ID: 1085207360

View in Genome Browser
Species Human (GRCh38)
Location 11:74744038-74744060
Sequence ATGTGGATGAGGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085207356_1085207360 5 Left 1085207356 11:74744010-74744032 CCATCAGCTAGAGGGAAGTTTTG No data
Right 1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG No data
1085207353_1085207360 25 Left 1085207353 11:74743990-74744012 CCAGCAAGGAGAAGCTGGAGCCA No data
Right 1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085207360 Original CRISPR ATGTGGATGAGGAGTGAGGA AGG Intergenic
No off target data available for this crispr