ID: 1085207927

View in Genome Browser
Species Human (GRCh38)
Location 11:74748237-74748259
Sequence AGCCTAGAGGAACACCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085207920_1085207927 16 Left 1085207920 11:74748198-74748220 CCAGTGCAGCACGCAGAGTGAGA No data
Right 1085207927 11:74748237-74748259 AGCCTAGAGGAACACCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085207927 Original CRISPR AGCCTAGAGGAACACCCACA TGG Intergenic
No off target data available for this crispr