ID: 1085203788

View in Genome Browser
Species Human (GRCh38)
Location 11:74718080-74718102
Sequence TGCCAAAGGCTGAGCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085203788_1085203794 3 Left 1085203788 11:74718080-74718102 CCCAGGTGGCTCAGCCTTTGGCA 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1085203794 11:74718106-74718128 AATCATGCCAGGTGTGAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 207
1085203788_1085203793 -8 Left 1085203788 11:74718080-74718102 CCCAGGTGGCTCAGCCTTTGGCA 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1085203793 11:74718095-74718117 CTTTGGCAGGGAATCATGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1085203788_1085203799 28 Left 1085203788 11:74718080-74718102 CCCAGGTGGCTCAGCCTTTGGCA 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1085203799 11:74718131-74718153 CCAGCAAGTCCTAGCCTCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 158
1085203788_1085203795 4 Left 1085203788 11:74718080-74718102 CCCAGGTGGCTCAGCCTTTGGCA 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1085203795 11:74718107-74718129 ATCATGCCAGGTGTGAGTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085203788 Original CRISPR TGCCAAAGGCTGAGCCACCT GGG (reversed) Intronic
902642370 1:17775064-17775086 TGCAGAAGGCTGAGCCAGCAGGG - Intronic
903592083 1:24464278-24464300 AGGCAATGGCTGAGGCACCTCGG + Intronic
903818866 1:26085542-26085564 TGCCCAAGGCTGAGCTCCCCTGG + Intergenic
905461011 1:38123068-38123090 TGCCAAACCCTGAGCCACGCCGG + Intergenic
905896080 1:41546607-41546629 TGCCAATGGCTGTGTGACCTTGG - Intronic
907071494 1:51539706-51539728 TGCCCAAGGCTGTGTGACCTTGG - Intergenic
907451228 1:54547222-54547244 TGTCACTGGCTGTGCCACCTGGG + Intronic
907857786 1:58321016-58321038 AGCCAAGGGCTAAGTCACCTGGG - Intronic
910094181 1:83501196-83501218 TGCCAAAGGCTGAGCTGTATTGG + Intergenic
911119404 1:94280325-94280347 TGCCAAAGGCTGTGCCAGGTTGG + Intergenic
911453782 1:98097904-98097926 TGCCAAAGGCTGGGCCCAATAGG + Intergenic
912508504 1:110172731-110172753 TTCCAAAGCCTCACCCACCTTGG - Intronic
912911085 1:113759559-113759581 GGCCAGGGGCGGAGCCACCTCGG - Intergenic
915282354 1:154831174-154831196 AGCCAAAAGCTGGCCCACCTAGG + Intronic
915450846 1:156003910-156003932 TGCCACTGGCTGGGCAACCTTGG + Intronic
915727934 1:158032005-158032027 AGCCGCAGGCTCAGCCACCTAGG - Intronic
919168566 1:193926359-193926381 TGCAAAAGGCACAGCCACTTTGG - Intergenic
919980542 1:202640268-202640290 TGGCAAAGGCAGAGCCAGCAGGG + Intronic
922473625 1:225891104-225891126 TGCCAGAGTCTGAGCTACTTTGG - Intronic
923540943 1:234887780-234887802 GGCAAGAGGCTGAGCCACCTGGG - Intergenic
1067121540 10:43476181-43476203 TCCCCAAGTCAGAGCCACCTAGG + Exonic
1070470277 10:76772562-76772584 TGATAAAGGCTGAGGCAGCTTGG + Intergenic
1070640603 10:78166192-78166214 TGCCCAAGGCTATGCCATCTTGG + Intergenic
1071432747 10:85619140-85619162 GGCCCAAGGCTTAGACACCTTGG + Intronic
1075366282 10:121892898-121892920 TGCCCCAGGCTGAGCCCTCTAGG + Intronic
1075669007 10:124250378-124250400 AGCCACATGCGGAGCCACCTGGG + Intergenic
1077947158 11:6912159-6912181 TGACCAAGGCTGAGTCACGTGGG - Intergenic
1078446841 11:11410988-11411010 TGCCAAGGGCTGTGGCACCCAGG - Intronic
1078720229 11:13877434-13877456 TGCAAAAGGCAGAGGCAGCTGGG + Intergenic
1078920391 11:15825392-15825414 GGCCAACGGATGAGCCACTTTGG - Intergenic
1080584831 11:33672386-33672408 TGCCTATGGGTGAGCCACCCTGG + Exonic
1080880757 11:36318174-36318196 TGGCAAAGGCTGTACCATCTAGG + Intronic
1083365343 11:62138733-62138755 CGCCACAGGCTCAGCCTCCTCGG - Exonic
1083680587 11:64349943-64349965 TGCCAAACACTGAGCTCCCTAGG - Intronic
1083887099 11:65578225-65578247 TGCCGAAAGCTGATCCTCCTTGG + Intronic
1084720544 11:70902837-70902859 TGCCAAGGGCAGAGCCCCCAGGG - Intronic
1085029989 11:73265198-73265220 TGGAAAAGGCAGAGCCACCACGG - Intronic
1085203788 11:74718080-74718102 TGCCAAAGGCTGAGCCACCTGGG - Intronic
1086567000 11:88238713-88238735 TGCTAGAGGCTGATCCACATGGG - Intergenic
1089392748 11:118113195-118113217 TGCCAAAGGCTGGGTCCCCAGGG - Intronic
1096634553 12:52949925-52949947 TGGCTAAGGCTGAGTCATCTAGG + Intronic
1096748811 12:53745846-53745868 TCTCAAAAGCTGAGCCACCCAGG - Intergenic
1102446451 12:113006687-113006709 TGCTGAGGGCTGAGCCACTTTGG + Intronic
1102615066 12:114146475-114146497 TTCCAAAGGCTGAGACACTGAGG - Intergenic
1105327770 13:19385610-19385632 TACCATAGGAAGAGCCACCTTGG - Intergenic
1105644114 13:22298432-22298454 TGCCATAGAGTGAGCCAACTGGG - Intergenic
1106386612 13:29291561-29291583 TGGAAAAGGCAGAGCCACCAGGG - Intronic
1111135129 13:84031747-84031769 GGCCAAAAGCTGAGCCTCTTGGG - Intergenic
1113244514 13:108379514-108379536 TGCCAAATACTGAGTCACTTTGG - Intergenic
1118905910 14:70023056-70023078 TGCCACAGGCTGAGCCGCTGTGG + Intronic
1120655187 14:87180862-87180884 AGCCAAAGGAAGAGACACCTAGG + Intergenic
1121606924 14:95247339-95247361 TGGCCAAGGCTCAGCCATCTTGG + Intronic
1122530620 14:102423608-102423630 TGTCATAGGCTGTGCCATCTAGG + Intronic
1122769638 14:104092268-104092290 AGGCAAAGGCTGAGCCCCGTGGG + Intronic
1126113147 15:45187340-45187362 TGCCAGAAGCTGAGACACCGAGG + Intronic
1126943797 15:53794778-53794800 TTCCAAAGCCTGAGCCTCCAGGG - Intergenic
1129071222 15:72953094-72953116 TCCCAAAGGCTGATCCTCCCAGG + Intergenic
1131065039 15:89429293-89429315 TGCAAATGGCTGTGCCTCCTGGG - Intergenic
1131983549 15:98018591-98018613 TGGCACAGGCTGAGGCACCGAGG - Intergenic
1132367798 15:101270129-101270151 TGCCAAAAGCTGAGGCCCCTGGG - Intergenic
1132618390 16:853221-853243 TGCCCACGGCTGAGCCACTGTGG - Intergenic
1133023377 16:2976692-2976714 TTCCAGAGGCTCAGCCGCCTGGG - Exonic
1133560679 16:6947352-6947374 TGCAAAAGGCTCAGGCACCCAGG - Intronic
1133986909 16:10675783-10675805 GGCCAAGGGCTGAGCTTCCTGGG - Intronic
1134045812 16:11100031-11100053 TGTCATAGGCAGAGCCACCGTGG - Intronic
1136189343 16:28606485-28606507 TGCCAAAGGGTGTGCTACCCAGG - Intronic
1139357015 16:66372594-66372616 CTCCGAAGGCTGAGTCACCTGGG - Intronic
1143474154 17:7193391-7193413 GGCCATAGGCAGAGCCTCCTGGG - Intronic
1143636155 17:8164630-8164652 TCACATAGGCTGAGCCACCCGGG - Intergenic
1145901225 17:28491623-28491645 TGACAAGGGGTGGGCCACCTTGG + Intronic
1146678657 17:34791567-34791589 TGTCAATGGCTGAGCCAACTTGG + Intergenic
1146883672 17:36457318-36457340 TGCCAAAGTCACAGCAACCTGGG + Intergenic
1148368289 17:47072916-47072938 TCCCAAGGACTGAGCCCCCTGGG + Intergenic
1150396908 17:64829429-64829451 TCCCAATGACTGAGCCCCCTGGG - Intergenic
1150497309 17:65617766-65617788 TGCCAAAGGAGCAGCCACGTGGG + Intronic
1150593902 17:66586703-66586725 AGCAAAACACTGAGCCACCTAGG - Intronic
1151519049 17:74615361-74615383 TGCCCAAGGGTGATCCTCCTGGG - Intronic
1152005661 17:77678802-77678824 TACCACAGGCTGTACCACCTGGG - Intergenic
1153667911 18:7382798-7382820 AGCCAGAGGCTGAGCCATGTGGG + Intergenic
1154286292 18:13060157-13060179 TGCAGAAGGCTGTGCCATCTAGG - Intronic
1158234389 18:55296840-55296862 TGCCTAAATGTGAGCCACCTTGG - Intronic
1160165367 18:76506804-76506826 TGCCAGTGGCTGTGCCACCCCGG + Intergenic
1161802833 19:6425368-6425390 AGCCAATGGCTGAGCGACATGGG + Intergenic
1162432043 19:10634944-10634966 GGGCAAAGGCTGAGCCGGCTGGG - Intronic
1162755718 19:12858433-12858455 TGCCTACGGGTGAGCCACCCGGG + Exonic
1167038282 19:47007234-47007256 GGGCAAAGGCTGAGCCATCTGGG + Intergenic
1167129384 19:47573989-47574011 GGGGAAAGGCTGAGCCATCTGGG + Intergenic
926001725 2:9338841-9338863 TCCCAAAGGCTGTGATACCTGGG + Intronic
929485959 2:42354803-42354825 TGCCACAGTCTCAGCCACCATGG + Intronic
930214500 2:48680780-48680802 TACCAATAGCTGAGCCTCCTGGG - Intronic
933891579 2:86776571-86776593 TCCCAAAGGCTAAGCCACTGAGG - Exonic
934651431 2:96093311-96093333 TGCCAGAGTCTCAGCCACCTTGG + Intergenic
934997089 2:98973831-98973853 TCAGAAGGGCTGAGCCACCTGGG - Intergenic
935180860 2:100690175-100690197 TCCCACAGACTGAGCCTCCTTGG - Intergenic
936085789 2:109468175-109468197 TGTCACAGGCTGTGCCATCTAGG - Intronic
936143946 2:109966625-109966647 TGCCAAAACCTGAGTCAACTTGG + Intergenic
936180628 2:110264586-110264608 TGCCAAAACCTGAGTCAACTTGG + Intergenic
936200741 2:110404844-110404866 TGCCAAAACCTGAGTCAACTTGG - Intronic
937071866 2:119069928-119069950 TGCCAAAGGATGAGGCGCCGCGG - Intergenic
937704912 2:124909380-124909402 TGTCATAGGCTGTACCACCTAGG + Intronic
938273123 2:129992894-129992916 TGCCAAAGGCAAAGGCTCCTTGG + Intergenic
938443101 2:131353212-131353234 TGCCAAAGGCAAAGGCTCCTTGG - Intronic
940168376 2:150800203-150800225 GTCCAAAGGCTGAGGAACCTGGG - Intergenic
944235373 2:197437264-197437286 TTCCAAAGGCTGAGCAGCTTGGG - Intergenic
1172682335 20:36726371-36726393 TGCCAAATCCTGAGTCACCCTGG - Intronic
1172931882 20:38592170-38592192 TGCCACAAGCTGAGGCACATTGG - Intergenic
1173836685 20:46130541-46130563 TGGGAAAGGCTGAGACCCCTGGG - Intergenic
1174625746 20:51912950-51912972 GTCCAAAGGCAGAGCCTCCTGGG - Intergenic
1175181935 20:57154635-57154657 TGTAAAAGGTTCAGCCACCTTGG + Intergenic
1175309370 20:58000924-58000946 TGCAGCAGGCTGTGCCACCTGGG + Intergenic
1178019538 21:28393749-28393771 GACCAAAGGCTCACCCACCTTGG - Intergenic
1178745348 21:35244348-35244370 TGCCAGAGACAGAGCCTCCTGGG - Intronic
1180147100 21:45927829-45927851 GGCCACAAGCTGAGCCATCTTGG + Intronic
1181678207 22:24471735-24471757 GGCCTAAGGCTGAGCCTGCTGGG + Intergenic
1184517158 22:44969739-44969761 TGTCATATGCTGAGCCAGCTGGG - Intronic
1184687717 22:46104071-46104093 TGCCTCAGGCTAGGCCACCTGGG + Intronic
950580579 3:13859322-13859344 TGCCAAAAGCTGTGTGACCTTGG + Intronic
955970226 3:64431735-64431757 TTCCAAAGGCCGAGTCACCAAGG + Intronic
956288442 3:67635868-67635890 TGCCAAAGGCTGGGAGACCCTGG - Intronic
960603783 3:119484155-119484177 GGCCAGAGGATGAGCCACGTTGG + Intronic
960845837 3:122003914-122003936 TGGAAAAGGCAGAACCACCTTGG + Intronic
960936114 3:122903683-122903705 TGCCTTAGGCTGGGCCATCTGGG - Intergenic
961809730 3:129514844-129514866 GGGTAAAGGCAGAGCCACCTGGG - Intronic
963573370 3:147026724-147026746 TTCTAAAGGCTTAGCCACCAGGG - Intergenic
965775001 3:172219629-172219651 TGCCAAAGGCTGAGGCAGGAGGG - Intronic
967297927 3:187983678-187983700 TGCCATAGGCTGTGTGACCTTGG - Intergenic
967497555 3:190158831-190158853 TGCCAAAGGGCGGGTCACCTTGG + Intergenic
967766992 3:193291853-193291875 AGCCAAAGGAAGAGACACCTAGG - Intronic
968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG + Intronic
968734709 4:2289459-2289481 TGACAAAGGCTGAGGCCACTGGG + Intronic
969316910 4:6387958-6387980 TGCCAAAGGCCCTGCCACTTAGG - Intronic
969904485 4:10381642-10381664 TGCCTGAGGCTGAGCTGCCTTGG + Intergenic
970321512 4:14879937-14879959 TCCTAAGGGATGAGCCACCTGGG + Intergenic
975676474 4:76832330-76832352 GCCCAAAGGCTGTGGCACCTGGG + Intergenic
976668729 4:87628272-87628294 TGTCTAAGGCTGAGCCATCTGGG + Intergenic
980177552 4:129365144-129365166 TGCCAGAGGCTGAGTCTCTTTGG - Intergenic
981489759 4:145327078-145327100 TGCTCAAGGCTGAGAAACCTGGG - Intergenic
983372963 4:166886861-166886883 TGCCAAAGGCTGAGAGACAGGGG - Intronic
983442791 4:167808882-167808904 TGCCCAAGGCTGAGAAACCTGGG + Intergenic
985105201 4:186492812-186492834 GGCCAAAGACTGAGACACATGGG + Intronic
986858706 5:11903285-11903307 TGCCAGACCCTGAGCCCCCTTGG - Intronic
986930532 5:12814574-12814596 TGCCAAAGGCTGTGGCAGTTGGG - Intergenic
987585706 5:19853403-19853425 TGCCCAAGGCTGAACCCCCAGGG - Intronic
987939247 5:24511461-24511483 TTCCAATGGCTGTGCCAACTGGG + Exonic
992640836 5:78767204-78767226 TGCCAAAGGGTGTTCCAACTGGG + Intronic
997642998 5:135462011-135462033 TGCAAATGGCTGAGCCACGATGG - Intergenic
1002036295 5:176472621-176472643 TCCCAAAGCATGAGCCACCATGG - Intronic
1002397993 5:178972734-178972756 GGCCTGAGGCTGAGCCACGTGGG + Intergenic
1004454504 6:15779337-15779359 TACCAAGGGCTGAGCCATCAGGG - Intergenic
1007412754 6:41674428-41674450 TGGCTAGGGCTGGGCCACCTTGG - Intergenic
1012263982 6:97119147-97119169 TCCCACAGGTAGAGCCACCTAGG - Intronic
1013598858 6:111685463-111685485 TGCCAATGGGGGAGCCACCCTGG + Intronic
1015356442 6:132282426-132282448 AGCCAAAGGCTAAGCCAGATTGG - Intergenic
1017319313 6:153070303-153070325 TGCTAAAAGCTGAACCAACTGGG - Intronic
1019033592 6:169034809-169034831 AGCCAAGGGTTGAGCCATCTGGG + Intergenic
1019594407 7:1851816-1851838 TGCCAAAGGCCAGGCCTCCTAGG + Intronic
1020456570 7:8380356-8380378 TGACAAAGGCTAACCCACCAAGG - Intergenic
1022517929 7:30987579-30987601 CCCCAAAGGCTGAGGCACCAGGG + Intronic
1022802211 7:33787430-33787452 TGCTAAAGGCTGAGCCATATGGG + Intergenic
1023882272 7:44327072-44327094 AGGCAAATGCTGGGCCACCTGGG + Intronic
1024131724 7:46360325-46360347 TGCCAAAGGCTGATCACCTTAGG - Intergenic
1025108175 7:56190442-56190464 TGTCAAAGCTTGAACCACCTGGG - Intergenic
1025248603 7:57336712-57336734 TGCCTGACGCTGAGCAACCTGGG + Intergenic
1029280860 7:99434727-99434749 TGCAAAACACTGAGCCACCAGGG + Intronic
1030526559 7:110661502-110661524 TGCCACGGGCTGAGCCTTCTAGG - Intergenic
1032202249 7:129830284-129830306 TGCCAAGTGCTAAGCCTCCTGGG - Intergenic
1035295517 7:157864992-157865014 AGCCCAAGGCTGTGCCACATAGG + Intronic
1035971543 8:4254824-4254846 TGCCACAGGCTGTACCATCTAGG + Intronic
1037316984 8:17608446-17608468 TGCCAATGCACGAGCCACCTGGG - Intronic
1038971021 8:32635730-32635752 TGCCAAATGCTTAGGTACCTTGG + Intronic
1041588460 8:59547557-59547579 TGCACTAGGCTGAGCCAGCTAGG + Intergenic
1042283467 8:67080749-67080771 AGCCAAAGGTTGAGACACATAGG + Intronic
1042580240 8:70269186-70269208 TGTCAAAGGCTGAACCAACAAGG - Intronic
1044487437 8:92769218-92769240 TGCAAACGGCTGATCTACCTTGG - Intergenic
1045108162 8:98913822-98913844 AGCCACAGGCTGAGATACCTGGG + Intronic
1045268786 8:100644147-100644169 TGCCAAGTGCTGACCCAACTTGG - Intronic
1046170841 8:110502865-110502887 TACCAAAACCTGAGCAACCTAGG - Intergenic
1047799967 8:128298596-128298618 TGCCCAAGTCTGTTCCACCTGGG + Intergenic
1048037842 8:130693900-130693922 TCCCACAGGCAGAGCCTCCTGGG + Intergenic
1049617859 8:143583691-143583713 TGCCACAGCCACAGCCACCTAGG - Intronic
1050213745 9:3296809-3296831 TGCCAAAAACTAACCCACCTCGG + Intronic
1057452495 9:95177147-95177169 TGCAGCAGGCTGAGCCATCTGGG - Intronic
1058079450 9:100686605-100686627 TGCCAAGGTCTCAGCTACCTTGG - Intergenic
1061115649 9:128609536-128609558 TCCCAAATGCTGAGCTTCCTGGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1203490348 Un_GL000224v1:98806-98828 GGCCAAAGGCTGCCGCACCTTGG + Intergenic
1203502971 Un_KI270741v1:40687-40709 GGCCAAAGGCTGCCGCACCTTGG + Intergenic
1186198024 X:7129500-7129522 AGCAAAATGCTGAGCAACCTTGG - Intronic
1190332309 X:49243329-49243351 TCCAACAGGCTGAGGCACCTGGG - Exonic
1193083281 X:77426203-77426225 TGACAGAGGCTGAACCAGCTGGG - Intergenic
1194319777 X:92430450-92430472 TGTCCAAGGGTGAGCTACCTTGG + Intronic
1200627900 Y:5543583-5543605 TGTCCAAGGGTGAGCTACCTTGG + Intronic