ID: 1085208224

View in Genome Browser
Species Human (GRCh38)
Location 11:74749626-74749648
Sequence TTGGAGGGAAACAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085208219_1085208224 -4 Left 1085208219 11:74749607-74749629 CCTTACGTAAGTCCGAAGTTTGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG 0: 1
1: 0
2: 1
3: 37
4: 299
1085208218_1085208224 2 Left 1085208218 11:74749601-74749623 CCTGTGCCTTACGTAAGTCCGAA 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG 0: 1
1: 0
2: 1
3: 37
4: 299
1085208217_1085208224 3 Left 1085208217 11:74749600-74749622 CCCTGTGCCTTACGTAAGTCCGA 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG 0: 1
1: 0
2: 1
3: 37
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085208224 Original CRISPR TTGGAGGGAAACAGAATTGT TGG Intronic
900750533 1:4394305-4394327 TTGCAGGGAAGCAGATTTGAGGG - Intergenic
901525599 1:9820851-9820873 TTGCAGGGAAACAGGATTTAGGG + Intronic
902722379 1:18312657-18312679 TTGGAGGGAGACAGGAGGGTCGG - Intronic
904102052 1:28039327-28039349 TTGCAGGAAAACAGATTTGGGGG + Intronic
904356042 1:29940623-29940645 TTGGAGGGAAACACTAGTGTTGG - Intergenic
905318270 1:37097304-37097326 TTGGAAGGAGACAGAATGGTGGG + Intergenic
906047370 1:42842431-42842453 TTGGAGGGAAAAAGAATCTTAGG - Intronic
906806464 1:48783501-48783523 TTGGAGGGCCAAAGAAATGTGGG + Intronic
906862328 1:49374990-49375012 TTGGAGGGAAAGAGAGAGGTTGG - Intronic
907117035 1:51978039-51978061 TAGGAGGAAAAGAGAATTCTAGG - Intronic
907913853 1:58851034-58851056 TTCAAGGGAAACAAAATAGTAGG - Intergenic
908133279 1:61099304-61099326 TTGGAGGGAAACAGACAGATTGG + Intronic
908219728 1:61993071-61993093 GTGGTGGGAGACAGTATTGTGGG - Intronic
910598267 1:89003647-89003669 TTTGCTGGAAACAGAATTCTTGG + Intergenic
910747088 1:90585817-90585839 TCAGAAGGAAACAGAATTCTAGG + Intergenic
911499026 1:98662589-98662611 TTGGAGGGAAATTGACTTGTGGG + Intronic
913204679 1:116526629-116526651 TTGAAGGAGAACAAAATTGTAGG - Intronic
914406761 1:147382658-147382680 TTTCAGGAAAACAAAATTGTTGG + Intergenic
915060327 1:153176499-153176521 TTGAAGTGAATCAAAATTGTTGG - Intergenic
917051340 1:170927743-170927765 TCTGAGAGAAACAGAATTTTAGG + Intergenic
917380041 1:174396159-174396181 TTGGAGGAAAAAGGAATTGGGGG + Intronic
917382296 1:174426116-174426138 CTGAAGGGAAACAAAATTGTTGG - Intronic
918355075 1:183700293-183700315 TCTGAGGGAAACATAATGGTTGG + Intronic
919257921 1:195149917-195149939 TTTCAGGGAAACAGAATAATGGG - Intergenic
919887796 1:201947479-201947501 CTTCAGGGAAACAGAATTCTGGG + Intergenic
920128069 1:203709553-203709575 TTGAAGGGAAGCAGAGTGGTCGG - Intronic
920254008 1:204642065-204642087 TTGGAGGGGAGCAGATTTGGAGG + Intronic
923563626 1:235060338-235060360 AAGGAAGGAAACAGAATAGTAGG + Intergenic
923868180 1:237962734-237962756 TGGGAGGGAACCAGAGTTGTTGG + Intergenic
924888674 1:248249442-248249464 ATGGAGAGAAATAGAATGGTTGG - Intergenic
1063284479 10:4670149-4670171 TTTGATGGATACAGAATTCTTGG + Intergenic
1064549257 10:16482252-16482274 TCAGAGGGTGACAGAATTGTAGG - Intronic
1065399421 10:25280348-25280370 TTGAAGGCAAAAAGAACTGTTGG + Intronic
1065881981 10:30044779-30044801 TTGGAGGGAAACAGAAAGGTAGG - Intronic
1067238852 10:44473456-44473478 TGGGAGGGAGACAGACCTGTGGG - Intergenic
1068566739 10:58584292-58584314 TTGGAGGACAACAGAATTCATGG - Intronic
1069150346 10:64952507-64952529 TTGGCTGGATACAGAATTCTTGG + Intergenic
1070443448 10:76469275-76469297 TCGGAGGGAATAAGAAATGTTGG - Intronic
1070748630 10:78950757-78950779 ATGGAGGGAAAGACATTTGTAGG - Intergenic
1072852304 10:98908805-98908827 TTTCTGGGAGACAGAATTGTGGG + Intronic
1073080087 10:100854168-100854190 GGGGAGGGAAACAGAAGTGGGGG - Intergenic
1073091219 10:100941386-100941408 TTGAAGGGATACAGAATTGAAGG - Intronic
1073711157 10:106044060-106044082 TTGTTGGAAAACAGAATTCTAGG - Intergenic
1075637276 10:124037834-124037856 GTGGAGAGACACAGAATTCTAGG + Intronic
1076321340 10:129584200-129584222 TTGCAGGGAAACAGACATGGAGG + Intronic
1076388421 10:130076317-130076339 TTGGTGGGACACAGGAATGTGGG - Intergenic
1076637494 10:131891868-131891890 CTGGAGGGGAGTAGAATTGTGGG - Intergenic
1077934516 11:6769495-6769517 CTGGAGGGAAAGAGAATTCTGGG + Intergenic
1078023683 11:7674380-7674402 TCGGAGGGGAGCAGAATAGTAGG + Intronic
1078514506 11:12010106-12010128 TTGGCGGTAAACAGTAATGTGGG - Intergenic
1079281457 11:19090567-19090589 ATGCAGAGAAACAGAATTGAGGG - Intergenic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1084022764 11:66427608-66427630 TTGGAGGAAAACAGCATTTTTGG - Intergenic
1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG + Intronic
1086217692 11:84403513-84403535 TTGGAGGGAATGAGAACAGTTGG - Intronic
1086994730 11:93342860-93342882 TTTGAGGGAAACACAAATCTAGG + Intronic
1087549944 11:99636560-99636582 TTGAAGGGCAAAAGAAATGTAGG + Intronic
1087842483 11:102934788-102934810 TTGAAAGGAAATAGAAGTGTTGG + Intergenic
1090027757 11:123182307-123182329 TCGGATGGAAACAGAAGTGATGG - Intronic
1090585974 11:128213864-128213886 TTGGAAGGAAATAGCAATGTTGG + Intergenic
1091015662 11:132049079-132049101 TTGAAGGGAAATATAATTGGAGG + Intronic
1092556073 12:9563338-9563360 TTAGAGAGAAACAGAATACTAGG - Intergenic
1094516020 12:31127310-31127332 TTAGAGAGAAACAGAATACTAGG + Intergenic
1095106401 12:38238388-38238410 GTGAAGGGAAACAGATATGTGGG + Intergenic
1095490694 12:42730795-42730817 TTGGGTGGCAACAGAATTCTTGG + Intergenic
1096201087 12:49683659-49683681 TGGGAAGGAACCAGAATTGGAGG - Intronic
1097397884 12:59098204-59098226 TTGAAGAGAAGCAGAATGGTTGG + Intergenic
1100138139 12:91581006-91581028 TAGGAGGCAAAAAGAAATGTTGG + Intergenic
1100615750 12:96230618-96230640 TTGGAGGGATTCAGAGTTGCTGG + Intronic
1100764609 12:97849846-97849868 TTGGAGGGCAACATAACTTTTGG - Intergenic
1101003729 12:100381402-100381424 TTGGAGGTACACAGGATTCTTGG + Intronic
1101436026 12:104665303-104665325 TTGAGGGGAAACAGAACTTTGGG + Intronic
1101837406 12:108305045-108305067 TTGGAGGCTGACAGAATTGGAGG - Intronic
1102462131 12:113106386-113106408 TTGGAGTGAAACAGAATCACAGG - Intronic
1102807386 12:115793976-115793998 TTGGAGGGCAATAGAAATGGTGG + Intergenic
1102930014 12:116855111-116855133 TCAGAGGAAAACAGAATTGAGGG - Intergenic
1103987068 12:124774486-124774508 TTGCAGGGACAAAGAATTGATGG + Intergenic
1104753803 12:131256378-131256400 TTGGGGGGAAACAGCCATGTTGG + Intergenic
1107749484 13:43549012-43549034 TTAGAGGGAAACAGAGTTTGTGG - Intronic
1108085226 13:46782189-46782211 TGGGGGGGTAACAGAATTATGGG + Intronic
1108441574 13:50458769-50458791 TTGTAGGCAAAAAAAATTGTAGG - Intronic
1108613257 13:52105354-52105376 TTGGTGGGAAACAAATTTGTGGG + Intronic
1109059890 13:57601954-57601976 TTGTCAGGAAACATAATTGTAGG - Intergenic
1109169516 13:59077985-59078007 TTCTAGAGAAACAGAAGTGTGGG - Intergenic
1109708031 13:66124948-66124970 TTTGAGGCAAAGATAATTGTGGG - Intergenic
1109713077 13:66184232-66184254 TTCTAGAGGAACAGAATTGTAGG - Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1111017351 13:82398713-82398735 TTGGAGGCAAGCAGAATGTTAGG + Intergenic
1111413316 13:87906089-87906111 TTGGAGATAATAAGAATTGTAGG + Intergenic
1112993994 13:105549724-105549746 TAGGATGGAAACAGGATTGTAGG - Intergenic
1113722474 13:112570070-112570092 TTGGACGGAAACAGACTCCTGGG + Intronic
1113774993 13:112938941-112938963 TTGGAGTGAACCAGACATGTGGG + Intronic
1115488158 14:33932826-33932848 TTGGTAGCAAACAGAATTGATGG + Intronic
1116390430 14:44384438-44384460 GGAGAGGGAAAAAGAATTGTTGG + Intergenic
1119914430 14:78384079-78384101 TTGGAAGGAGACAGAATTACTGG + Intronic
1120496494 14:85243726-85243748 ATGGAGGGAAACTGAATGGCAGG + Intergenic
1120600226 14:86495179-86495201 TTGGAGGGCAATAAACTTGTAGG - Intergenic
1120942185 14:89958945-89958967 TTGATGGTAAACAAAATTGTTGG + Intronic
1121791174 14:96700890-96700912 TTTGAGGAAAAAAGAGTTGTAGG + Intergenic
1122089039 14:99326073-99326095 TCGGAAGGAAACAGAATGGTAGG - Intergenic
1123110019 14:105862765-105862787 TTGGCTGGAAAGAGAACTGTCGG - Intergenic
1123185470 14:106512503-106512525 TTCAATGGATACAGAATTGTGGG - Intergenic
1123196675 14:106623756-106623778 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123196685 14:106623840-106623862 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123847326 15:24315948-24315970 TTGTAGAGAACCAGAATTTTAGG - Intergenic
1123866322 15:24523018-24523040 TTGTAGAGAACCAGAATTTTAGG - Intergenic
1124118677 15:26869694-26869716 GTGGAGGGCAACTGAAATGTTGG - Intronic
1125221917 15:37347761-37347783 TTTGAGGCAAACTTAATTGTGGG - Intergenic
1125486182 15:40112413-40112435 TTGGAGGGATACAGAGTTAAGGG + Intergenic
1126206603 15:46052992-46053014 TTGGCAGGAAACAAAATTCTTGG + Intergenic
1127828925 15:62732629-62732651 TTGGACGGAAACAAAGTGGTAGG + Intronic
1128073363 15:64811001-64811023 TAGGAAGGAAACAGAAATGAAGG + Intergenic
1128237249 15:66076805-66076827 TTGGAAGGAAACAGATTGGATGG - Intronic
1128241211 15:66102230-66102252 TTGCAGGGATACAGCATTGGTGG - Intronic
1128584578 15:68837016-68837038 GTGGAGGGTAACAGAATTCTAGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1129892914 15:79083433-79083455 TTCCAGGGAAACCGGATTGTGGG + Intronic
1131681406 15:94727592-94727614 TGGAAGGGAAACAGAGTTCTCGG - Intergenic
1132134046 15:99315461-99315483 ATGGTGGGAAACAGAATTCTAGG + Intronic
1132159071 15:99519990-99520012 TTGGAGAGAGACAGAGTGGTTGG + Intergenic
1133396303 16:5450210-5450232 CAGGAGGGAGACAGAATTGAAGG - Intergenic
1133588527 16:7219428-7219450 TTGGGGGGAAAGAGAACCGTCGG + Intronic
1133646213 16:7766981-7767003 AGGGAGGGAAAAAAAATTGTAGG + Intergenic
1136994752 16:35181981-35182003 CGGGAGGGAATCAGAATTTTTGG - Intergenic
1137246583 16:46710986-46711008 TTGGAGGCAAGAAGAATTTTTGG + Intronic
1137305535 16:47195984-47196006 TTTGCTGGATACAGAATTGTAGG + Intronic
1139168745 16:64603897-64603919 TTTGATGGAGACAGAATTATAGG - Intergenic
1140632419 16:76870156-76870178 TTGGAGGAAAACAGGACTGGAGG - Intergenic
1143082270 17:4390460-4390482 TGGGAGGGAGACTGAATTTTTGG - Intergenic
1144246015 17:13365651-13365673 ACGGAGGGAGACAGAATTGAAGG - Intergenic
1144334607 17:14257533-14257555 TTGGAAGGAAAGAGAGCTGTTGG - Intergenic
1146644413 17:34567577-34567599 CAGGAGGGAAACAGAGCTGTCGG + Intergenic
1147286555 17:39407161-39407183 AGGGAGGGAAACAGTTTTGTGGG - Exonic
1153105748 18:1524009-1524031 TTTGAGTGAAACAGAATCTTGGG + Intergenic
1153500768 18:5747339-5747361 TTGGAGGGAAAAAGAACAGTTGG - Intergenic
1154129039 18:11720069-11720091 TGCTAGGAAAACAGAATTGTGGG - Intronic
1155068051 18:22285608-22285630 TTGGAGGAGAAAAGAATTATAGG + Intergenic
1156406471 18:36787317-36787339 CTGAAGGGAAACAAAATTTTTGG - Intronic
1156857479 18:41799195-41799217 TTGGAGGTCAGCAGAATTATTGG - Intergenic
1157705746 18:49804266-49804288 TTGGAGAGAACTAGAATTGGTGG - Intronic
1157905139 18:51563157-51563179 TTGGAGGGACTCAGATTGGTAGG + Intergenic
1158471313 18:57739400-57739422 TAGGAAGGAAACAGAAATGTAGG - Intronic
1158935132 18:62357656-62357678 TTGCAGGGAAAGAGACCTGTAGG + Intronic
1159008051 18:63031120-63031142 TTGAAGGAAAACAGAATTTAAGG - Intergenic
1159494133 18:69178695-69178717 TTTGCTGGATACAGAATTGTTGG + Intergenic
1159603369 18:70449858-70449880 TTAGAGGGAGAGAGAATTCTGGG - Intergenic
1159734167 18:72073756-72073778 TGGGACAGAAACAGAATTGGAGG + Intergenic
1159959897 18:74547279-74547301 TAGGAGGGCAATAGAATTCTCGG + Intronic
1160111591 18:76037359-76037381 GTGGAGGCAGGCAGAATTGTGGG - Intergenic
1162160329 19:8709749-8709771 TTAGTGGGAAACACAATTCTGGG - Intergenic
1162575251 19:11495426-11495448 CAGGAGGGAAACAGAATGGAGGG + Intronic
1167037851 19:47004710-47004732 TTGCTGCGAAACAGAATTTTGGG - Exonic
925894789 2:8462944-8462966 CCAGTGGGAAACAGAATTGTGGG + Intergenic
926887974 2:17614945-17614967 GCGGAGGGAAACAGAAGTATTGG - Intronic
929557069 2:42932167-42932189 TTGGGGGGAAACAGGTTTGGTGG + Intergenic
930941959 2:57024545-57024567 TTGGAGGGATATAAAATTATTGG + Intergenic
931584469 2:63810525-63810547 TTGGAGGGAAAAAGAACAGTGGG + Intronic
933524545 2:83418626-83418648 TTGGAAGGATACAAAATTCTTGG - Intergenic
935327361 2:101948919-101948941 TTGGAGGGAAGGAGAAGTTTGGG + Intergenic
937126836 2:119480437-119480459 GTGGAAGGTAATAGAATTGTGGG - Intronic
937156261 2:119721598-119721620 TTGAAGTGAAACAGTCTTGTAGG + Intergenic
937284039 2:120738658-120738680 TTGGAGAGAATTAGAATTATAGG + Intronic
937315016 2:120926585-120926607 CTGGAGGCAAACATAATTATAGG - Intronic
938002762 2:127757662-127757684 TTGGGGGAAAACAGAATTCTGGG + Intronic
938708469 2:133954749-133954771 ATCTAGGGAAACAGAAATGTAGG - Intergenic
939192013 2:138927812-138927834 TTGGAGTGAATCATAATTTTAGG - Intergenic
942182511 2:173393987-173394009 TTGGAGACAATCATAATTGTTGG + Intergenic
946002900 2:216497975-216497997 CTGGAGGGACAGAGAATTGACGG + Intergenic
947353229 2:229268252-229268274 TTGTGGGGACACAGAAGTGTGGG + Intronic
947711201 2:232317116-232317138 TGGAAGGGAAACACATTTGTGGG + Intronic
947816729 2:233042371-233042393 TTGGAGGCAAACTGAACTCTTGG - Intergenic
948144999 2:235702124-235702146 CTGGAGCCAAACAGAATTGGGGG + Intronic
1169380182 20:5099559-5099581 TTGGATGGAAATAGAAATTTGGG - Intronic
1169633106 20:7655888-7655910 TTGAGGGAAAACAGAATTGGTGG + Intergenic
1170852990 20:20020908-20020930 CAGGAGGGAAAGAGAATTGCAGG + Intronic
1171279447 20:23883550-23883572 ATGGAGGGAAAGAGAATCCTTGG + Intergenic
1172969230 20:38861425-38861447 TTGGAGGGACACAGGAGTCTTGG - Intronic
1173087733 20:39940373-39940395 TAGTAGGGAAAAAGAAATGTGGG + Intergenic
1174322088 20:49749988-49750010 TGGGAATGAAACAGAAGTGTGGG + Intergenic
1174807688 20:53618710-53618732 TTGGATTGAAACAGAATAGAGGG - Intergenic
1175246369 20:57584704-57584726 CTGGAGTGAAACAGACTAGTAGG + Intergenic
1175294900 20:57901656-57901678 TCGGAGGGAAGCAGAAATGGAGG + Intergenic
1176007573 20:62874829-62874851 TCGTAGGGAAACATATTTGTAGG - Intergenic
1176089394 20:63312256-63312278 TGGGAGGGCAACAGAACTGCAGG - Intronic
1179418992 21:41221110-41221132 TGGTAGGGAAACAGATTTGGGGG - Intronic
1182160628 22:28117577-28117599 TTGGACCTACACAGAATTGTGGG + Intronic
1182219362 22:28745697-28745719 TTGGACTGAAACAGAAATGCTGG - Intronic
1182478465 22:30590227-30590249 TGTGAGGGATACAGAAATGTGGG - Intronic
1184051326 22:42007525-42007547 TTTAATGGGAACAGAATTGTTGG - Intronic
949231857 3:1759017-1759039 TTGGAGGAATACAAAATTCTTGG - Intergenic
950139078 3:10602762-10602784 TTGGAGGGAAACTGACATGGAGG + Intronic
950854012 3:16088605-16088627 TTGGAAGGAAACTGAAATGGAGG + Intergenic
951360183 3:21715941-21715963 TTTGAGAGAAACAGATTTGAAGG - Intronic
951378147 3:21949188-21949210 TCTTAGGGAAACAGAATTTTTGG + Intronic
951510187 3:23491804-23491826 TTGGAGGGAAGCACAACTGGAGG + Intronic
952738382 3:36712292-36712314 TTGGATGGAAACATAACTGGGGG + Intergenic
953123595 3:40070251-40070273 TTGCAGGGAAACATTAATGTGGG + Intronic
953191186 3:40689473-40689495 TTGGAGGGAACAAGTATTGTTGG - Intergenic
955786102 3:62540573-62540595 ATAGAAGGAAACAGAATTCTAGG + Intronic
956393028 3:68794782-68794804 ATAAAGGGAATCAGAATTGTTGG - Intronic
956764552 3:72473404-72473426 CTGGGGGGAAACAGAAATGAGGG - Intergenic
957995899 3:87689810-87689832 TTGGGGGTAGACAGAATTGGGGG - Intergenic
958546303 3:95555933-95555955 GAGGAGGGAAGCAGAATTGAAGG + Intergenic
958965665 3:100555365-100555387 TTGGAGGGAATTACAATAGTTGG + Exonic
960450697 3:117803795-117803817 CTGGAGGCAAAGAGAATTTTCGG + Intergenic
960740670 3:120830149-120830171 TAAGAGGGAATCAGAAGTGTGGG + Intergenic
961624605 3:128253232-128253254 TCAGAGGGACACAGAGTTGTAGG - Intronic
961643080 3:128376994-128377016 TTGGATGGAAACAAAAGTCTGGG - Intronic
962483039 3:135814399-135814421 TCAGAGGGAAACACCATTGTGGG + Intergenic
962509174 3:136081648-136081670 TTGGCTGACAACAGAATTGTGGG + Intronic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
964119824 3:153171559-153171581 GTGGAAGGTTACAGAATTGTAGG + Intergenic
964802584 3:160571869-160571891 TTGGAGAAAAACAGAATTATAGG + Intergenic
965750104 3:171966845-171966867 CAGGATGGAAACAGAATTGAGGG + Intergenic
965960310 3:174421724-174421746 TTGGAGGGAAAGAAAATGGCAGG - Intergenic
967295762 3:187963212-187963234 TTGGAGGGAAGGAAAATTCTTGG - Intergenic
967580099 3:191142848-191142870 TTGGAAGGAAATAGGATTGGAGG - Intergenic
968486669 4:866281-866303 CTGGTGGGAAACAGAGCTGTGGG - Intronic
968560865 4:1281117-1281139 CTGGAGGGAAAAGGAACTGTGGG - Intergenic
970233599 4:13936018-13936040 TTGGAGGAGAACAAAATTCTTGG - Intergenic
971164865 4:24172554-24172576 CTGAAGGGAGACAGATTTGTGGG - Intergenic
972812337 4:42604118-42604140 ATGGAGGGAAAGAGAATTCTAGG - Intronic
973695654 4:53488110-53488132 TTGTAGGGAAATTGAATTATAGG - Intronic
973933677 4:55819445-55819467 AGGGAGGGAAAGAGACTTGTTGG + Intergenic
974375710 4:61073368-61073390 TTGGAGCGAGAGAGAATTGCTGG - Intergenic
977115194 4:93015692-93015714 TAGGAGTAAAACAGAATTGTGGG - Intronic
980199240 4:129633401-129633423 TAGGATTTAAACAGAATTGTAGG - Intergenic
981017979 4:139994166-139994188 TTGGAATGAAACAGAATTTTGGG - Intronic
981223259 4:142261640-142261662 GTGGAGGGAGACAGAACAGTGGG - Intronic
981690306 4:147500686-147500708 TTGGAAGGAAAAAAAAATGTTGG + Intronic
982626297 4:157770627-157770649 TCGGAGGAAAGCAGAATTCTAGG - Intergenic
983521373 4:168712407-168712429 CTGGAGGGAAGCAGGCTTGTGGG + Intronic
987614464 5:20254444-20254466 TTGGTGGGAAATAAAATTCTTGG - Intronic
988798126 5:34671318-34671340 TTTGAGTGAAATAAAATTGTGGG + Intronic
989177011 5:38538107-38538129 TTAGAGGGAAACAGAAAAGGTGG - Intronic
989401052 5:41008050-41008072 ATGCAGGGAAACAGAATGATGGG + Intronic
990058655 5:51618857-51618879 GTGAAGGGAAAGAGAATGGTTGG + Intergenic
991477827 5:67042269-67042291 TTGTGGGGTAACAGAATTTTAGG - Intronic
992839185 5:80670475-80670497 TTGGTGGGAACCAGACTTGGTGG + Intronic
993165545 5:84349513-84349535 TTGGTGACAAACATAATTGTGGG + Intronic
994347075 5:98699853-98699875 TTGGGGAGAAACAAAATGGTTGG - Intergenic
995267117 5:110175176-110175198 TAGGAGGTAAACAGAATCGATGG + Intergenic
995442185 5:112204267-112204289 TTGGAGAGAAACAGTAATGTCGG + Intronic
995808121 5:116077068-116077090 TTGGAGAGGAGCAGAATTGGAGG - Intergenic
996957502 5:129201693-129201715 TTAGAGGGAAACAGAATGTAAGG - Intergenic
996991831 5:129643444-129643466 TGGGAGGGAAGTAGAATTGATGG + Intronic
997857257 5:137383443-137383465 CGGGATGGAAACAGATTTGTGGG + Intronic
998580104 5:143364269-143364291 TTGGCAGGATACAGAATTCTTGG - Intronic
998684130 5:144504954-144504976 TTTTTGGGAAACAGAAGTGTGGG + Intergenic
998868710 5:146531431-146531453 TTTGAGTGAAACAGAATTTCTGG + Intergenic
999165195 5:149543420-149543442 TTGAAGGGAAACTGAATTCATGG - Intronic
999584860 5:153079117-153079139 TTAGAGGGAAATGGAATTGAGGG - Intergenic
1000990167 5:167903680-167903702 TTGAAAGGAGACAGAATAGTAGG + Intronic
1001034216 5:168285619-168285641 TTGCAGGGAAAGAGAATAGCAGG - Intergenic
1003571286 6:7258190-7258212 TGGTATGGAAACAGAATTCTAGG - Intergenic
1004194679 6:13492347-13492369 ATGGAGGGAAAGAAAATTTTAGG - Intergenic
1004431490 6:15549106-15549128 TTGGAGTTAAACAAAATTGTAGG - Intronic
1004549333 6:16631508-16631530 TTGGAATGATACAGAATTTTTGG - Intronic
1005359141 6:25014113-25014135 CCAGAGGGAAACAGAATTTTAGG + Intronic
1005499676 6:26418822-26418844 TTGAAGTGAAAGGGAATTGTAGG + Intergenic
1005612989 6:27544726-27544748 TTAGAGGGAAAAACAAATGTGGG + Intergenic
1008327475 6:50201422-50201444 TTGGAAGGAAAGAGAAAAGTAGG - Intergenic
1008849338 6:56005758-56005780 TTGGTGGGAAACAGGAGTTTGGG + Intergenic
1008911712 6:56740578-56740600 TTGTAGGGAAACATAAGAGTTGG - Intronic
1009375450 6:62962638-62962660 TTTTAGGGACACAGAATTCTGGG + Intergenic
1010068224 6:71710939-71710961 TTGGAGAGATACAAACTTGTTGG + Intergenic
1010174112 6:73006861-73006883 TTGCACAGAAATAGAATTGTAGG - Intronic
1010787461 6:80021122-80021144 TTGGAGGTCAACAGAATTCAAGG - Intronic
1012828488 6:104177883-104177905 TTGGAGGGAAACAGATTTTGAGG - Intergenic
1013880044 6:114886865-114886887 CTGCATGGCAACAGAATTGTAGG - Intergenic
1014911277 6:127096443-127096465 GTGGAGAGAGACAGAATTGTCGG + Intergenic
1015825744 6:137309648-137309670 TTGGAGAGAAACACAACTGTAGG - Intergenic
1018327706 6:162691501-162691523 TTGGTGGGACACAGAATGGGAGG - Intronic
1021574464 7:22094623-22094645 TTGAAGGGAAGCAGAGTTGATGG - Intergenic
1021823814 7:24526540-24526562 TTGGAGAAAAACAAAATTGGAGG + Intergenic
1022866176 7:34423476-34423498 TGGGAAGGGAACAGAATTATGGG + Intergenic
1023224039 7:37950489-37950511 TTGGAGAGAAATATAATTTTAGG + Exonic
1023262297 7:38370293-38370315 CTGGAGGGAGACACAATGGTGGG - Intergenic
1023521489 7:41054294-41054316 ATCCAGGGAAACAGAAGTGTAGG - Intergenic
1024214613 7:47237584-47237606 CTGGAGGGAAACATAATTTCAGG + Intergenic
1024452668 7:49565423-49565445 TTGGAAGGATACAAAATTCTTGG - Intergenic
1025858197 7:65302743-65302765 TGGGAGAGAAACAGAATCATAGG - Intergenic
1026354446 7:69545124-69545146 TTGGAGGGAAAGAGCCTTGCAGG + Intergenic
1028193755 7:87880889-87880911 TTGGAGAGGAACAGAAATGTAGG + Intronic
1028209367 7:88054464-88054486 TTGAAGGAAAACAGACTGGTGGG - Intronic
1028240773 7:88417917-88417939 TTGGCGGGATAGAGAATTCTGGG + Intergenic
1029885296 7:103863479-103863501 TTGCAGGGATACAGGATTTTTGG - Intronic
1030657800 7:112186840-112186862 TTGGAGGGTAACAAAATTTCAGG + Intronic
1031192803 7:118576266-118576288 TTGGATGGAAACATAAATCTGGG + Intergenic
1032346050 7:131117942-131117964 TAGGACAGAAACAGAATTGCAGG + Intronic
1032802782 7:135329750-135329772 TTGTGGGGACACAGACTTGTTGG + Intergenic
1034817950 7:154190099-154190121 ATGGAGGGATAAAGAATTGAAGG + Intronic
1035551563 8:531489-531511 TCAGAAGGAAACTGAATTGTAGG + Intronic
1035731445 8:1856433-1856455 TTTGAAGGAAACAGATTTTTAGG - Intronic
1036499787 8:9303194-9303216 TGGGAGGAATACAGAATTGCAGG - Intergenic
1038161968 8:25048195-25048217 TTGGTGGGAAAGAAAATAGTGGG - Intergenic
1038380883 8:27092520-27092542 TTGGAGAGAAACAGAATATATGG - Intergenic
1039709198 8:40038765-40038787 TTGGAGGGAGACAGGTATGTGGG - Intergenic
1041009852 8:53530971-53530993 TTGGTGGGCAGCAGAAATGTTGG - Intergenic
1041201858 8:55457466-55457488 TTTGATGGACACAGAATTCTTGG - Intronic
1041725619 8:61014782-61014804 TTGGAAGGACACAGCATAGTTGG + Intergenic
1043913277 8:85889984-85890006 TTGGAGAGAAAAAGCAATGTTGG - Intergenic
1045409463 8:101902912-101902934 TTGGAGAGCAACACAGTTGTTGG - Intronic
1046411844 8:113855211-113855233 TTGGAGGGTAAAGAAATTGTGGG - Intergenic
1046854241 8:119011417-119011439 TTGAAGGAAAGCAGAATTGGAGG - Intronic
1047457878 8:125032514-125032536 TTGGAGGGAATGACAATTCTGGG + Intronic
1051150768 9:14076620-14076642 TAAGAGGGAAACAGTTTTGTTGG - Intergenic
1052362433 9:27575237-27575259 TTGGGGGGAAAGAAAATTGTAGG + Intergenic
1052650221 9:31292389-31292411 TTGGTGGGATACAAAATTCTTGG - Intergenic
1053064925 9:35061372-35061394 TTAGAGTAAATCAGAATTGTTGG - Intronic
1055240861 9:74183958-74183980 TTGGAAGGAAACAGCTTTGGAGG + Intergenic
1055740423 9:79382458-79382480 TTTGTGGGAAACAGAATGGGAGG - Intergenic
1058136822 9:101316668-101316690 TTGGCAGGAAACAGAAAAGTGGG + Intronic
1059381698 9:113932242-113932264 TTGGTGGGGAACAGCATTCTAGG + Intronic
1061188207 9:129067487-129067509 TTGGAGGGACACAGAATGTGAGG - Intronic
1186386072 X:9111512-9111534 TTGGAGGGTAAAAGAGATGTTGG + Intronic
1186607685 X:11109217-11109239 TGGGAGAGACACAGGATTGTGGG + Intergenic
1186847830 X:13548683-13548705 TTGGAGAGGCAAAGAATTGTGGG - Intergenic
1187252542 X:17611899-17611921 TTGAAGAGAACCAGAATTTTTGG + Intronic
1187470046 X:19561547-19561569 GTGGCGGGAAAGAGAAATGTTGG - Intronic
1188500897 X:30824979-30825001 TTGAAAGAAAACAGAATTGGGGG + Intergenic
1188824706 X:34817548-34817570 TTGGAGGGCTACAGAATGATTGG + Intergenic
1189060199 X:37745697-37745719 TTGGAGGGGAACAGAAGTGGTGG - Intronic
1192372823 X:70529216-70529238 TTGAGGGGAAAAAGAAATGTGGG + Intronic
1192856138 X:75014352-75014374 TTGGAGGGAGGGAGAATTTTAGG - Intergenic
1194001565 X:88435880-88435902 TTTGATGGACACAGAATTCTTGG - Intergenic
1195725122 X:107906884-107906906 TTGAAGAAAAAAAGAATTGTTGG - Intronic
1197754967 X:129986938-129986960 TTTGAGAGAAACAGAATTATGGG + Intronic
1198444521 X:136698638-136698660 TTGGATGAATACAGAATTCTTGG - Intronic
1198523876 X:137480113-137480135 TTGAAGGGAAATTGTATTGTGGG + Intergenic
1199589835 X:149457032-149457054 TTGGAGTGAGACAGGATTGGAGG - Intergenic
1199917760 X:152362601-152362623 TTGGATGGAAACAAGATTTTAGG + Intronic
1199981551 X:152923343-152923365 TGGGAGGGAGACAGAAATGCTGG + Intronic
1201099060 Y:10657615-10657637 TTGGAGGGGAATGGAATGGTAGG - Intergenic
1201099947 Y:10663882-10663904 TTGGAGGGGAATGGAATGGTAGG - Intergenic
1201102449 Y:10688275-10688297 TTGGAGGGGAATGGAATGGTAGG - Intergenic
1202178068 Y:22115817-22115839 TTGGCTGGAAACTGAATTCTGGG + Intergenic
1202213293 Y:22470578-22470600 TTGGCTGGAAACTGAATTCTGGG - Intergenic