAGGAGTGGGG + Intergenic
1066047529 10:31606347-31606369 CAGTGACAGCCATGGGAGAAAGG - Intergenic
1067829117 10:49599859-49599881 CTGTGACATCACTAGGAGTTTGG + Intergenic
1067940296 10:50649547-50649569 CAGTGCCAGCTATAGGATTTTGG + Intergenic
1068526242 10:58133604-58133626 CAGTGTAGGCAATGGGAGTGAGG + Intergenic
1071263264 10:83940346-83940368 TAATCACAGCAATAGAAGTGTGG + Intergenic
1071680741 10:87703012-87703034 CTGTGCCACCAATGGGAGTGAGG + Intronic
1071750070 10:88465495-88465517 CAGTGCCAGTAAAAAGAGTGAGG + Intronic
1073440592 10:103550297-103550319 GAGGGACAGCTATAGTAGTGGGG + Intronic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1074079300 10:110154969-110154991 CAGTGACAGAAATGGCTGTGGGG + Intergenic
1076617322 10:131764291-131764313 CAGGGGCAGCAAGAGAAGTGAGG - Intergenic
1076906036 10:133361633-133361655 CCGTGACTGCATTAGGAGGGGGG - Intergenic
1077374115 11:2197599-2197621 CCGTGACTGCCACAGGAGTGGGG + Intergenic
1077843296 11:5998019-5998041 CGGTACCAGCAATAGGAGTGAGG + Intergenic
1078448118 11:11420274-11420296 TAGAGACAGCACTAGGAGTTGGG - Intronic
1078766729 11:14305546-14305568 CAGGGAAAGCTATTGGAGTGGGG - Intronic
1079145022 11:17843284-17843306 GAGTGACAGTAAAAGGAGGGAGG - Intronic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1080753601 11:35174107-35174129 AGCTGACAGCAATAGGAGAGGGG - Intronic
1082802154 11:57423069-57423091 CAATGACAGAAAGAAGAGTGAGG + Intronic
1082987904 11:59183758-59183780 CAGTGACAGAGGTAGGAGTAGGG - Intronic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1086157370 11:83682440-83682462 CAGTGACAGTAATTGGTGTTTGG + Intronic
1086815597 11:91366776-91366798 CAGTGACAGAGAAAGGAATGTGG - Intergenic
1087188212 11:95225183-95225205 CACTGAGAGCAAAAGCAGTGGGG - Intronic
1088447356 11:109946425-109946447 CAGTCACAGCCAGAGGAATGCGG - Intergenic
1090932456 11:131310461-131310483 CAGGGACAGCACTAGGTCTGAGG + Intergenic
1091715687 12:2774659-2774681 CAGTGGGAACAATAGGGGTGGGG + Intergenic
1092826474 12:12404541-12404563 CAATGACAGTAATAGGAGGTGGG - Intronic
1093271511 12:17067915-17067937 AAGTGACAGCAAAAGGGGGGGGG + Intergenic
1096761590 12:53846082-53846104 CAGTGACTGCAGTGGGAGGGTGG - Intergenic
1098129047 12:67329071-67329093 CAGTGACTCCAAAAGGAGAGAGG - Intergenic
1098667859 12:73186645-73186667 AATTGACAGAAATAGGAGTCAGG - Intergenic
1104730299 12:131101945-131101967 CAATGACAGCAATAGAGATGTGG - Intronic
1105978356 13:25493796-25493818 CAGGGTCAGGAAAAGGAGTGTGG + Intronic
1107740762 13:43447466-43447488 CAGGGACCACAATAGGAGAGGGG + Intronic
1108156386 13:47589692-47589714 CAGTGACAGGAAAAGGGATGGGG + Intergenic
1109662730 13:65486007-65486029 GAGTGAAAGCAATTGGAGCGGGG + Intergenic
1110188299 13:72700887-72700909 CGGTGAGAGCAATGGTAGTGGGG - Intergenic
1110404439 13:75134093-75134115 CATTGACAGAAATTGGAGTGAGG - Intergenic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1115397285 14:32922547-32922569 AAGTGAGAGAAATAGGAGAGGGG + Intergenic
1115773024 14:36686303-36686325 CAGTGATTGCAGTATGAGTGAGG + Intronic
1115778854 14:36747248-36747270 CAGTAAAGGCAATATGAGTGTGG + Intronic
1118462627 14:66000740-66000762 AAGGGACAGAAATGGGAGTGAGG + Intronic
1118488099 14:66233146-66233168 CAGTGCCAGGAAGAAGAGTGCGG - Intergenic
1119904974 14:78293466-78293488 CAGTAACAGAAATAGGAAGGTGG - Intronic
1120286114 14:82504137-82504159 CTGTGATAGCAAGAAGAGTGGGG + Intergenic
1120894776 14:89519619-89519641 CAATGACACCAATAGGAATAGGG + Intronic
1121441881 14:93954625-93954647 CAGTGGCTGCAAGAGGACTGGGG + Intronic
1123035848 14:105471637-105471659 CAGTGACAGGACTAGGTGTCAGG + Intergenic
1202829047 14_GL000009v2_random:5977-5999 CAGGGACTGGCATAGGAGTGAGG - Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1126279049 15:46921639-46921661 CATTTAAAGCAATAGGAGTTAGG - Intergenic
1126610687 15:50526605-50526627 CAGTGATAGCAATATGTATGTGG - Intronic
1127628059 15:60799762-60799784 CAGAGACTGCAATAGCAGAGAGG + Intronic
1128797490 15:70476406-70476428 GAGTGACAGGAGTAGGTGTGGGG + Intergenic
1130017977 15:80202018-80202040 CAGAGACAGCCACAGCAGTGGGG + Intergenic
1130222501 15:82032411-82032433 GGGAGACAGCAATTGGAGTGGGG - Intergenic
1134022142 16:10928703-10928725 CAGGGACAGCATTTGGGGTGTGG - Exonic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135847611 16:25932956-25932978 CATTGACAGCTAAAGGAGGGAGG - Intronic
1136567429 16:31078742-31078764 CAGTGACAGCATTGGCAGAGTGG - Exonic
1137615462 16:49843803-49843825 TAGGAACAGCACTAGGAGTGAGG - Intronic
1137762718 16:50953546-50953568 CAGAGGCAGAAATTGGAGTGAGG + Intergenic
1138668687 16:58595310-58595332 TAGTGACAGTAATAGTGGTGCGG - Intronic
1139434624 16:66928879-66928901 GAGTGGGAGCAATAGGAGTTGGG + Intergenic
1139667342 16:68466898-68466920 CGGAGACAGAGATAGGAGTGGGG - Intergenic
1141243373 16:82283870-82283892 CAGAGACAGAAATAGAGGTGAGG - Intergenic
1143861031 17:9890767-9890789 CAGGTAAAGCAATAGGAGTTTGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144320098 17:14107810-14107832 CAGTGACAACCATAGTAATGAGG - Intronic
1144885217 17:18453614-18453636 CAGTGTCAGCTACTGGAGTGAGG + Intergenic
1145722811 17:27089102-27089124 CAGCGACGGAGATAGGAGTGCGG - Intergenic
1146677355 17:34782627-34782649 CACTAACAGCAGTAGGGGTGGGG + Intergenic
1147429135 17:40361123-40361145 AAGTGACAACAATAGGTGGGTGG + Exonic
1150839683 17:68596142-68596164 CAGTGACAGCAATAGGTAGGAGG + Intronic
1150951322 17:69805044-69805066 CATTGATAGAAATAGGTGTGTGG + Intergenic
1154188652 18:12208974-12208996 CAGAGCCTGCGATAGGAGTGGGG - Intergenic
1155399701 18:25424583-25424605 GAGTGACAGAAATAGGAGATGGG + Intergenic
1158735598 18:60075551-60075573 CAGTGGCAGCAATGGGTGAGGGG - Intergenic
1160246035 18:77160370-77160392 CAGTCACAGCATTAGGAAAGAGG + Intergenic
1160278417 18:77461992-77462014 AAGTGACAGCAGTAGGTGTCTGG + Intergenic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161680327 19:5676880-5676902 CAGTGACGGTAACAGGTGTGAGG + Intronic
1162059124 19:8084100-8084122 CAGTGGCATCAACAGGACTGGGG - Intronic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165004726 19:32795508-32795530 CACTGACAGGGCTAGGAGTGGGG + Intronic
1166563913 19:43751710-43751732 CAGTGACAGGAATGTGGGTGTGG + Intronic
1166851511 19:45763648-45763670 CAGAGACAGCAAAAGAATTGAGG - Intronic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1167250836 19:48397666-48397688 GAGTGACAGAAACAGGAATGAGG - Intronic
1168638731 19:58016362-58016384 CACTGACACCAATAGAAGTCAGG + Intergenic
928315616 2:30242602-30242624 CAGTGATAGAAATATGGGTGTGG - Intronic
929655949 2:43731899-43731921 CAGGCACAGCAATGGGAGAGGGG + Intronic
931729001 2:65136587-65136609 CATTGGCAGAAATGGGAGTGAGG + Intergenic
933759738 2:85665329-85665351 CAGAGCCAGCAATAGGGGAGAGG + Exonic
938712352 2:133986260-133986282 CAGAGGCAGCAATTGGAGTGAGG - Intergenic
943677882 2:190734514-190734536 TAGTGAAAGGAAGAGGAGTGAGG + Intergenic
945679279 2:212893876-212893898 CAGTGCCAGGAATAGGACTCAGG + Intergenic
946253227 2:218426037-218426059 CAGTGGCAGAAATAAGAGTTAGG - Intronic
948002852 2:234582396-234582418 CAGAGGCAGGAATTGGAGTGAGG - Intergenic
948536815 2:238652781-238652803 CCGTGTCAGCAGTAGGTGTGGGG + Intergenic
948584019 2:239007366-239007388 CAGGGACAGAAAGAGGAATGAGG - Intergenic
1170843282 20:19940991-19941013 GAGTGACAGCTACAGGAGAGTGG - Intronic
1172281507 20:33711064-33711086 CAGTAGCAGCTATAGGAGGGTGG + Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1173250040 20:41359556-41359578 GGGTGACAGCAGTGGGAGTGTGG + Exonic
1173726424 20:45301365-45301387 CAGTGACAGAAATAGGAGCCTGG + Exonic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175838910 20:62014441-62014463 CAGGCACAGCCATGGGAGTGAGG - Intronic
1176608231 21:8850816-8850838 CAGGGACTGGCATAGGAGTGAGG - Intergenic
1176613459 21:9008022-9008044 CAGAGACACCAATAGGGTTGAGG + Intergenic
1181961050 22:26622060-26622082 CAGTGACATCCCTAGGACTGGGG - Intronic
1184288093 22:43483321-43483343 CAGTGACAGCTGGGGGAGTGGGG - Intronic
1203303643 22_KI270736v1_random:94355-94377 GAGTGGCATAAATAGGAGTGGGG + Intergenic
956004596 3:64764866-64764888 GAGTGACAGCAGTTAGAGTGCGG + Intergenic
957355579 3:79081336-79081358 CACTGACAGCCATCTGAGTGTGG - Intronic
957978254 3:87474597-87474619 CTGTGAAAGCAATGGGAGTGGGG + Intergenic
958819731 3:98959390-98959412 CAGTGGCAGCATGGGGAGTGGGG - Intergenic
966402294 3:179560715-179560737 CAGTGACAGCTATAATAATGGGG + Intergenic
967696048 3:192531761-192531783 CAGTGACAGCATCAAGCGTGTGG - Intronic
968170674 3:196507275-196507297 CAGTGATAGCAATAGGAGGCAGG - Exonic
969663594 4:8544525-8544547 CTGTGGCAGGAATGGGAGTGGGG + Intergenic
970137100 4:12936996-12937018 CACAGACAGCAATAGGAGGGAGG - Intergenic
970336854 4:15055965-15055987 CACAGACAGCACTAGGAGTTGGG - Intronic
971375046 4:26049766-26049788 CAGAGAGAGAAATGGGAGTGGGG - Intergenic
971460315 4:26889129-26889151 CAGAGAGAGAAATAAGAGTGGGG - Intronic
972342793 4:38167051-38167073 CAGTGACAGGAAAGGAAGTGAGG + Intergenic
975572424 4:75831793-75831815 CATTCACAGAAAAAGGAGTGGGG - Intergenic
976500017 4:85776580-85776602 CAGTGAAAGCAATAGGAAATTGG - Intronic
976505249 4:85838680-85838702 CAGTTTCAGCAACAGAAGTGGGG - Intronic
976835003 4:89362035-89362057 CAGAGGCAGAGATAGGAGTGAGG - Intergenic
977360931 4:96003498-96003520 CAGCGACAGCAATAGTTGAGAGG + Intergenic
979137934 4:117133752-117133774 CAATGAAAGCAATAAGAGAGTGG + Intergenic
979824583 4:125217501-125217523 CAGTAAAAGCATTAGGGGTGTGG + Intergenic
980771010 4:137373174-137373196 CCCTGACAGCAATAGAGGTGGGG + Intergenic
980882893 4:138731594-138731616 GTGTGAAAACAATAGGAGTGAGG + Intergenic
981503694 4:145478340-145478362 AAGTGACAGAAAATGGAGTGAGG - Intergenic
982273321 4:153614327-153614349 AAGTGAAAGCAATAGGAAGGTGG + Intronic
1202771017 4_GL000008v2_random:207725-207747 CAGGGACTGGCATAGGAGTGAGG + Intergenic
987552668 5:19404251-19404273 AAGTGACACCAGTAGGAATGTGG + Intergenic
988617022 5:32784817-32784839 CAGTGACAGGAATTGTCGTGGGG + Exonic
989624009 5:43412335-43412357 CACTGACAGCAACACAAGTGAGG + Exonic
994380996 5:99071100-99071122 CTGTGACAGGATTAGTAGTGTGG + Intergenic
999435321 5:151559158-151559180 CAGTCATGGCAATGGGAGTGTGG + Intronic
1000233713 5:159338296-159338318 CAGTGAAAGAAATGGGTGTGTGG + Intergenic
1002322721 5:178385116-178385138 CACCCACAGCTATAGGAGTGTGG + Intronic
1003444220 6:6169973-6169995 CAAAGACAGCAATACGAGAGCGG - Intronic
1003578816 6:7320993-7321015 CACTGACAGCAGTGGGAGTAAGG + Intronic
1004262259 6:14118279-14118301 CAGTGACAGGAAGGGGATTGAGG - Intronic
1005360888 6:25029644-25029666 TAGAGACAGCACTGGGAGTGAGG + Intronic
1006618350 6:35344804-35344826 CTGTGAAAGCAATAGGATTGTGG + Intronic
1007816995 6:44531659-44531681 CAGTGAGAGCCATGGCAGTGTGG + Intergenic
1012426241 6:99117838-99117860 AAGAGACAGGAATAGGAATGGGG + Intergenic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1016079417 6:139837547-139837569 CTGTGACACCAATAAGTGTGAGG + Intergenic
1018893987 6:168000688-168000710 GAGGGTCAGCAATGGGAGTGGGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1027490396 7:78817043-78817065 CAGTGACATTAATAGGAATTTGG + Intronic
1029559336 7:101292072-101292094 CAGTGAAGCCAATCGGAGTGAGG - Intergenic
1029954544 7:104623798-104623820 AACTGCCAGCCATAGGAGTGAGG + Intronic
1031880168 7:127188878-127188900 AAGTCACAGGGATAGGAGTGTGG - Intronic
1033770743 7:144548918-144548940 AACTCACAGCAATAGGACTGTGG + Intronic
1034292568 7:149944711-149944733 CAGTGACAGAGAAAGCAGTGGGG - Intergenic
1034813502 7:154152181-154152203 CAGTGACAGAGAAAGCAGTGGGG + Intronic
1034844339 7:154430552-154430574 ATGTGACAGCACTAGGAGGGGGG - Intronic
1035645219 8:1213895-1213917 CTGGGCCAGCAAAAGGAGTGAGG - Intergenic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1039796183 8:40917586-40917608 CAGAGAGAGCAACAGGAGCGTGG + Intergenic
1044289937 8:90455939-90455961 AAGTGACAAAAATGGGAGTGAGG + Intergenic
1047414175 8:124650359-124650381 CAGTTGAAGCAACAGGAGTGTGG - Intronic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1048957217 8:139547065-139547087 CAGTGACAGCAACAGGCTTTAGG - Intergenic
1049993189 9:1009486-1009508 CAGTGAGAGGCACAGGAGTGAGG - Intergenic
1050079128 9:1896731-1896753 CAGGGACAGGAATTGGAGTTTGG - Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053381700 9:37654319-37654341 CAGTGAGAGCCACAGGAGAGAGG + Intronic
1055080458 9:72263712-72263734 CAGTGACAGTAGCTGGAGTGGGG + Intergenic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055242462 9:74200016-74200038 CAGTGAAAGGAATAGTAGAGAGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1061479562 9:130890401-130890423 CAGTGATATCAACTGGAGTGTGG - Intergenic
1062002890 9:134225747-134225769 AAGTGACAGAGAGAGGAGTGGGG + Intergenic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1062420843 9:136481632-136481654 CAGTGGCAGCAAGAGGAGAGGGG - Intronic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1190141006 X:47844353-47844375 CAGAGACAGAAATAGAAGAGTGG - Intronic
1190512982 X:51192942-51192964 CTGTGTTACCAATAGGAGTGGGG - Intergenic
1190594067 X:52035509-52035531 CAGGGACAACACTGGGAGTGGGG - Intergenic
1192730145 X:73794905-73794927 CAGTGAGTGCAATAGGAGGAGGG - Intergenic
1192955446 X:76065088-76065110 CTGAGACAGCACTAGGAGGGTGG + Intergenic
1196683821 X:118494915-118494937 CACTGACTGCACCAGGAGTGGGG - Intergenic
1196683839 X:118494986-118495008 CACTGACTGCACCAGGAGTGGGG - Intergenic
1197141487 X:123122089-123122111 CTCTGACAGCAATGGCAGTGCGG - Intergenic
1197173200 X:123457068-123457090 TAGAGACAGCAAAATGAGTGAGG + Intronic